ID: 965700238

View in Genome Browser
Species Human (GRCh38)
Location 3:171453267-171453289
Sequence AGTGTTATGAAAGAGGTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965700236_965700238 -5 Left 965700236 3:171453249-171453271 CCAAGACAGAAAGTTCTGAGTGT 0: 1
1: 0
2: 0
3: 19
4: 180
Right 965700238 3:171453267-171453289 AGTGTTATGAAAGAGGTGTGAGG 0: 1
1: 0
2: 1
3: 12
4: 198
965700235_965700238 30 Left 965700235 3:171453214-171453236 CCTCTAAAAAGGAATTGTCTAGT 0: 1
1: 0
2: 2
3: 13
4: 165
Right 965700238 3:171453267-171453289 AGTGTTATGAAAGAGGTGTGAGG 0: 1
1: 0
2: 1
3: 12
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965700238 Original CRISPR AGTGTTATGAAAGAGGTGTG AGG Intronic
900360143 1:2284398-2284420 ACTGTTACAAAAGAGGTCTGAGG - Intronic
901872339 1:12145400-12145422 AATGTTTAGGAAGAGGTGTGTGG - Intergenic
902766012 1:18615785-18615807 AGTGTTCTGAAGGAGGGGAGGGG + Intergenic
903651078 1:24922728-24922750 ATTGTTCTGAGAAAGGTGTGCGG + Intronic
903951313 1:26997566-26997588 AGTGTTCTGAAAGTCATGTGGGG - Intronic
904889234 1:33765998-33766020 AGAGGTATAAAAGAGGTGTCTGG - Intronic
905892738 1:41527448-41527470 AGTGTGAGGACAGGGGTGTGAGG - Intronic
906383798 1:45349670-45349692 AGTGTGATATAATAGGTGTGAGG - Intronic
908602911 1:65760698-65760720 AGGGATAAAAAAGAGGTGTGTGG + Intergenic
909179137 1:72398575-72398597 AATGTTATGAAATTGGAGTGTGG - Intergenic
909424673 1:75509129-75509151 AGTGTGAAGCACGAGGTGTGGGG - Intronic
910579220 1:88803089-88803111 ACTGTCATGAAAGAAGTATGAGG - Intronic
910977369 1:92920925-92920947 AGAGGAAGGAAAGAGGTGTGGGG + Intronic
912208969 1:107537857-107537879 TGTGTTATTGAAGAGGTTTGTGG - Intergenic
912871313 1:113309611-113309633 AGTTTTAAAAAAGAGGCGTGGGG - Intergenic
915870709 1:159556978-159557000 AGTGTTATGGATGAGATGAGGGG - Intergenic
919870819 1:201820000-201820022 AGTGCTCTGAAAGAGGAGAGGGG - Exonic
921932826 1:220769271-220769293 AGTGATAAGAAAGCTGTGTGAGG - Intronic
922043143 1:221916789-221916811 AGTGTTATGAAGGAGCTGAAAGG + Intergenic
1064512572 10:16111429-16111451 AGTGCTATGAATGAGGGGGGCGG + Intergenic
1066022269 10:31315993-31316015 TGTGTTTTGGAAGAGGTATGTGG + Intergenic
1069058376 10:63867922-63867944 AGGGTTATGTAAGAGGTGGATGG - Intergenic
1073238543 10:102037955-102037977 AGTGATATTACAGAAGTGTGAGG - Intronic
1074050378 10:109876219-109876241 ATTGTTTTGAAAACGGTGTGGGG - Intronic
1074234055 10:111567001-111567023 AGCGGTTTCAAAGAGGTGTGTGG + Intergenic
1074262423 10:111867636-111867658 AGTGTTCTGAAAGATGAGTAGGG + Intergenic
1078665906 11:13324995-13325017 AGTGTTGTGCTAGAGCTGTGGGG + Intronic
