ID: 965708646

View in Genome Browser
Species Human (GRCh38)
Location 3:171534801-171534823
Sequence AGGAGAGTAGTTATCTGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 5, 1: 11, 2: 22, 3: 42, 4: 203}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965708643_965708646 7 Left 965708643 3:171534771-171534793 CCAGTAGCAGGCCAAGAGCTGCT No data
Right 965708646 3:171534801-171534823 AGGAGAGTAGTTATCTGCAGAGG 0: 5
1: 11
2: 22
3: 42
4: 203
965708645_965708646 -4 Left 965708645 3:171534782-171534804 CCAAGAGCTGCTTCTCAAAAGGA No data
Right 965708646 3:171534801-171534823 AGGAGAGTAGTTATCTGCAGAGG 0: 5
1: 11
2: 22
3: 42
4: 203
965708642_965708646 8 Left 965708642 3:171534770-171534792 CCCAGTAGCAGGCCAAGAGCTGC No data
Right 965708646 3:171534801-171534823 AGGAGAGTAGTTATCTGCAGAGG 0: 5
1: 11
2: 22
3: 42
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965708646 Original CRISPR AGGAGAGTAGTTATCTGCAG AGG Intergenic
900192325 1:1356710-1356732 AGGAGAGGAGTGAGCTGGAGAGG + Intronic
900687135 1:3955742-3955764 AGAAGAGTGGTTGACTGCAGTGG + Intergenic
903120069 1:21210396-21210418 AGGAGAGTAGTTATCCACAGAGG - Intergenic
903393585 1:22982355-22982377 AGGAGAGTAGCTAGCTTCACTGG - Intergenic
904773653 1:32894218-32894240 AGGAGACTTTTTATCTGGAGGGG + Exonic
905846298 1:41235743-41235765 AGGATAGTAGGTATCTCCAAAGG - Intronic
906123251 1:43409316-43409338 AGGGCAGGAGTTATCTGCTGAGG + Intronic
909749711 1:79143434-79143456 AGGGGACCAGTTATCTCCAGAGG - Intergenic
909794719 1:79719179-79719201 CAGAGAGAAGTTTTCTGCAGGGG - Intergenic
910153628 1:84186748-84186770 ATGAGAGAAGTTATCTGTTGGGG + Intronic
911603821 1:99877658-99877680 AGGAGAGAACTTATTTGCTGGGG + Exonic
915715027 1:157937349-157937371 AGGAGACTAGATATCTACAAAGG - Intergenic
916365969 1:164028081-164028103 AGGAGAGCAGTTATCTGTGGAGG + Intergenic
917052489 1:170939831-170939853 AGAAGACTAACTATCTGCAGAGG + Intronic
917959903 1:180133802-180133824 AGGAGAGAAGGTATTTGGAGAGG - Intergenic
918012200 1:180597474-180597496 AGGAGATTAATTAAATGCAGTGG - Intergenic
919308763 1:195878453-195878475 CAGAGAGAAGTTAGCTGCAGGGG - Intergenic
920188163 1:204175236-204175258 AGCAGAGGAGGAATCTGCAGAGG + Intergenic
922958426 1:229625331-229625353 AGGAGAGTGCTTACCTGCAAGGG - Intronic
923007060 1:230058422-230058444 AGGACAGCAGCTATCTGGAGAGG - Intronic
923144682 1:231189774-231189796 AGGAGAGGTGGTATCAGCAGTGG - Intronic
1065607018 10:27428513-27428535 AGGAGGGTAGTTATCCACTGAGG - Intergenic
1067026693 10:42848348-42848370 AGGAAAATAGTTATCTGCTGAGG + Intergenic
1067974291 10:51006807-51006829 CAGAGAGTAGATAGCTGCAGAGG - Intronic
