ID: 965720986

View in Genome Browser
Species Human (GRCh38)
Location 3:171661977-171661999
Sequence ATTTCAGGGTCCCCAAACTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965720986_965720990 -3 Left 965720986 3:171661977-171661999 CCTAAGTTTGGGGACCCTGAAAT 0: 1
1: 0
2: 0
3: 20
4: 166
Right 965720990 3:171661997-171662019 AATCTCTGCATGATATTTAAGGG 0: 1
1: 0
2: 2
3: 32
4: 355
965720986_965720989 -4 Left 965720986 3:171661977-171661999 CCTAAGTTTGGGGACCCTGAAAT 0: 1
1: 0
2: 0
3: 20
4: 166
Right 965720989 3:171661996-171662018 AAATCTCTGCATGATATTTAAGG 0: 1
1: 1
2: 0
3: 30
4: 246
965720986_965720991 1 Left 965720986 3:171661977-171661999 CCTAAGTTTGGGGACCCTGAAAT 0: 1
1: 0
2: 0
3: 20
4: 166
Right 965720991 3:171662001-171662023 TCTGCATGATATTTAAGGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965720986 Original CRISPR ATTTCAGGGTCCCCAAACTT AGG (reversed) Intronic
900518252 1:3093461-3093483 ATTCCAGGGCCCCCAAAGTCTGG - Intronic
900627394 1:3615208-3615230 TTTTCAGAGTCGTCAAACTTTGG + Intergenic
901646450 1:10719414-10719436 ATTTCAGGGTCCCTTGTCTTGGG - Intronic
902162880 1:14545968-14545990 ATTTCTGGTTCTCCTAACTTGGG - Intergenic
903411562 1:23147830-23147852 ATTTCAGTGTCTCCATACTTTGG + Intronic
904912245 1:33944153-33944175 AGTTCAGGGTCAGCAAACTGTGG - Intronic
907846899 1:58216993-58217015 CTTTCAGGGCTCCCAAAATTGGG + Intronic
907895034 1:58680101-58680123 ATTTCAAGGTCCTTAAATTTTGG + Intronic
908132966 1:61094687-61094709 AGTTCAGGGACCCAAAAGTTTGG - Intronic
908448906 1:64230402-64230424 AGTGCAGGGTCCTCAAATTTAGG - Intronic
909525310 1:76615491-76615513 ATTTCAGGGTTCAGAAACATAGG + Intronic
910249197 1:85177143-85177165 CTTTGGGGGTCTCCAAACTTTGG - Intronic
911102672 1:94106565-94106587 ATATAAGGTTCCTCAAACTTGGG + Intronic
911423625 1:97678369-97678391 AAATCGGGGTCCCCAAACTCGGG - Intronic
911826782 1:102497393-102497415 AAGTCAGGGACCCCAAACTGAGG + Intergenic
912303388 1:108539972-108539994 AAGTCAGGGACCCCAAACTGAGG + Intergenic
912669744 1:111614561-111614583 ATTTCTTCCTCCCCAAACTTAGG - Intronic
913672478 1:121110711-121110733 ATCTCATTGGCCCCAAACTTTGG + Intergenic
914024243 1:143898075-143898097 ATCTCATTGGCCCCAAACTTTGG + Intergenic
914662736 1:149806102-149806124 ATCTCATTGGCCCCAAACTTTGG + Intronic
916661610 1:166926984-166927006 ATTTGGGGGTCACCAAACTTGGG - Intronic
916669136 1:166996792-166996814 GTTTCAGGGTGCCCAATCTTTGG + Intronic
917491486 1:175502252-175502274 ACATCAGAGTTCCCAAACTTTGG - Intronic
917961713 1:180150915-180150937 AGTACAGGGTCCCCAAATTTGGG - Intergenic
918402889 1:184181162-184181184 ATTACAGGGAACCCAAACTGAGG + Intergenic
918444038 1:184598311-184598333 AATGCAGAGTCCCCAAACTTTGG - Intronic
919156295 1:193770136-193770158 AATTCTGGGTCCCCAATGTTTGG + Intergenic
920389648 1:205591518-205591540 ATTTCTGGGTCTCCAACCATAGG + Intronic
923626389 1:235617136-235617158 ATGTCATGGGCCCCAAACTATGG - Intronic
1063072152 10:2677567-2677589 GGTTGAGGGTCCCTAAACTTGGG - Intergenic
1065976832 10:30849111-30849133 TTTTCAGGGTCCCCAGCTTTTGG + Exonic
1066099694 10:32106767-32106789 CTTTCAAGCTCCCAAAACTTTGG - Intergenic