1082066900 11:47908364-47908386 AGAGCTATGAAAGAGTTATGTGG + Intergenic
1082718345 11:56642414-56642436 AGACTTATGAAAGAGGTTCGAGG - Exonic
1085823059 11:79813785-79813807 AGGGTTATGAAAGTGCTTTGTGG + Intergenic
1087662333 11:101002166-101002188 AGGGTTCTGAAAGAGGTGGGGGG - Intergenic
1089018849 11:115190332-115190354 TGTGCTGTGAAAGAGGTCTGAGG + Intronic
1091055316 11:132412668-132412690 AGTATTATGACAGAGATATGAGG - Intergenic
1091691792 12:2602060-2602082 AGTGTGATGAGAGTGGGGTGGGG + Intronic
1092213563 12:6664471-6664493 ATTCTTATGAAGGATGTGTGAGG - Intergenic
1092482667 12:8874417-8874439 AGTGTTCTTAATGAGCTGTGGGG - Exonic
1098556522 12:71824860-71824882 GTTCTTATAAAAGAGGTGTGAGG + Intergenic
1099349701 12:81550206-81550228 AGTGTTATAATAGAGTTGTATGG + Intronic
1099356758 12:81646532-81646554 ACTGTGTTGAAAGAGGAGTGAGG - Intronic
1099623952 12:85043747-85043769 AGTTTTATGATATATGTGTGGGG - Intronic
1100786588 12:98085056-98085078 AGTCTTTTCAAAGTGGTGTGGGG + Intergenic
1104119116 12:125781686-125781708 ACTGTTTTGAAAGTGGTTTGGGG + Intergenic
1104873545 12:132017247-132017269 AGTGCTCTGAAAGAGAAGTGGGG - Intronic
1106090720 13:26590993-26591015 AGAGATTTGAAGGAGGTGTGAGG + Intronic
1106546612 13:30736446-30736468 ATAGTTATGAAAGTGGTCTGAGG - Intronic
1107340263 13:39398036-39398058 AGTGTCACTAAAGATGTGTGTGG - Intronic
1108009316 13:45988066-45988088 AGTGTTTTGATAAAGGAGTGAGG - Intronic
1110309015 13:74024881-74024903 AGTGTCAGGGAAGAGGTGGGTGG - Intronic
1110639338 13:77803918-77803940 AGTGTTATCAGAAAGTTGTGTGG + Intergenic
1111431188 13:88150062-88150084 AATGTCATGAAAGTGGTGTCTGG - Intergenic
1111461717 13:88553049-88553071 TGTGTTAGGGAAGTGGTGTGGGG - Intergenic
1111702218 13:91705053-91705075 AGGGTGGTGTAAGAGGTGTGAGG + Intronic
1113001067 13:105637946-105637968 AGTGTGATGAATGACATGTGGGG + Intergenic
1113851813 13:113422244-113422266 AGTGTGATTAAAAAGGTGGGTGG + Intronic
1114439627 14:22735823-22735845 AGGGTCATGAAAGACTTGTGGGG - Intergenic
1115629589 14:35230665-35230687 ATTCTTGTGAAAGAGGTATGTGG + Intronic
1116650159 14:47580331-47580353 AGCTTTATAAAAGAGGTGTGAGG - Intronic
1117612969 14:57503353-57503375 AGTGGCATGAAAAAGGTGGGAGG - Intergenic
1117943456 14:60993351-60993373 AGTGTTATGAAAGTGGACTCTGG - Intronic
1118030996 14:61817585-61817607 AGTGTCATGAAAGATGGCTGAGG + Intergenic
1120255456 14:82113502-82113524 AGGGTGGTGAAAGAGGTGGGAGG + Intergenic
1120363420 14:83535163-83535185 AGTGTTATGAAAGTGAACTGTGG + Intergenic
1122045335 14:99018922-99018944 AGTGGTAAGAAACAGGGGTGTGG - Intergenic
1125350929 15:38766891-38766913 AGTGGCCTGAAATAGGTGTGAGG + Intergenic