1069209892 10:65742848-65742870 AAAGGAGTAGTTATTTGCAGAGG + Intergenic
1069851871 10:71410658-71410680 AGGATAGGAGTTAACTTCAGAGG - Intronic
1071076378 10:81758458-81758480 AGGAGAGAAGTTAGATGAAGTGG + Intergenic
1071820054 10:89270868-89270890 AAAAGAATAGTTATCTGCAGGGG - Intronic
1072911596 10:99506706-99506728 AGGAGAGGGCTTCTCTGCAGAGG - Intergenic
1073464830 10:103688466-103688488 AGAAGAGGAGTAATCTGCGGGGG + Intronic
1074632514 10:115274045-115274067 AGGATAGTAGTTATCTGCAGAGG + Intronic
1075912692 10:126139596-126139618 AGGAGAGGACTTACCTACAGAGG + Intronic
1077149552 11:1064336-1064358 AGGAGAGTTCTTATCAGGAGTGG - Intergenic
1077669465 11:4144579-4144601 AGGAGAGTAGTTACCCACAGGGG - Intergenic
1078052832 11:7982561-7982583 AGGTGAGTAGTTATTTCTAGGGG + Intronic
1078396548 11:10986771-10986793 AGGAGAGTAGTAATGGGCTGGGG + Intergenic
1078611833 11:12827159-12827181 TTGAGAGTAATTATCAGCAGTGG + Intronic
1080436747 11:32251757-32251779 AGCAGAGTGGTTAAATGCAGGGG + Intergenic
1080469318 11:32529722-32529744 AGCAAAGTAATTATCTGCAGAGG + Intergenic
1080523054 11:33085053-33085075 TGGACAGGAGTTTTCTGCAGAGG + Exonic
1081735961 11:45404425-45404447 AGGAGAGGAGTTTACTGCAATGG - Intergenic
1084726936 11:70947986-70948008 AGGAGACTGGCTAGCTGCAGAGG - Intronic
1084905785 11:72345889-72345911 AGGAGATTTGTTTTCTACAGTGG + Intronic
1085079263 11:73620702-73620724 AGGGGAGTAGTTATCCACAGAGG - Intergenic
1089215474 11:116832146-116832168 AGGAGAGTACTGATGGGCAGGGG - Intronic
1089630677 11:119782293-119782315 GGGAGGGTAATTATCTGCCGTGG + Intergenic
1090095188 11:123735691-123735713 AGGAGACTGGTTATCTGCAGAGG - Intronic
1091064797 11:132499465-132499487 AGGACATCAGTTGTCTGCAGAGG + Intronic
1095190260 12:39250145-39250167 AGGAAAGTAGCTATCTACAGAGG - Intergenic
1097532444 12:60821425-60821447 AGGAGAGCAGGCATTTGCAGAGG + Intergenic
1097947801 12:65391392-65391414 AGGAGAGTATTTCTCTTCAGAGG + Intronic
1099293798 12:80804991-80805013 GGGAGTGCAGATATCTGCAGTGG + Intronic
1099995067 12:89769549-89769571 AGGAGAGTAGTTATCTGAAGAGG + Intergenic
1101222655 12:102657378-102657400 AAGAGAGTAGTTATCTGCAGAGG - Intergenic
1101805463 12:108059702-108059724 AGGAGTGTAGTTATAGGGAGGGG + Intergenic
1106021259 13:25918037-25918059 AAGAGAATAATTATCTGTAGAGG + Intronic
1106763438 13:32890714-32890736 TGGAGAATAGTTGTCAGCAGAGG + Intergenic
1109392313 13:61708966-61708988 AGGTGAGTAGCTATCCCCAGAGG - Intergenic
1111109206 13:83685379-83685401 TGGAGGGTAGTTTTCTGTAGAGG - Intergenic
1112093022 13:96102562-96102584 AGCAAAGAAATTATCTGCAGTGG - Intronic
1114688723 14:24560239-24560261 AGCAGAGTAGTTCTCTGCCTTGG - Intergenic
