ID: 965697121

View in Genome Browser
Species Human (GRCh38)
Location 3:171420815-171420837
Sequence CTACTAAGTAGACTAAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965697121 Original CRISPR CTACTAAGTAGACTAAAGGG AGG Intronic
904735082 1:32625624-32625646 CTACTCAGGAGACTGAAGTGGGG + Intronic
906527267 1:46501762-46501784 CTACTCAGGAGGCTAAAGTGAGG - Intergenic
906642328 1:47449016-47449038 CTGTTCAGTAGACTAGAGGGAGG - Intergenic
907436473 1:54452479-54452501 CTACTAAGGAGGCTGAAGTGAGG + Intergenic
911310923 1:96291016-96291038 CCAGTAAGTAGGCTACAGGGAGG - Intergenic
916502324 1:165397454-165397476 CTGCTTAATAGACTAAAGGAAGG + Intergenic
919318839 1:196007905-196007927 GTAGTAAGGAGACTAAAGAGAGG - Intergenic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
924842003 1:247721646-247721668 CTACTAAAAAAACAAAAGGGAGG + Intergenic
1063868277 10:10390527-10390549 CTGCTAAGTAGCCTTAAGGAAGG + Intergenic
1065458237 10:25930231-25930253 CTAATAAGGAAACTGAAGGGAGG - Intergenic
1069268326 10:66491912-66491934 CTACTCAGAAGACTAAAATGGGG - Intronic
1071209002 10:83316726-83316748 CTGATGAGTAGACTGAAGGGAGG + Intergenic
1075570362 10:123537353-123537375 CTGCTAATAAGACTAAAGAGGGG + Intergenic
1078053253 11:7985529-7985551 CTACTAAGCACCCAAAAGGGAGG + Intronic
1081148085 11:39589083-39589105 CTACTAAGTACACTAAATAAAGG + Intergenic
1081497602 11:43631183-43631205 CTACAAAGGAGACTGAAGGTTGG + Intronic
1085957873 11:81422098-81422120 CTAATAAGTAGACATAAAGGAGG + Intergenic
1086095525 11:83046602-83046624 CTACTCAGGAGACTAAGGTGGGG - Intronic
1086299889 11:85415836-85415858 ATACTAACTAAACTAAAGAGTGG + Intronic
1086355419 11:85993195-85993217 CTACTCAGAAGGCTAAAGTGGGG - Intronic
1086915911 11:92529941-92529963 CTCCTAAGTCGCCTAAAGTGGGG - Intronic
1093076360 12:14762602-14762624 CTACAGAGAAGACTAAAGAGAGG + Intergenic
1094358329 12:29602250-29602272 CTACTCAGGAGACTAAGGTGGGG - Intronic
1095203511 12:39412603-39412625 CTACTCAGAAGACTGAGGGGTGG + Intronic
1096802735 12:54122073-54122095 CTACTGTGTAGCCTAAAGCGGGG + Intergenic
1097602868 12:61715806-61715828 CTACTCAGGAGGCTACAGGGAGG + Intronic
1098523610 12:71461477-71461499 ATAATAAATAGACTAAAAGGCGG - Intronic
1102714123 12:114955245-114955267 CTACTCAGGAGGCTAAAGTGGGG - Intergenic
1103221612 12:119251057-119251079 CTAATAAGTGGACAAAAGGCTGG + Intergenic
1103757481 12:123220451-123220473 CTACTCAGGAGACTTAAGGCAGG + Intronic
1106110772 13:26774780-26774802 TTCTTAAGTAGACTAAAGGTGGG - Intergenic
1109565170 13:64103980-64104002 CTCCAAAGCAAACTAAAGGGAGG + Intergenic
1115674536 14:35656121-35656143 TTACTAAGAAGACTACAGGCTGG + Intronic
1118070434 14:62241175-62241197 CTACTAAGCAGAATAAAGAAGGG + Intergenic
1120246041 14:82008096-82008118 ATCCTAAGGAGACAAAAGGGCGG - Intergenic
1121160629 14:91736364-91736386 CTACTCAGTAGGCTAAGGGCAGG + Intronic
