ID: 965708645

View in Genome Browser
Species Human (GRCh38)
Location 3:171534782-171534804
Sequence TCCTTTTGAGAAGCAGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965708645_965708649 5 Left 965708645 3:171534782-171534804 CCAAGAGCTGCTTCTCAAAAGGA No data
Right 965708649 3:171534810-171534832 GTTATCTGCAGAGGATGGCAGGG No data
965708645_965708651 27 Left 965708645 3:171534782-171534804 CCAAGAGCTGCTTCTCAAAAGGA No data
Right 965708651 3:171534832-171534854 GCCTTGCTGCAATATCTTAAGGG No data
965708645_965708646 -4 Left 965708645 3:171534782-171534804 CCAAGAGCTGCTTCTCAAAAGGA No data
Right 965708646 3:171534801-171534823 AGGAGAGTAGTTATCTGCAGAGG 0: 5
1: 11
2: 22
3: 42
4: 203
965708645_965708650 26 Left 965708645 3:171534782-171534804 CCAAGAGCTGCTTCTCAAAAGGA No data
Right 965708650 3:171534831-171534853 GGCCTTGCTGCAATATCTTAAGG No data
965708645_965708648 4 Left 965708645 3:171534782-171534804 CCAAGAGCTGCTTCTCAAAAGGA No data
Right 965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG No data
965708645_965708647 0 Left 965708645 3:171534782-171534804 CCAAGAGCTGCTTCTCAAAAGGA No data
Right 965708647 3:171534805-171534827 GAGTAGTTATCTGCAGAGGATGG 0: 7
1: 198
2: 208
3: 121
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965708645 Original CRISPR TCCTTTTGAGAAGCAGCTCT TGG (reversed) Intergenic
No off target data available for this crispr