1114896347 14:26995319-26995341 AGAAAAGTAGTTATCTGCAGAGG + Intergenic
1116891433 14:50272548-50272570 AGGAGGTTAGTTATCTGCAGAGG - Intronic
1117693491 14:58334924-58334946 AGGAATGTAGTTATCTGGAGAGG - Intronic
1119445459 14:74659610-74659632 AGGACAGTAGTTACCTTTAGTGG + Intronic
1119566443 14:75633177-75633199 AGGAGAGAAATCACCTGCAGAGG + Intronic
1120343577 14:83254439-83254461 AAGAGAGTAGATATTTGCTGAGG + Intergenic
1120710472 14:87788110-87788132 AGGAGAGTGGTTATCTACAAAGG + Intergenic
1122978790 14:105181798-105181820 AGGAGAGTAGGGAGCTGGAGGGG + Intergenic
1123145572 14:106126940-106126962 AGGAGAGCAGGTATCTTCACAGG - Intergenic
1123908502 15:24943673-24943695 AGGAGGGTAGTTAACTACAGAGG + Intronic
1124151340 15:27181208-27181230 AGTAGGGTAATTGTCTGCAGAGG + Intronic
1124571700 15:30870336-30870358 AGGACAGTAATTATCCACAGAGG - Intergenic
1126292970 15:47102058-47102080 AGCAGAGTTGTTATCTGGTGAGG - Intergenic
1126613354 15:50551782-50551804 AGGAGATTAGTTATATGCAGAGG - Intergenic
1127727131 15:61760999-61761021 AGGTAAGTAGTCATTTGCAGAGG + Intergenic
1129286699 15:74531299-74531321 AAGAGAGCAGCTATCTTCAGGGG + Intergenic
1129304509 15:74649404-74649426 AGAAGTGTAGTTGGCTGCAGTGG - Intronic
1130904940 15:88233676-88233698 AGGAGAGCAGTTTTCTGAAGAGG - Intronic
1132305742 15:100810883-100810905 AAAGGAGTAGTTATTTGCAGAGG + Intergenic
1132554364 16:566100-566122 AGGAGAGAAGTGATTTGCTGTGG - Intergenic
1135911937 16:26569340-26569362 GGGAGACTTGTTATCTGCGGGGG + Intergenic
1136903741 16:34067130-34067152 AGGAGTGTAGTGGACTGCAGTGG + Intergenic
1136904321 16:34072957-34072979 AGGAGTGTAGTGGACTGCAGTGG + Intergenic
1141342528 16:83216119-83216141 AGGAGAGTAGTTCCAGGCAGAGG - Intronic
1142681539 17:1552005-1552027 AGGAGAGCAGTGCTGTGCAGTGG - Intronic
1143360983 17:6371107-6371129 AGGAGAGTAGTTACCTACGAGGG + Intergenic
1145088786 17:19968599-19968621 AGGAGGGTAGTTGTCAGCAAAGG + Intronic
1146456203 17:33011760-33011782 AGGGTAGTAGTTATTTGCAGTGG + Intergenic
1147506181 17:41019723-41019745 AGGACAGTAGTTATTTTCAGAGG + Intergenic
1148100533 17:45087853-45087875 AGGAGATTTGTTTGCTGCAGAGG + Intronic
1153184390 18:2470724-2470746 AGGAGAGTAATTATTTGTGGAGG - Intergenic
1153532346 18:6060257-6060279 AGGAAAGGAATTATTTGCAGTGG - Intronic
1155336984 18:24774777-24774799 AGGAGAGTAGTTATCCACAGAGG + Intergenic
1155376104 18:25159472-25159494 AGGAGTGTTGCTTTCTGCAGAGG + Intronic
1156367658 18:36444578-36444600 AGGAGACTAGTTATCTATAGAGG - Intronic
1157299068 18:46466710-46466732 AGAAGAGTAGCTTTCTGCTGGGG + Intergenic
1157853217 18:51078130-51078152 AGCAGAGAAGTTATATGCTGAGG + Intronic