1126217236 15:46170177-46170199 AATGTGATCAAAGAGGTGTAGGG - Intergenic
1127617537 15:60701818-60701840 AGTGTTTTAAAAGGGCTGTGAGG + Intronic
1128106981 15:65052252-65052274 AGTGTGAGGGATGAGGTGTGTGG + Intronic
1129662039 15:77558289-77558311 AGAGTTGTGTAGGAGGTGTGCGG + Intergenic
1129918007 15:79291867-79291889 AGTGTTTTCAAGGAGGAGTGGGG + Intergenic
1131597385 15:93812430-93812452 ACCCTTATAAAAGAGGTGTGAGG + Intergenic
1131669317 15:94602417-94602439 ATTGGTATGAGAGAGGTGGGTGG + Intergenic
1133682589 16:8133874-8133896 ACTGTGAGGAAAGAGGTATGAGG + Intergenic
1137778973 16:51080800-51080822 ATTTTTCTGAAAGGGGTGTGTGG + Intergenic
1137853480 16:51769915-51769937 AGAGTAATGAATGGGGTGTGCGG - Intergenic
1137958346 16:52855722-52855744 AGTGTTTTGAAAGAAGTTAGTGG - Intergenic
1140130212 16:72153836-72153858 AGGGTTATCAAAGAGGTATAAGG - Intronic
1141109531 16:81260937-81260959 AGAGTTATGAAAGAGTTGAAGGG + Intronic
1143047695 17:4095324-4095346 AGTGTTATGAATGTGCTGTAGGG - Intronic
1146066391 17:29639187-29639209 CATTTTATGAAAGAGGTCTGAGG + Intronic
1146647660 17:34585781-34585803 AGTGCTATGAAAGAAATGTGAGG + Intronic
1147498249 17:40937846-40937868 ATTATTATGAAAGAGAAGTGTGG - Intergenic
1151409436 17:73912063-73912085 TCTGTTATGTAAGAGGTGGGGGG - Intergenic
1151920051 17:77147792-77147814 TGTGTTTTGACAAAGGTGTGGGG + Intronic
1152532002 17:80924211-80924233 AGGGTTATGAGAGTGGTGTGAGG + Intronic
1153255895 18:3170921-3170943 AGTGTAATGAAAGAAGTCTTAGG - Intronic
1154385213 18:13886913-13886935 AGTGTTCAGAAGGAGGTTTGTGG + Intronic
1157523377 18:48360772-48360794 AGTGTCATGAAGGAGGCATGTGG + Intronic
1159026171 18:63183876-63183898 AGGGTGGTGAGAGAGGTGTGTGG - Intronic
1159152767 18:64541340-64541362 AGTGATATGATTGAAGTGTGGGG + Intergenic
1160310677 18:77787079-77787101 AGTGAGAAGAAAGAGTTGTGAGG - Intergenic
1162638718 19:11990333-11990355 AGTGTTATGAAAGACCTTGGCGG + Intergenic
1164728796 19:30485468-30485490 AGTGACAGGAAAGAGATGTGCGG - Intronic
1165109653 19:33494249-33494271 AGAGTTAGGATAGGGGTGTGGGG - Intronic
1165406116 19:35632467-35632489 AGTGTTAGGCAAGGGGTGAGTGG - Intronic
1168395895 19:56048212-56048234 AGTGTTAGGATGGAGATGTGAGG + Intronic
1168709170 19:58488346-58488368 AGTGCCATGAACAAGGTGTGTGG - Intronic
1168709178 19:58488402-58488424 AGTGCTATGAACAGGGTGTGTGG - Intronic
925441566 2:3891490-3891512 AGTGGCATGAGAGGGGTGTGAGG - Intergenic
925683172 2:6444535-6444557 AGTGTAATAACAAAGGTGTGTGG + Intergenic
926936643 2:18092473-18092495 AGTCTTTTGAAAGATGTCTGTGG + Intronic
926951614 2:18249393-18249415 AGAGATATGAAAGTAGTGTGGGG + Intronic