1125025963 15:35029682-35029704 TTATTAAGTAGCCTAAAGGTTGG + Intergenic
1125638485 15:41209302-41209324 CTACTCAGGAGGCTAAAGTGAGG + Intronic
1127125977 15:55812467-55812489 CTACTAAATATACAAAAGCGGGG + Intergenic
1127402112 15:58599076-58599098 CTACTTAGGAGGCTAAAGTGGGG + Intronic
1127494829 15:59500406-59500428 CTACTCAGGAGACTAAAGTTGGG - Intronic
1129509174 15:76108025-76108047 CTACCCAGCAGCCTAAAGGGTGG + Intronic
1131907085 15:97154567-97154589 CTACTCTGTGTACTAAAGGGAGG + Intergenic
1133381980 16:5338765-5338787 CTACTCAGGAGGCTAAAGTGGGG - Intergenic
1134462939 16:14445671-14445693 CTACTAAGGAGACTGAAGTAGGG - Intronic
1135710295 16:24710821-24710843 CTACTAAGGAGACTGAAGCAGGG - Intergenic
1135762399 16:25147798-25147820 CTACTCAGAAGGCTAAAGTGAGG - Intronic
1138737437 16:59266626-59266648 CTACTAAGTAGATGAAAGATGGG + Intergenic
1140657603 16:77156526-77156548 CTACTCAGGAGGCTAAAGGTGGG + Intergenic
1150145995 17:62770016-62770038 CTACTAAGTGCACTAAGGAGGGG - Intronic
1157849700 18:51036755-51036777 CCACTAACTAGAATCAAGGGTGG - Intronic
1158874746 18:61722776-61722798 CTAAAAAGTAGTCTAAAGGATGG - Intergenic
1158987863 18:62837091-62837113 CTACTCAGAAGTCTAAAGTGGGG - Intronic
1160100352 18:75915066-75915088 CTATTAAGGAGAATAAAGGCCGG - Intergenic
1162190766 19:8944749-8944771 ATACTACGTAGACGTAAGGGAGG - Intronic
1165566544 19:36734214-36734236 CTACTTAGGAGGCTAAAGGCAGG + Intronic
1166488337 19:43233871-43233893 CTACTCAGGAGGCTAAAGGGAGG + Intronic
1168276186 19:55279959-55279981 TTGCTAAGGAGACCAAAGGGCGG - Intronic
925592884 2:5527538-5527560 CTCTTAAGTAGACTAAAGGTGGG + Intergenic
927778883 2:25923658-25923680 CTACTCAGGAGGCTAAAGGCAGG - Intergenic
929221299 2:39467463-39467485 TTCCTGAGAAGACTAAAGGGGGG + Intergenic
929560037 2:42950826-42950848 CTACTAAGAAGTCTAGAGGCAGG - Intergenic
929677894 2:43955859-43955881 TTACTAAGAAGACTATGGGGTGG - Intronic
940217261 2:151314023-151314045 CTTCTAGATAGACTTAAGGGTGG - Intergenic
940590702 2:155721645-155721667 CTACTCAGGAGGCTGAAGGGAGG + Intergenic
943751259 2:191511750-191511772 CTACTTAGTAGGCTAAGGGAGGG + Intergenic
944804662 2:203269342-203269364 CTACTCAGGAGACTGAGGGGAGG + Intronic
946942432 2:224783718-224783740 GTACTAAATAGACTGAGGGGGGG - Intronic
947868139 2:233415732-233415754 CTACTCAGTAGGCTAAGGTGCGG - Intronic
1169899744 20:10540762-10540784 CTACAAAGAGGAATAAAGGGAGG - Intronic
1171116161 20:22526493-22526515 CTACTCAGGAGACTGAGGGGAGG + Intergenic
1182425370 22:30268736-30268758 CTACTCAGGAGACTAAGGCGGGG - Intergenic
1183124667 22:35764618-35764640 CTAATATCTAGAATAAAGGGGGG - Intronic
1184342881 22:43895745-43895767 CTACTGAGTGGAGTAACGGGGGG - Intergenic
951188848 3:19745896-19745918 CTACCAAGTAGAGTCAAGCGTGG - Intergenic
951396185 3:22169903-22169925 CTACTTAGTAGGCTAAAGTGGGG - Intronic
956812026 3:72872755-72872777 CTACTCAGGAGGCTAAAGTGGGG - Intergenic