1159232385 18:65626100-65626122 AAGTGAGTGGTAATCTGCAGAGG + Intergenic
1162295598 19:9811259-9811281 AGGAGCTCAGCTATCTGCAGAGG - Exonic
1164616747 19:29671686-29671708 AGGACACTTGTGATCTGCAGGGG + Intronic
1166521048 19:43480301-43480323 AGAAGAGAAGCTATGTGCAGTGG + Intronic
1166602519 19:44110546-44110568 AGGAGAGTAAGTATATGCAGAGG - Intergenic
1167157970 19:47750750-47750772 GGGAGAGGAGTTCTCTGAAGAGG + Intronic
1167728221 19:51233703-51233725 AGGAATGTAGGTATCTGCAGTGG + Intronic
1167951578 19:53031903-53031925 AGGTGAGTAGTTATCTGCAGAGG - Intergenic
1168481696 19:56725382-56725404 AAGAGCGATGTTATCTGCAGAGG - Intergenic
925543206 2:4988996-4989018 AGTGGAGTAGTTATTTGCAGCGG - Intergenic
925599047 2:5589373-5589395 AGGACAGGAGTTGCCTGCAGGGG + Intergenic
926444085 2:12922667-12922689 AGGGCAGTAGTTGTCTCCAGTGG + Intergenic
927298148 2:21478674-21478696 AGGATAGTAGTTATCTGTGGAGG + Intergenic
927816399 2:26221357-26221379 AGGAGAGTAGTTATTCACAGAGG - Intronic
932313180 2:70760616-70760638 AGGTGAGTTGTTACCTCCAGGGG + Intronic
937531191 2:122829585-122829607 AGGAGAGTATTTATCTGCAGAGG - Intergenic
937785208 2:125887749-125887771 AGGAGAGTAGTTATCTGCAGAGG + Intergenic
937867149 2:126761061-126761083 AGGAGAGTAGTTATCTGCAGAGG - Intergenic
938298984 2:130197067-130197089 AGGAGGGTAGTTTTATGAAGAGG - Intronic
938709575 2:133964615-133964637 GGGATTGTGGTTATCTGCAGAGG - Intergenic
938983761 2:136552657-136552679 AGGAGAGGAGATATCAGGAGAGG - Intergenic
939755231 2:146101783-146101805 GGAAGAGAAGTTATCTGCAGAGG - Intergenic
940068579 2:149657501-149657523 AGGAGAGACATTATATGCAGAGG + Intergenic
941457299 2:165724620-165724642 AGTAGATTGGTTATATGCAGGGG + Intergenic
942295510 2:174513176-174513198 AGAAGAACAGTTAACTGCAGTGG - Intergenic
943294058 2:186114902-186114924 AGGTGAGTGATTAACTGCAGAGG - Intergenic
945499206 2:210548696-210548718 AGAAGATTAGTGATCTGGAGAGG - Intronic
946012715 2:216579298-216579320 AGGAGAGTAGTTTTCTACTGGGG + Intergenic
946839809 2:223809138-223809160 TGGAGAGAAGTTTTGTGCAGGGG - Intronic
946873545 2:224106462-224106484 AGGGGAATAGTTATCCACAGAGG + Intergenic
1169744860 20:8933384-8933406 AGGAGAGCAGATATGTGCAGAGG + Intronic
1170092311 20:12604132-12604154 AGCAGAGTAGGTATCTGCAGAGG + Intergenic
1173048866 20:39539767-39539789 AGGAGAGTGGATGTGTGCAGAGG - Intergenic
1173923685 20:46764863-46764885 TGGAGAGTTGTCCTCTGCAGAGG + Intergenic
1175217829 20:57400770-57400792 AGGATAGAAGTTTTCTGCAGAGG + Intronic
1177781017 21:25622445-25622467 AGGAAATTAGTTATCTGCGAAGG + Intergenic
1179458196 21:41514164-41514186 AGGAAAGTATTTATCTGTGGAGG + Intronic