927995598 2:27483522-27483544 AGTGTTAGGAAAATGCTGTGGGG - Intronic
929840355 2:45454407-45454429 AGTGTTTTGAAAGAACAGTGTGG + Intronic
930462127 2:51694874-51694896 AGTATCATGAAAGAGGTTTAAGG - Intergenic
930494397 2:52122682-52122704 AGTGATATGAGAGAACTGTGAGG - Intergenic
930792799 2:55352129-55352151 AATGTCATGAAATTGGTGTGTGG + Intronic
932085600 2:68755739-68755761 AATGCTAAGAAAGAGGAGTGGGG + Intronic
933204086 2:79484796-79484818 AGAGTAATGTAAGAGGAGTGAGG - Intronic
935707911 2:105872327-105872349 AGTGATGTGAAGGAGGTGTTAGG - Intronic
936884887 2:117298929-117298951 AATGTTAATAATGAGGTGTGAGG + Intergenic
938171717 2:129083836-129083858 AATGTAATGAAAGATGTGTAAGG - Intergenic
940673844 2:156704778-156704800 AGTTTTATTAAAGATGGGTGAGG - Intergenic
942871770 2:180742820-180742842 AGTGTTATGAAAGAAATCGGGGG - Intergenic
1169488147 20:6050808-6050830 AGTATCTTGAAAGATGTGTGTGG + Exonic
1170370166 20:15639745-15639767 AGTGGTAGGAAAGAGGCTTGAGG - Intronic
1174720625 20:52808192-52808214 AGGGTGATGAATGAGGAGTGAGG + Intergenic
952097717 3:29973808-29973830 AGGGTCATGAAAGAAGTGTGTGG - Intronic
952761791 3:36921628-36921650 AGTTTTATGAAAGAGATACGTGG - Intronic
958080397 3:88738960-88738982 AGTGTTTTGCATGTGGTGTGGGG + Intergenic
958737681 3:98028692-98028714 AGTTTTAAGAAAGAGGTCAGAGG + Intronic
958969747 3:100598986-100599008 AGTGTTAGTATTGAGGTGTGAGG + Intergenic
960563940 3:119114497-119114519 TGTGTTATCAAAGAGGTTGGAGG - Intronic
960897409 3:122520187-122520209 AGTCTGATGAAGGAGATGTGAGG - Intergenic
962411987 3:135149110-135149132 AGTTTCAAGAAAGATGTGTGAGG - Intronic
964914266 3:161820174-161820196 AGGGTTATAAAAGAGGTCTGGGG + Intergenic
965700238 3:171453267-171453289 AGTGTTATGAAAGAGGTGTGAGG + Intronic
966062498 3:175776220-175776242 AGTAATATGAAAGAGTTGAGGGG - Intronic
968271528 3:197407086-197407108 AGTGTTGTGAAGGAGGCGTGAGG - Intergenic
969408082 4:7008213-7008235 TGTGTGATGAAAGAGGTGGTGGG + Intronic
969921117 4:10540590-10540612 AGTGTTATGAGAGGCCTGTGTGG + Exonic
972050608 4:34728150-34728172 AGTGATATGTAAGAAGTGTAAGG + Intergenic
972361058 4:38325742-38325764 TGTCTTTTGAAAGAGGTGAGAGG - Intergenic
972438800 4:39063051-39063073 ACTGTTAGAAAAGGGGTGTGGGG + Intronic
974771822 4:66424054-66424076 AGTGTTATGAAATAAGTTTTTGG - Intergenic
976050094 4:81001499-81001521 ATTGTTATGAAAGAGGTTAAAGG - Intergenic
976631347 4:87240062-87240084 AGTGTTCTCAAAGTGCTGTGGGG - Intronic
977019028 4:91736131-91736153 AGTGGTATGAAAAATGTTTGTGG - Intergenic
977292459 4:95178499-95178521 AGTGTTATCATAGAGGTCTGAGG - Intronic
