ID: 965708648

View in Genome Browser
Species Human (GRCh38)
Location 3:171534809-171534831
Sequence AGTTATCTGCAGAGGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965708645_965708648 4 Left 965708645 3:171534782-171534804 CCAAGAGCTGCTTCTCAAAAGGA No data
Right 965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG No data
965708643_965708648 15 Left 965708643 3:171534771-171534793 CCAGTAGCAGGCCAAGAGCTGCT No data
Right 965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG No data
965708642_965708648 16 Left 965708642 3:171534770-171534792 CCCAGTAGCAGGCCAAGAGCTGC No data
Right 965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965708648 Original CRISPR AGTTATCTGCAGAGGATGGC AGG Intergenic
No off target data available for this crispr