ID: 965710581

View in Genome Browser
Species Human (GRCh38)
Location 3:171552958-171552980
Sequence ATGTAGGCCTATAAGAGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965710581_965710583 12 Left 965710581 3:171552958-171552980 CCATAGCTCTTATAGGCCTACAT No data
Right 965710583 3:171552993-171553015 TCTCATTCTCAGCTGTTAGAAGG No data
965710581_965710585 25 Left 965710581 3:171552958-171552980 CCATAGCTCTTATAGGCCTACAT No data
Right 965710585 3:171553006-171553028 TGTTAGAAGGTTCTAACCATGGG No data
965710581_965710584 24 Left 965710581 3:171552958-171552980 CCATAGCTCTTATAGGCCTACAT No data
Right 965710584 3:171553005-171553027 CTGTTAGAAGGTTCTAACCATGG No data
965710581_965710586 28 Left 965710581 3:171552958-171552980 CCATAGCTCTTATAGGCCTACAT No data
Right 965710586 3:171553009-171553031 TAGAAGGTTCTAACCATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965710581 Original CRISPR ATGTAGGCCTATAAGAGCTA TGG (reversed) Intergenic
No off target data available for this crispr