1179654452 21:42836779-42836801 AAGAGAGTTGTTGCCTGCAGGGG - Intergenic
1180054116 21:45348333-45348355 AGGAGAGATTTTATCTGCTGGGG + Intergenic
1180103385 21:45600628-45600650 AGGAGAGTTGTTAGCTGAAGAGG + Intergenic
1180849636 22:19009205-19009227 AGAAGAGTGGTTATCTTTAGGGG + Intergenic
1181420652 22:22795810-22795832 AGCAGAGTAGTTATCTGTAGAGG - Intronic
1181992021 22:26844520-26844542 AGAATAGTAATTATCTCCAGGGG - Intergenic
1182178659 22:28320893-28320915 AGAAGTGTAGTTTTCTGGAGAGG + Intronic
1182405412 22:30124491-30124513 AGGAGAGTGGTTACCTTCAGAGG - Intronic
1203300943 22_KI270736v1_random:76629-76651 AGGAGACAAGTTGACTGCAGTGG + Intergenic
952618809 3:35310478-35310500 AGGACAGTAGTGATCAGAAGGGG - Intergenic
953086370 3:39671945-39671967 AGGAGAGTACATATGTGGAGAGG + Intergenic
953190917 3:40687183-40687205 ACCAGAGAAGGTATCTGCAGAGG - Intergenic
953467229 3:43133143-43133165 AGGAGAATATTTATTTGAAGAGG + Intergenic
953717509 3:45328653-45328675 AGGGGAGTGGTTAGCTGCACGGG - Intergenic
955035583 3:55264070-55264092 GGGAGAGTAGTTATCTGCAGAGG - Intergenic
956799062 3:72740326-72740348 AAGAAAGTAGGTAGCTGCAGGGG + Intergenic
957888711 3:86326575-86326597 AGGAGGGTAGTGAGATGCAGGGG + Intergenic
958025190 3:88041123-88041145 AACAGAGTAGTTACCTGCAAAGG + Intergenic
958179878 3:90046504-90046526 AGGAGGGTAGTTATCCACAGAGG + Intergenic
960576994 3:119240164-119240186 AGGAGAGTAGTTATCAACAGTGG - Intronic
961360355 3:126363449-126363471 AGGAGAATCATTATGTGCAGAGG + Intergenic
962027408 3:131562908-131562930 AGGAGAGGAATTATCAGCAAGGG + Intronic
962126837 3:132628741-132628763 AGGAGGGTAGTGATCTTTAGAGG - Intronic
962365896 3:134780861-134780883 AGGAGAATAGCTAAATGCAGTGG - Intronic
963268117 3:143259268-143259290 AGGGGAATAGTTATCTGTAAAGG + Intergenic
963453669 3:145516645-145516667 AGAATACTATTTATCTGCAGAGG - Intergenic
964753796 3:160076646-160076668 TGGAGAACAGTGATCTGCAGGGG + Intergenic
965708646 3:171534801-171534823 AGGAGAGTAGTTATCTGCAGAGG + Intergenic
965893159 3:173540116-173540138 AGAAGGGTAGTCATCTGCAGAGG + Intronic
966480567 3:180403944-180403966 AGAAGAGGAGTTATCTGCAGAGG - Intergenic
966543519 3:181118303-181118325 AGGAAAGTAGATATCTAAAGTGG - Intergenic
966789907 3:183657695-183657717 AGGAGAATAGTATTCTTCAGTGG - Intronic
967221776 3:187253375-187253397 TGGAGAGGTGTTACCTGCAGTGG - Intronic
967831772 3:193925968-193925990 AGGGGAGTAGTTTTCTGTAGAGG - Intergenic
968225688 3:196970531-196970553 AGGTGAGGGGTTAGCTGCAGAGG - Intergenic
970327063 4:14936826-14936848 AGGAGAGTAGTTATCTCATTTGG - Intergenic
971777309 4:30983074-30983096 AAGGGAGTAGGTAGCTGCAGGGG + Intronic
