ID: 965708649

View in Genome Browser
Species Human (GRCh38)
Location 3:171534810-171534832
Sequence GTTATCTGCAGAGGATGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965708645_965708649 5 Left 965708645 3:171534782-171534804 CCAAGAGCTGCTTCTCAAAAGGA No data
Right 965708649 3:171534810-171534832 GTTATCTGCAGAGGATGGCAGGG No data
965708643_965708649 16 Left 965708643 3:171534771-171534793 CCAGTAGCAGGCCAAGAGCTGCT No data
Right 965708649 3:171534810-171534832 GTTATCTGCAGAGGATGGCAGGG No data
965708642_965708649 17 Left 965708642 3:171534770-171534792 CCCAGTAGCAGGCCAAGAGCTGC No data
Right 965708649 3:171534810-171534832 GTTATCTGCAGAGGATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965708649 Original CRISPR GTTATCTGCAGAGGATGGCA GGG Intergenic
No off target data available for this crispr