1066369993 10:34812619-34812641 ATTTAAGGGTCAACAATCTTGGG + Intronic
1067995303 10:51266102-51266124 ATTTCATGGTTCCCTAACTGTGG - Intronic
1068743876 10:60506429-60506451 ATTTTTGAGTCCCCAAACTTTGG - Intronic
1068954264 10:62807077-62807099 ATTTTAGGGCACCAAAACTTGGG + Exonic
1070582600 10:77733769-77733791 ATTGAAGGGCCTCCAAACTTGGG + Intergenic
1071102283 10:82053148-82053170 ATTTCAGTGTTCCAAAAATTGGG + Intronic
1071470456 10:85980507-85980529 ATTTCTGGTTCCCCAAGCTGGGG + Intronic
1071472706 10:85995375-85995397 TTTTCAGGGTCTCCAGCCTTAGG + Intronic
1076400861 10:130184298-130184320 ATTTCAGAAGCCCCAGACTTGGG - Intronic
1077293789 11:1814652-1814674 ATTTCTGTGTCCCCAAACCGGGG + Intergenic
1078256033 11:9659657-9659679 ATTTCAGTGTCTCCAAGCCTTGG - Intergenic
1079930377 11:26552041-26552063 ACTTCAGGGACCCCAAGCTTAGG - Intronic
1084039187 11:66531634-66531656 ACTTCTTTGTCCCCAAACTTAGG + Exonic
1086424377 11:86669789-86669811 ATTTCAGGGGACCAAAACCTAGG + Intronic
1094461982 12:30705907-30705929 ATTTCAAAGACCCTAAACTTTGG - Intergenic
1097031785 12:56095031-56095053 ATTCCAGGTTCCCAAAACTGTGG - Intronic
1098437856 12:70486900-70486922 AATTCTGGGTCCCCAAAATAGGG - Intergenic
1099507477 12:83497529-83497551 ATTTCAGGGAACACAAACATCGG - Intergenic
1100027271 12:90146109-90146131 CTTTCAGCTTCCTCAAACTTTGG - Intergenic
1102376184 12:112423051-112423073 ATTTCAGGGTCTCCAATCCTTGG - Intronic
1103891553 12:124242640-124242662 ATTTCAGGGAGCCCAGAGTTGGG - Intronic
1105810991 13:23995123-23995145 ATGTCAGGGTTCCCGAACCTTGG - Intronic
1106385435 13:29281071-29281093 AATTCAGGGTCCTCACAGTTTGG + Intronic
1107256080 13:38428171-38428193 ATTTCAGGGCCTCAAATCTTGGG + Intergenic
1109948004 13:69463289-69463311 ATTTCAGAGTCCTTAAACTTTGG + Intergenic
1112115733 13:96351286-96351308 ATTTCAACTTCCCCAAACTGGGG + Intronic
1112476356 13:99734512-99734534 ATTTCAGGGCTCCCTAACTTGGG - Intronic
1112556534 13:100473402-100473424 TTTTGAGTGTCCCCAAACTCTGG + Intronic
1115853815 14:37608726-37608748 ATTTGAGGCTCCCCACAATTAGG - Intronic
1116309860 14:43311130-43311152 AGCTCAGTGTCCCCAAACTTAGG - Intergenic
1117143301 14:52811194-52811216 ATGTGTGGGTCCCCCAACTTTGG + Intergenic
1118045530 14:61967177-61967199 ATTTCTGGTTCCCCAAACGTAGG - Intergenic
1119118123 14:72045993-72046015 AATTCAGGTTCCCAAAAGTTTGG + Intronic
1124002485 15:25770623-25770645 ATCTCAGGACCCCCAAACTTAGG + Intronic
1124076254 15:26447570-26447592 TTTTCAGGGTACACAATCTTAGG - Intergenic
1124397504 15:29316805-29316827 AATTCAGGTTCCCAAAACATAGG - Intronic
1125532672 15:40423850-40423872 ATTTCAGGGCTCCCAAACACTGG - Intronic
1128468551 15:67932924-67932946 CTTCCAGGGAACCCAAACTTAGG + Intergenic
1134410869 16:14002242-14002264 ATTACAGGCACCCCCAACTTTGG - Intergenic
1141490499 16:84369043-84369065 ATTCCTGGGTCTCCAGACTTGGG + Intronic
1143175637 17:4953422-4953444 ATTTCTGGGTCCCCCATTTTGGG + Intronic
1144657593 17:17047259-17047281 AGTTCAGGGTCAGCAAACTATGG - Intronic
1146022793 17:29293431-29293453 ATCTCAGGGCCCCCAAATTGAGG + Intronic
1148030171 17:44614321-44614343 ATTTCATGGTCCATAAAGTTGGG + Intergenic
