ID: 965708650

View in Genome Browser
Species Human (GRCh38)
Location 3:171534831-171534853
Sequence GGCCTTGCTGCAATATCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965708645_965708650 26 Left 965708645 3:171534782-171534804 CCAAGAGCTGCTTCTCAAAAGGA No data
Right 965708650 3:171534831-171534853 GGCCTTGCTGCAATATCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965708650 Original CRISPR GGCCTTGCTGCAATATCTTA AGG Intergenic
No off target data available for this crispr