ID: 965713201

View in Genome Browser
Species Human (GRCh38)
Location 3:171577419-171577441
Sequence GCAAGTCCTGCTTTTCTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965713191_965713201 6 Left 965713191 3:171577390-171577412 CCTCAACCCCTTCTCTTTCACCC No data
Right 965713201 3:171577419-171577441 GCAAGTCCTGCTTTTCTAGGGGG No data
965713192_965713201 0 Left 965713192 3:171577396-171577418 CCCCTTCTCTTTCACCCTTAGTG No data
Right 965713201 3:171577419-171577441 GCAAGTCCTGCTTTTCTAGGGGG No data
965713195_965713201 -2 Left 965713195 3:171577398-171577420 CCTTCTCTTTCACCCTTAGTGGC No data
Right 965713201 3:171577419-171577441 GCAAGTCCTGCTTTTCTAGGGGG No data
965713189_965713201 8 Left 965713189 3:171577388-171577410 CCCCTCAACCCCTTCTCTTTCAC No data
Right 965713201 3:171577419-171577441 GCAAGTCCTGCTTTTCTAGGGGG No data
965713190_965713201 7 Left 965713190 3:171577389-171577411 CCCTCAACCCCTTCTCTTTCACC No data
Right 965713201 3:171577419-171577441 GCAAGTCCTGCTTTTCTAGGGGG No data
965713193_965713201 -1 Left 965713193 3:171577397-171577419 CCCTTCTCTTTCACCCTTAGTGG No data
Right 965713201 3:171577419-171577441 GCAAGTCCTGCTTTTCTAGGGGG No data
965713188_965713201 27 Left 965713188 3:171577369-171577391 CCTGGGGAAGGGGCAAGTACCCC No data
Right 965713201 3:171577419-171577441 GCAAGTCCTGCTTTTCTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965713201 Original CRISPR GCAAGTCCTGCTTTTCTAGG GGG Intergenic
No off target data available for this crispr