957261667 3:77909851-77909873 CTAATAAGTAGACTTAAGAGTGG + Intergenic
957486921 3:80873378-80873400 ATACTAGGCAGACTAGAGGGTGG + Intergenic
959418574 3:106105957-106105979 CTACTAAGGAGACTGAGGGGTGG - Intergenic
960230734 3:115223615-115223637 CTACTCAGTAGGCTGAAGTGGGG - Intergenic
960690311 3:120340309-120340331 TAACTAACTAGACTAAAAGGTGG - Intronic
963679517 3:148356284-148356306 CTATTAAGGAGGCTAAAGTGGGG + Intergenic
965697121 3:171420815-171420837 CTACTAAGTAGACTAAAGGGAGG + Intronic
970390150 4:15600788-15600810 CTACTCAGGAGGCTAAAGTGGGG + Intronic
973960691 4:56107081-56107103 CTACTCAGTAGGCTAAAAGGGGG - Intergenic
976404966 4:84652981-84653003 CTACTCAGGAGGCTAAAAGGTGG - Intergenic
976945349 4:90759016-90759038 CCAGTAAGAAGACAAAAGGGAGG - Intronic
977314537 4:95429096-95429118 CTACTCAGTAGACCAAATGCAGG + Intronic
979237065 4:118412843-118412865 CACATTAGTAGACTAAAGGGGGG - Intergenic
980921434 4:139090170-139090192 CTACTCAGGAGACAAATGGGAGG - Intronic
982888759 4:160819857-160819879 CCCCTAAATAAACTAAAGGGAGG + Intergenic
984904229 4:184611800-184611822 CTAATAAGTTGACTGAAGGCTGG - Intergenic
986689294 5:10300689-10300711 CTACTCAGAAGACTGAAAGGAGG + Intronic
986808906 5:11335053-11335075 CTACTAAGAAGACAAGAAGGAGG - Intronic
993879887 5:93349599-93349621 CTAATATGAAGATTAAAGGGTGG - Intergenic
996321859 5:122226801-122226823 CAACTAAGTAAACAAAATGGTGG + Intergenic
996330801 5:122326641-122326663 CAATTAAGTAGAGTCAAGGGAGG + Intronic
1003833556 6:10041930-10041952 TTACTTCGTAGACTAAAGAGGGG + Intronic
1004124668 6:12861284-12861306 CTATTCAGAAGACAAAAGGGAGG + Intronic
1007638526 6:43316463-43316485 CTACTTAGGAGACTGATGGGGGG - Intronic
1009548626 6:65056479-65056501 CTACTCAGGGGACTAAGGGGAGG + Intronic
1021138566 7:16995067-16995089 CAACTAATTAGACCAAAGGTGGG + Intergenic
1027909417 7:84229980-84230002 GAACTGAGTAGAGTAAAGGGGGG - Intronic
1028184030 7:87759685-87759707 CTACTTGGGAGACTAAGGGGAGG + Intronic
1037168014 8:15854413-15854435 TTACTAAGTAGTCAAGAGGGAGG + Intergenic
1037380353 8:18278278-18278300 CTACTTAGTAGCCTAAGGGAAGG + Intergenic
1038635150 8:29280343-29280365 CTACTAAGTAGGCTGAGGAGGGG + Intergenic
1056844464 9:90025328-90025350 TTACCAAGTAGCCCAAAGGGTGG + Intergenic
1058564326 9:106265601-106265623 CTACTCAGGGGAATAAAGGGAGG + Intergenic
1058989546 9:110241847-110241869 CAACAAAGGAGACTGAAGGGTGG - Intergenic
1059593446 9:115690229-115690251 CTATGAAGTAGAATAAAGAGTGG + Intergenic
1186847622 X:13546081-13546103 CTGCTAAGCAGACAAAAGGAAGG - Intergenic
1189825787 X:44915725-44915747 CTACTAAGTGGACTAACAGTGGG - Intronic
1190475449 X:50822750-50822772 CTACTCAGGAGGCTGAAGGGAGG - Intergenic
1191590080 X:62872923-62872945 CTACTAAGCAGCCTAAAGAAAGG - Intergenic
1198969266 X:142263263-142263285 CTAATAAGTAAAATGAAGGGTGG + Intergenic
1202195456 Y:22295501-22295523 CTACTAAGTAAGCTACAGGATGG + Intergenic