ID: 965704722

View in Genome Browser
Species Human (GRCh38)
Location 3:171494774-171494796
Sequence GGTTGGAGTGGAGGAGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965704710_965704722 20 Left 965704710 3:171494731-171494753 CCCAACTTTGACACCAGAAAGTT No data
Right 965704722 3:171494774-171494796 GGTTGGAGTGGAGGAGAAGCAGG No data
965704711_965704722 19 Left 965704711 3:171494732-171494754 CCAACTTTGACACCAGAAAGTTT No data
Right 965704722 3:171494774-171494796 GGTTGGAGTGGAGGAGAAGCAGG No data
965704714_965704722 7 Left 965704714 3:171494744-171494766 CCAGAAAGTTTATGGTATGGTTG No data
Right 965704722 3:171494774-171494796 GGTTGGAGTGGAGGAGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965704722 Original CRISPR GGTTGGAGTGGAGGAGAAGC AGG Intergenic
No off target data available for this crispr