ID: 965708642

View in Genome Browser
Species Human (GRCh38)
Location 3:171534770-171534792
Sequence GCAGCTCTTGGCCTGCTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965708642_965708646 8 Left 965708642 3:171534770-171534792 CCCAGTAGCAGGCCAAGAGCTGC No data
Right 965708646 3:171534801-171534823 AGGAGAGTAGTTATCTGCAGAGG 0: 5
1: 11
2: 22
3: 42
4: 203
965708642_965708647 12 Left 965708642 3:171534770-171534792 CCCAGTAGCAGGCCAAGAGCTGC No data
Right 965708647 3:171534805-171534827 GAGTAGTTATCTGCAGAGGATGG 0: 7
1: 198
2: 208
3: 121
4: 258
965708642_965708648 16 Left 965708642 3:171534770-171534792 CCCAGTAGCAGGCCAAGAGCTGC No data
Right 965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG No data
965708642_965708649 17 Left 965708642 3:171534770-171534792 CCCAGTAGCAGGCCAAGAGCTGC No data
Right 965708649 3:171534810-171534832 GTTATCTGCAGAGGATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965708642 Original CRISPR GCAGCTCTTGGCCTGCTACT GGG (reversed) Intergenic
No off target data available for this crispr