974390853 4:61265468-61265490 AGGACAGTAGTTAACTAAAGTGG + Intronic
974688526 4:65265568-65265590 AGGAGAATAGTAATCTGCTGAGG - Intergenic
975688492 4:76942631-76942653 AGGAATGTACTTAGCTGCAGAGG - Intergenic
976914473 4:90353727-90353749 AGGAGAGTGCTTTCCTGCAGTGG - Intronic
977337378 4:95716120-95716142 AGAAGAGTAGTTATCTGCGGAGG + Intergenic
978665292 4:111174777-111174799 AGAAGAGTAGGTATCTGAAGAGG - Intergenic
979526226 4:121720097-121720119 AGAAGAGTAGAGATCTACAGTGG - Intergenic
980342915 4:131574058-131574080 GGGAGAGTAGTTATATAGAGGGG + Intergenic
986926777 5:12764118-12764140 AGAAGAGTAGTTATTTGCACAGG - Intergenic
987671483 5:21015738-21015760 AGGAGAGTAGATATCAGCAGTGG + Intergenic
988220288 5:28336665-28336687 AGGATAGTAGTTAGCTCTAGGGG - Intergenic
988625184 5:32867534-32867556 AGGAGAGAATTTATCTCTAGTGG + Intergenic
988929778 5:36026434-36026456 AAGAGACTGGTTATCTCCAGGGG - Intergenic
989340111 5:40364561-40364583 AGGAGAGTAGTTATCTGCAGGGG - Intergenic
989367876 5:40676625-40676647 AGGAGATTATTTACCTGCAGTGG - Intergenic
990563874 5:57009694-57009716 AGGAGAGTAGTGATTTCTAGAGG - Intergenic
991234165 5:64375142-64375164 AGGAGAGTAGTTATCCACAGAGG - Intergenic
995065047 5:107852081-107852103 AGGAGAGTGGTTACATGTAGAGG + Intergenic
995451420 5:112305356-112305378 AGCAGAGAAGTTGTCTGCACTGG - Intronic
996626928 5:125581067-125581089 AGAAGAGTAGTTATGAGCATGGG + Intergenic
999172414 5:149606601-149606623 ATGAGATTAGTTACCTACAGAGG - Intronic
1000621621 5:163492956-163492978 AAAAGAGTAGTTATCTGCATAGG + Intergenic
1003904177 6:10683773-10683795 ATGAGAGAAGTAAACTGCAGAGG + Intronic
1003981842 6:11397201-11397223 AGGAGAGTTGTCATTTTCAGAGG + Intergenic
1004468223 6:15905428-15905450 AGTAGAGACGTTACCTGCAGGGG + Intergenic
1004472914 6:15945101-15945123 AGGAGAGAAGGTATCTGTTGGGG + Intergenic
1005578165 6:27209272-27209294 AGAAGAGTAGTTACCCACAGAGG - Intergenic
1006956002 6:37872559-37872581 AGGAGAGTGGTACTCTGGAGAGG - Intronic
1007544848 6:42685972-42685994 AGAATAGTAGGTATCTTCAGAGG - Intronic
1009967557 6:70593357-70593379 AGCAGAGGGGTTCTCTGCAGTGG - Intergenic
1010325332 6:74556619-74556641 AGGAGAGTAGTTATCTTCAGAGG + Intergenic
1011404876 6:87008903-87008925 AGGAGAGTGGTTATTTTTAGAGG - Intronic
1012964794 6:105662005-105662027 AGGAGAGGAGTCACCTGCAATGG + Intergenic
1014289016 6:119536897-119536919 AGTAGGTTAGATATCTGCAGTGG - Intergenic
1014530768 6:122556719-122556741 AGGAGGAGAGTTTTCTGCAGAGG - Intronic
1015002108 6:128230410-128230432 ATGAGAGTGGTTATTTGTAGAGG + Intronic
1015319887 6:131860687-131860709 AGGAGAGTAGTTTATTTCAGAGG + Intronic
