ID: 965710408

View in Genome Browser
Species Human (GRCh38)
Location 3:171551213-171551235
Sequence AAGTATAAATAGTTGAACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965710408_965710412 22 Left 965710408 3:171551213-171551235 CCAGAGTTCAACTATTTATACTT No data
Right 965710412 3:171551258-171551280 CTCATGCTGATTTTAGGTGAAGG No data
965710408_965710411 16 Left 965710408 3:171551213-171551235 CCAGAGTTCAACTATTTATACTT No data
Right 965710411 3:171551252-171551274 CCTAGTCTCATGCTGATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965710408 Original CRISPR AAGTATAAATAGTTGAACTC TGG (reversed) Intergenic
No off target data available for this crispr