ID: 965700798

View in Genome Browser
Species Human (GRCh38)
Location 3:171458226-171458248
Sequence TCTACGCTGGGAGTTGCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 84}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965700798_965700805 30 Left 965700798 3:171458226-171458248 CCGGCAGCAACTCCCAGCGTAGA 0: 1
1: 0
2: 0
3: 4
4: 84
Right 965700805 3:171458279-171458301 AAAGCAGGAAGCCACAGACCTGG 0: 1
1: 0
2: 4
3: 41
4: 443
965700798_965700803 6 Left 965700798 3:171458226-171458248 CCGGCAGCAACTCCCAGCGTAGA 0: 1
1: 0
2: 0
3: 4
4: 84
Right 965700803 3:171458255-171458277 GGCAAATGAACACACACAGTCGG 0: 1
1: 0
2: 0
3: 26
4: 243
965700798_965700804 15 Left 965700798 3:171458226-171458248 CCGGCAGCAACTCCCAGCGTAGA 0: 1
1: 0
2: 0
3: 4
4: 84
Right 965700804 3:171458264-171458286 ACACACACAGTCGGTAAAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965700798 Original CRISPR TCTACGCTGGGAGTTGCTGC CGG (reversed) Intronic
902481785 1:16715832-16715854 TCTAAGCTGAGAGTTGCTAGGGG + Intergenic
906323364 1:44829880-44829902 TCTCCTCTGGGAGTTGGTGAGGG - Intronic
906385091 1:45361168-45361190 TCTGCACTGGGAGTTGCTTATGG - Intronic
906939492 1:50243946-50243968 TCTACACTGGAAGCTGCAGCAGG + Intergenic
907331223 1:53672909-53672931 TCTCTGCTGGGACTGGCTGCAGG + Intronic
915920199 1:159970503-159970525 TGTCCTCTTGGAGTTGCTGCTGG + Intergenic
916648886 1:166816751-166816773 TCTGAGATTGGAGTTGCTGCCGG + Intergenic
1063142091 10:3264552-3264574 TCTGCTCAGGGAATTGCTGCTGG - Intergenic
1064274357 10:13892340-13892362 TCTTCAATGGAAGTTGCTGCAGG + Intronic
1067676864 10:48388477-48388499 TCTAGGCTGGTGGTTGCTGTGGG + Intronic
1070523649 10:77276275-77276297 TCTGCTCTGGAAGTTCCTGCAGG + Intronic
1073649220 10:105341055-105341077 TTTAGGCTGGGTGTTGCTTCTGG - Intergenic
1074821734 10:117184634-117184656 TCTACTCTGGGTGTTTCAGCAGG - Intergenic
1075690192 10:124389110-124389132 TCTACGCAGGGAGGGGCCGCGGG + Intergenic
1077899905 11:6479803-6479825 ACAACGCTGGGAGTTGCTTTTGG + Intronic
1095781716 12:46067382-46067404 TCTAGGCTGGGCGTGGGTGCGGG - Intergenic
1100616647 12:96236229-96236251 TCTTGGCTGGGCGCTGCTGCTGG - Intronic
1103197997 12:119062254-119062276 TCAGGGCTGGGAGTTGCTCCTGG + Intronic
1104937325 12:132373240-132373262 CCTAGGCTGGGGGTCGCTGCAGG - Intergenic
1119345720 14:73922185-73922207 TCTATCCTGGGAGTTGATGATGG + Exonic
1126815701 15:52451191-52451213 TCTACGCAGATAGTTGCTCCTGG + Intronic
1132996342 16:2825481-2825503 CCGAGGCTGGGAGTGGCTGCGGG + Intronic
1142601891 17:1057161-1057183 TCTTCCCTGGGGGCTGCTGCAGG + Intronic
1143631453 17:8142614-8142636 CCTACCCTGGGAGATGCTGGAGG + Intronic
1144183867 17:12777854-12777876 TCTACTCTGGGGGTTGAGGCAGG - Intergenic
1145080632 17:19891785-19891807 GGTGCGCTGGGAGTGGCTGCCGG + Intergenic
1147121120 17:38335634-38335656 TCTTCGCTGGGTGCGGCTGCTGG - Exonic
1148697995 17:49572659-49572681 CCCACGCTGGGAGTAGCTGGAGG + Intergenic
1151174089 17:72272837-72272859 TCTCCTCTGGGGGTTGATGCTGG - Intergenic
1152252264 17:79218347-79218369 TCCAAGCTGGGATTTGCAGCTGG - Intronic
1155469605 18:26177256-26177278 ACTGGGGTGGGAGTTGCTGCTGG + Intronic
1159102319 18:63970518-63970540 GCTGCGCTGTGATTTGCTGCCGG + Intronic
1160461733 18:79043814-79043836 TCTAGCATGGGAGTTCCTGCAGG + Intergenic
1162335013 19:10054958-10054980 GCTACCCTTGGAGTTGCTGCTGG - Intergenic
1168460341 19:56550105-56550127 TCTGAGCTGGGTGTAGCTGCTGG - Exonic
925026913 2:616739-616761 TCTACACTGGGAAGTGCTGCAGG + Intergenic
926311660 2:11679968-11679990 GCGTCACTGGGAGTTGCTGCTGG + Intronic
926459356 2:13109740-13109762 TCTAGGCTGGGTGTGGCTGGTGG + Intergenic