1015793273 6:136985672-136985694 AGGAGAGTTGGTTTCTGCTGAGG - Intergenic
1016132841 6:140498028-140498050 AGGAGAATAGTTATCTGCAGAGG + Intergenic
1016281209 6:142421115-142421137 AAGTCTGTAGTTATCTGCAGGGG + Intronic
1018421715 6:163645927-163645949 AGGAGAGCAGTTATCTATATGGG + Intergenic
1018457767 6:163967931-163967953 AGGAGAGTAGTTATCTTTGGAGG + Intergenic
1020526317 7:9263417-9263439 AGGATAGTAATTATGTGGAGTGG - Intergenic
1020584327 7:10047140-10047162 TGGAAAATAGTTATCTTCAGAGG - Intergenic
1020602584 7:10294425-10294447 AGGAGATTAATTATCTGGATGGG + Intergenic
1021305094 7:19022547-19022569 AGGAGTGTAGTTATCTGCAGAGG + Intronic
1024425069 7:49215959-49215981 AGGACAGTAGGTGTCTGCTGTGG - Intergenic
1030728816 7:112959586-112959608 TGGAGAGTAATTAAATGCAGTGG + Intergenic
1031096190 7:117424118-117424140 AGAAAAGTAGTTATCTCCAGAGG + Intronic
1032685564 7:134230858-134230880 AGGAGAGTGCTTATCTCCAGAGG + Intronic
1035227926 7:157443738-157443760 AGGAGAGTTATGATGTGCAGAGG - Intergenic
1036134940 8:6152313-6152335 AGGAGAGTAGTTAGCATCTGGGG + Intergenic
1036527348 8:9547541-9547563 AGGAGAGTAGTTATCCACAGAGG + Intergenic
1037953615 8:23036080-23036102 AGGAGAGTAGTTATCTGCAGAGG - Intronic
1038369890 8:26978110-26978132 AGGAGAGTAGTTACTTTTAGGGG + Intergenic
1038824959 8:30989989-30990011 AGGTGTGTAGCTCTCTGCAGTGG - Intergenic
1039272594 8:35899202-35899224 AGGAGAGGAGTTCTCAGAAGAGG - Intergenic
1039292312 8:36109904-36109926 TAAAGAGTAGTTATCTACAGAGG + Intergenic
1039626545 8:39060174-39060196 AGGAGAGTAGTTATTCGCAGAGG + Intronic
1040862811 8:52017423-52017445 AAGAAAGAAGTTATCTGAAGAGG - Intergenic
1042933260 8:74033518-74033540 AGGAGAATACTTATGAGCAGGGG + Intergenic
1043190408 8:77214325-77214347 AGGAGAAAAGATATATGCAGAGG - Intergenic
1045894017 8:107192689-107192711 AAGAGAGTAGTTTTCTGCTAGGG + Intergenic
1049485675 8:142858766-142858788 AGGAGACCAGATATCTGAAGTGG + Intronic
1049490910 8:142901446-142901468 AGGAGAGTAGTTATCAGCACAGG - Intronic
1051306301 9:15713639-15713661 AGGAGAATAGTTATCTGTAGTGG + Intronic
1051556269 9:18385845-18385867 AGGAAAGGAGTTATAGGCAGTGG + Intergenic
1052933212 9:34072620-34072642 AGGACAGGAATTTTCTGCAGGGG - Intergenic
1053207814 9:36202392-36202414 AGGAGAGTAGATAGCAGTAGCGG - Intronic
1053305846 9:36984330-36984352 AGTAGAGCAGTTATATGCACAGG + Intronic
1055678623 9:78691713-78691735 AGAAGAGTAGTAATCTGCAGAGG + Intergenic
1055690328 9:78823307-78823329 AGGTGAATACTTATTTGCAGAGG + Intergenic
1056041910 9:82677010-82677032 AAAAGAATAGTTAACTGCAGAGG - Intergenic
1057004944 9:91548838-91548860 AGGAAAATAATTATCTGCAGAGG + Intergenic