981264276 4:142762899-142762921 GATCTTATAAAAGAGGTGTGAGG + Intronic
982346559 4:154366907-154366929 AGTGCTAAGAAGAAGGTGTGAGG + Intronic
983780219 4:171661477-171661499 AATCATATGAAAGAGGGGTGTGG + Intergenic
985964315 5:3328340-3328362 AGTGTTATGAAATAAATGTTTGG + Intergenic
986501068 5:8400687-8400709 AGTGGTTTTCAAGAGGTGTGAGG - Intergenic
987808330 5:22800033-22800055 AATGCTAGGAAAGAGGTCTGGGG + Intronic
989280753 5:39640338-39640360 AGTGTTCTGGAAGGGGGGTGGGG + Intergenic
991214024 5:64141000-64141022 ACTCTTATAAAAGAGGTGTGAGG - Intergenic
992057742 5:73008830-73008852 AGTATTATGAATGAGGTATATGG + Intronic
993164590 5:84335977-84335999 GATCTTGTGAAAGAGGTGTGAGG - Intronic
993487744 5:88507176-88507198 AGTATTAGGACAGAGCTGTGTGG - Intergenic
993526057 5:88966960-88966982 AGTGTGAAGAAACAAGTGTGAGG - Intergenic
996284554 5:121773329-121773351 AGTGTTTGGAAAGAGGCATGAGG - Intergenic
996691033 5:126340333-126340355 ATCATTATGTAAGAGGTGTGAGG - Intergenic
997550361 5:134747300-134747322 AGTGTTATGTAAGAGGGGTGAGG - Intronic
998830436 5:146152241-146152263 AGTGTTGGGAAAGGTGTGTGTGG - Intronic
999242825 5:150137474-150137496 AGTGTGATGAAAGGGATGGGAGG + Intronic
999527390 5:152422409-152422431 AGAGTTATCAAGGAGGTGAGAGG + Intronic
1000488478 5:161879059-161879081 GGTGTTATGAAAGAACTCTGTGG - Intronic
1002692898 5:181062982-181063004 GGCATTTTGAAAGAGGTGTGTGG + Intergenic
1004290725 6:14364457-14364479 AGTCTGATGAAAGAAGTGTGTGG - Intergenic
1008771232 6:54981227-54981249 AGTGGTATGAAACAGGCATGTGG + Intergenic
1009735182 6:67667466-67667488 AGTGTTAAGAAAGTGGTGATGGG - Intergenic
1009994037 6:70879666-70879688 AGTGCTATGAAGGAAGGGTGCGG + Intronic
1010825196 6:80464643-80464665 AATAGTATGAAAGAAGTGTGAGG - Intergenic
1013841651 6:114403064-114403086 AGTGACATGAAAAAGCTGTGGGG + Intergenic
1016027284 6:139300181-139300203 TGTGTTAGAAAACAGGTGTGTGG + Intergenic
1016724855 6:147351791-147351813 AGTGTTAGGAAAGAGGCATTAGG - Intronic
1017059624 6:150469979-150470001 AGAGTCCTGGAAGAGGTGTGTGG - Intergenic
1017119492 6:151010488-151010510 AGTATTATAACAGAGTTGTGAGG - Intronic
1017373702 6:153742366-153742388 AGTGTTCTGAAGGAGGCCTGGGG - Intergenic
1018329062 6:162708511-162708533 AGTGTCATGAAAGCCGTGTTAGG - Intronic
1019149032 6:169992364-169992386 AGTGTTCTGAGAGGCGTGTGGGG - Intergenic
1019660760 7:2222820-2222842 CATGTTCTGAGAGAGGTGTGGGG - Intronic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1028632275 7:92947891-92947913 AGAGAGATGAAAGAGATGTGGGG + Intergenic
1028676711 7:93472450-93472472 ACTGTGATGAAAAAGGTGTTTGG - Exonic