927488214 2:23503737-23503759 CCTTCGCTGGCAGCTGCTGCCGG - Intronic
936070703 2:109369385-109369407 TCAACGCTGAGCGTTGCTGGAGG + Intronic
937239092 2:120448994-120449016 ACCAGGCTGGGAGTTACTGCAGG - Intergenic
937624099 2:124024732-124024754 TGTGCGGTGGGAGTAGCTGCGGG + Intergenic
939689309 2:145238140-145238162 TCAAAACTGGGAGTTGTTGCTGG - Intergenic
943319878 2:186433310-186433332 TGTACAGTGGGTGTTGCTGCTGG + Intergenic
945239203 2:207660841-207660863 TCTCCACTGGGAGTTCCTGATGG - Intergenic
1171418440 20:24999748-24999770 TCTGGGCTGGGAGGGGCTGCAGG + Intergenic
1172376292 20:34443680-34443702 TTTACGTTGTTAGTTGCTGCCGG + Intronic
1174743128 20:53035207-53035229 TCTCCTCTGTGATTTGCTGCTGG + Intronic
1179347931 21:40578577-40578599 CCCACGCTGGGTGCTGCTGCTGG - Intronic
1181682732 22:24506980-24507002 TCTAGGCTGGCAGTTCCTGAGGG + Intronic
1182750387 22:32637104-32637126 TCTACACAGGGAGTCCCTGCAGG + Intronic
951009232 3:17657166-17657188 TATACGCAGGGAGTTGCAGGTGG - Intronic
965700798 3:171458226-171458248 TCTACGCTGGGAGTTGCTGCCGG - Intronic
969182192 4:5450803-5450825 TCTACCCTGGGAGGAACTGCTGG + Intronic
969351060 4:6598176-6598198 TCCCCTCTGGGGGTTGCTGCAGG + Exonic
970671769 4:18404854-18404876 TCTAGGCTGGGCTTGGCTGCCGG + Intergenic
971486112 4:27162247-27162269 TTTACCCTTGGAGTTGCTGGTGG - Intergenic
976724830 4:88205792-88205814 GCTACTCTGGGGGTTGATGCAGG - Intronic
976806384 4:89051972-89051994 TTTAGGCAGAGAGTTGCTGCAGG - Intronic
980646067 4:135643982-135644004 CCTGTGATGGGAGTTGCTGCCGG - Intergenic
986044460 5:4023743-4023765 TCTATGCATGGAGTTTCTGCAGG + Intergenic
986109291 5:4695274-4695296 TCTCTGCTTGGAGTTCCTGCAGG - Intergenic
993504663 5:88694352-88694374 TCTGCGCTGGGGGGTGGTGCTGG + Intergenic
996458793 5:123716878-123716900 TCTACTCTGGGAGTGGGGGCAGG + Intergenic
1001893671 5:175360777-175360799 TCTGGGCTGGGAGCTGCTGCTGG - Intergenic
1006293888 6:33161310-33161332 GCTAGGCTGGGAGTGGGTGCGGG + Intergenic
1007171989 6:39870543-39870565 TCTGCGCTGGGAATGGCAGCTGG - Intronic
1007432389 6:41784208-41784230 CCTGCGGAGGGAGTTGCTGCAGG - Exonic
1011367870 6:86601697-86601719 GGTACTCTGGGAGTGGCTGCTGG + Intergenic
1011788110 6:90868670-90868692 TCAGTGCTGGGAGTTGTTGCTGG + Intergenic
1018455871 6:163951756-163951778 TCTACGCTGGCATATGCTTCCGG + Intergenic
1018977653 6:168577645-168577667 TCACTGCTGGGAGATGCTGCGGG - Intronic
1019446293 7:1073361-1073383 CCTGCGCGGGGAGTAGCTGCCGG - Intronic
1024559310 7:50629925-50629947 TCTGAACTGTGAGTTGCTGCGGG - Intronic
1025756699 7:64351244-64351266 TCTACAATGGCAGTTGCTGGGGG + Exonic
1032855275 7:135828737-135828759 TCTTTGCTGGGAGCAGCTGCAGG + Intergenic
1039602014 8:38847253-38847275 TCACCACTGGGAGATGCTGCTGG + Intronic
1041527775 8:58826842-58826864 TGTATGCTGCGAGTTGCTTCAGG + Exonic
1041765821 8:61417162-61417184 TCTTGCTTGGGAGTTGCTGCAGG + Intronic
1048379696 8:133854388-133854410 CCTGCACAGGGAGTTGCTGCAGG - Intergenic
1049269873 8:141689214-141689236 TCACAGCTGGGAGGTGCTGCTGG - Intergenic
1049843817 8:144790234-144790256 TCTACGGTGGGAGGAGCAGCAGG - Intronic
1055581706 9:77712792-77712814 TCCACCCAGGGGGTTGCTGCAGG - Intergenic
1060716356 9:125933555-125933577 TCTACCCTGGGCCTTGCTCCTGG + Intronic
1061750566 9:132774075-132774097 TCTACTCTGGGAGGGGCTCCTGG + Intronic
1187048074 X:15667828-15667850 TCTACTCTGGGAGCTGAGGCAGG - Intergenic
1190725902 X:53190411-53190433 TCTAACCTGGGAGTTGCTTCAGG + Intergenic
1200144973 X:153921735-153921757 GCTGCGGCGGGAGTTGCTGCAGG - Exonic
1200437282 Y:3166271-3166293 CCTATGCTGGGAGGGGCTGCTGG + Intergenic