1057058993 9:91986568-91986590 AGGAGAGTGGTTATCTGTTGAGG - Intergenic
1059044520 9:110851336-110851358 AGGAGAGAAAATATCTCCAGTGG + Intergenic
1059893367 9:118831648-118831670 AGGTGAGTAGTTATCTGTGCAGG - Intergenic
1060288596 9:122278383-122278405 AGAATAATAGTTATCTGCAAAGG - Intronic
1061310021 9:129756018-129756040 AGGAAGGTAGCTACCTGCAGGGG - Intergenic
1062301751 9:135877316-135877338 AGATGAGTAGTTACCTGCATTGG + Intronic
1185728063 X:2438717-2438739 AGGAGAGTACTGGACTGCAGAGG + Intronic
1185957653 X:4509577-4509599 TGAAGAGTCATTATCTGCAGTGG + Intergenic
1186061202 X:5709453-5709475 AGGAGAATGGAGATCTGCAGAGG + Intergenic
1187438161 X:19291521-19291543 ACCAGAGAAGTTGTCTGCAGTGG - Intergenic
1187591840 X:20725366-20725388 AGGATTTTGGTTATCTGCAGGGG + Intergenic
1188773142 X:34179330-34179352 AGGAGAATAGTTATTTACTGAGG - Intergenic
1189533453 X:41910776-41910798 AGGAGTGTGGGTATCTGGAGAGG - Intronic
1191883574 X:65865967-65865989 AGGATAGTAGTTACCTCTAGTGG + Intergenic
1192059359 X:67807533-67807555 AGGATTGTAGTTACCTACAGAGG + Intergenic
1192176383 X:68888508-68888530 AGGAGAGAACTTTTCAGCAGAGG + Intergenic
1192531687 X:71893160-71893182 ATGAGTGTAGTTATCTGCAGAGG + Intergenic
1192824484 X:74681171-74681193 AGGATAGTAGTTATCTGCAGAGG - Intergenic
1193231452 X:79051700-79051722 AGAAGAATATTTAACTGCAGAGG + Intergenic
1193464939 X:81836816-81836838 AAAAGAGTAGTTATCTACAGAGG + Intergenic
1193543675 X:82801358-82801380 AGTAGAGTAGTTATCTACAAAGG - Intergenic
1193876039 X:86863894-86863916 ACAAGAGTAGTTATCTGTGGAGG - Intergenic
1194146244 X:90268485-90268507 AGTAGAGTGGTTATCTCTAGTGG + Intergenic
1195782355 X:108479889-108479911 AGGAGAGTAGTTTTTTGCAGAGG + Intronic
1196333954 X:114507771-114507793 AGAAGATTAGTTATTTCCAGAGG + Intergenic
1196802994 X:119560267-119560289 AGGAGACTATGTATCTGCGGAGG - Exonic
1197084199 X:122453523-122453545 GGGAGAGTAGTTATCTGCAAAGG + Intergenic
1197790254 X:130247598-130247620 AGGATAGTAGTCATTTACAGTGG + Intronic
1197904936 X:131414714-131414736 AGGAGAGTCTGTATCTCCAGGGG - Intergenic
1198170001 X:134096230-134096252 AGCAGAGTAGTTATCTGTGGAGG - Intergenic
1198197857 X:134382816-134382838 AGAATAATAGCTATCTGCAGAGG - Intronic
1198810607 X:140532344-140532366 AGGATAGTTGTTATCTGCTTTGG + Intergenic
1199008506 X:142730863-142730885 AGGAGAGTAGTTATCTCCAGAGG - Intergenic
1200491986 Y:3837756-3837778 AGTAGAGTGGTTATCTCTAGTGG + Intergenic
1200501687 Y:3957888-3957910 AGGAGAGTAGTCATCTTCAGAGG + Intergenic
1201100637 Y:10669026-10669048 TGGAGAGTAGTGCACTGCAGTGG - Intergenic
1201745963 Y:17374161-17374183 TGAAGAGTCATTATCTGCAGTGG + Intergenic