ID: 965710408 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:171551213-171551235 |
| Sequence | AAGTATAAATAGTTGAACTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 965710408_965710412 | 22 | Left | 965710408 | 3:171551213-171551235 | CCAGAGTTCAACTATTTATACTT | No data | ||
| Right | 965710412 | 3:171551258-171551280 | CTCATGCTGATTTTAGGTGAAGG | No data | ||||
| 965710408_965710411 | 16 | Left | 965710408 | 3:171551213-171551235 | CCAGAGTTCAACTATTTATACTT | No data | ||
| Right | 965710411 | 3:171551252-171551274 | CCTAGTCTCATGCTGATTTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 965710408 | Original CRISPR | AAGTATAAATAGTTGAACTC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||