1029303884 7:99604642-99604664 AGTGTTGGGACAGAGGTGGGGGG + Intronic
1029969788 7:104777856-104777878 AGTGACATGAAAAAGGAGTGTGG + Intronic
1030190628 7:106807020-106807042 AATGTTTTGACAGAAGTGTGAGG + Intergenic
1030921701 7:115397609-115397631 AGAGTTATCTAAGAGGAGTGAGG + Intergenic
1030978599 7:116158224-116158246 AATGCTATGAAAGAGGTTTCTGG + Intronic
1032623962 7:133568720-133568742 AGTGTTATGGTAGAGATGTTTGG + Intronic
1037459388 8:19094024-19094046 AGTGTGAGGAGTGAGGTGTGGGG + Intergenic
1038697703 8:29820735-29820757 AGTGTGATGTGAGTGGTGTGTGG - Intergenic
1039590678 8:38744218-38744240 AGTGTCATGAATGGGGAGTGCGG - Intronic
1039795249 8:40907406-40907428 AGTGTTTTTCAAGAGGTATGAGG + Intergenic
1041699487 8:60772588-60772610 AGTGTTCTCAAAGAGGTGTCTGG - Intronic
1042323630 8:67504810-67504832 AGAGGAGTGAAAGAGGTGTGGGG + Intronic
1042554948 8:70026486-70026508 AGTCTTAGGAAGGAGGTGAGAGG + Intergenic
1043739246 8:83789166-83789188 AATGATTTGAAACAGGTGTGGGG - Intergenic
1046404533 8:113755786-113755808 AGAGTTATGCAGCAGGTGTGAGG - Intergenic
1046885903 8:119366779-119366801 GGTGATCTGAAATAGGTGTGGGG - Intergenic
1048007858 8:130433405-130433427 AGCTTTGTGAAAGAGGTGTCTGG - Intronic
1050760041 9:9057673-9057695 AGTAATATGAGAAAGGTGTGAGG + Intronic
1055800274 9:80027673-80027695 AATGTGATGATAGAGGTATGAGG - Intergenic
1056069895 9:82975319-82975341 AGTGTTACGAAAGCTGAGTGAGG + Intergenic
1057852467 9:98576057-98576079 GGTGTGATGAAAGAGAGGTGGGG - Intronic
1058398819 9:104589761-104589783 ATTGTGATGCAAGAGGTATGAGG - Intergenic
1058765059 9:108174393-108174415 AGTGTTATGAAATAAGTCTTAGG - Intergenic
1059184533 9:112255692-112255714 AGTGTTATACAAGAAGTGTCAGG - Intronic
1060371982 9:123082416-123082438 AGTTGTATGAAAGGGCTGTGGGG - Intronic
1060475765 9:123985371-123985393 AGGGTTATGAAAGAGAAGTGGGG - Intergenic
1062308289 9:135921787-135921809 AGGGTTATGAAGGAGGGGAGGGG - Intergenic
1187807720 X:23139333-23139355 ACCCTTATGAAAGAGGTATGAGG - Intergenic
1190029594 X:46959290-46959312 AGTGTTTTGACAGAGGTATTGGG - Intronic
1193368211 X:80660009-80660031 GGTATTTTGAAATAGGTGTGTGG - Intergenic
1193534461 X:82695612-82695634 AGTGTTGTGATAGAGGATTGTGG - Intergenic
1194073420 X:89356912-89356934 ACTTTTATGAAAGAGGTGGTGGG + Intergenic
1195569816 X:106385623-106385645 ACTGTTATGACAGAGATGTCAGG - Intergenic
1196655868 X:118216572-118216594 AGTGTTATTACAGAGCTGTTGGG + Intergenic
1197009965 X:121548578-121548600 AGTGTTACTATTGAGGTGTGAGG - Intergenic
1198299320 X:135319370-135319392 AGCATTATCAAAGAAGTGTGTGG + Intronic
1200728803 Y:6708490-6708512 ACTTTTATGAAAGAGGTGGTGGG + Intergenic