1149172392 17:53825704-53825726 ACTTCAGGGTCCCCAACCCCTGG - Intergenic
1149623819 17:58065467-58065489 GATTCAGGGTCTCCAAAGTTGGG - Intergenic
1150160729 17:62895723-62895745 ATTTCATGCTCCCCAAGCTGAGG + Intergenic
1151993541 17:77594016-77594038 ACTTAAGGGTCCCCACACTGAGG + Intergenic
1156562880 18:38148580-38148602 TTTTTAGGGTCCCTAAACCTTGG - Intergenic
1157210390 18:45737108-45737130 AATTTAGGGTTCCCAAGCTTTGG + Intronic
1158612394 18:58953542-58953564 ATTGAAGGGCCTCCAAACTTGGG + Exonic
1158889120 18:61856702-61856724 TTTTGAGGGTCTGCAAACTTAGG + Intronic
1161964496 19:7540781-7540803 ATCACAGGGTCCCCAATCTCTGG + Intronic
1162300182 19:9840454-9840476 TTCTCAGAGTCCCCAAACCTGGG + Intronic
1164544939 19:29152539-29152561 ATCTCAGGGTCCCTAGATTTGGG - Intergenic
1164877009 19:31698268-31698290 ATTTCAGTGTCCCTAAAATAAGG - Intergenic
1165421293 19:35723234-35723256 GTGTTAGGGCCCCCAAACTTGGG - Exonic
925741920 2:7012886-7012908 ATTGCAGTGGCCCTAAACTTAGG - Intronic
925893013 2:8451270-8451292 ATTTAGGGGTCCCCAACCTCGGG - Intergenic
926713834 2:15907862-15907884 ATCTCAGCCTCCCCAAACTCTGG - Intergenic
927992348 2:27457087-27457109 ATTTCAGGGTTTCTTAACTTAGG + Intronic
928793745 2:34991391-34991413 ATTGCAGAGGCCACAAACTTCGG - Intergenic
930778224 2:55196542-55196564 ATTCCAGGCCCCCCAAACTCCGG + Intronic
931114475 2:59149538-59149560 ATTTCAGGTTCTGCAAATTTGGG + Intergenic
931910832 2:66898084-66898106 ATTTCCGGCTCCCCAGACATGGG + Intergenic
933565696 2:83947969-83947991 ATTTCAGGTTCCTCAGAATTGGG - Intergenic
935290664 2:101608219-101608241 AAATCATGGTCCTCAAACTTGGG + Intergenic
937020466 2:118646317-118646339 ACTTCAGGCTCCCAAAACTCTGG + Intergenic
937630180 2:124092472-124092494 ACTTCAGGGTTGGCAAACTTTGG - Intronic
938524750 2:132118800-132118822 ATGTCAGGGACCCCAAACGGAGG + Intergenic
940300823 2:152175375-152175397 CTTTGAGGGTCCCCAAACTCAGG + Intronic
941037316 2:160582573-160582595 TTTTCTGGGTCCCAAAATTTGGG - Intergenic
944245037 2:197522141-197522163 AAGTCAGGGACCCCAAACTGAGG - Intronic
944738405 2:202589180-202589202 ATTTCAGGGTCACAAAGCCTCGG - Intergenic
945301989 2:208223040-208223062 CTTTCATGGTTCTCAAACTTTGG + Intergenic
948909909 2:240997919-240997941 AATTCAGGGTCCCCACCCTGTGG - Intergenic
1170559827 20:17547365-17547387 ATTTCAGTGCCCTCAAAATTAGG - Intronic
1170564506 20:17589452-17589474 ATCTCAGGCTCCCAAAATTTTGG + Intronic
1172804912 20:37604853-37604875 AGATCGGGGTCCCCAACCTTGGG + Intergenic
1177037320 21:16060317-16060339 CTTTCAGGGATCCCAGACTTAGG - Intergenic
1177984692 21:27960121-27960143 AGTTCAGGGACCCCAAACGGAGG + Intergenic
950866489 3:16193762-16193784 ATCTCAAGGACCCCAAACTTCGG - Intronic
951946662 3:28145063-28145085 AATTCTGGGGCCCCAAACCTGGG - Intergenic
952574578 3:34759294-34759316 ATTTCAGCATCCCCAACCATGGG + Intergenic
955213600 3:56964724-56964746 CTTTCTGGCTCCTCAAACTTTGG - Intronic
956041368 3:65148808-65148830 ACTTCAGGCTCCCCAGCCTTTGG + Intergenic
957458694 3:80488449-80488471 TTTTCAGGGACCCCAAAAATAGG - Intergenic
963013156 3:140794446-140794468 AGTGAGGGGTCCCCAAACTTCGG + Intergenic
963090527 3:141479465-141479487 ATTTCAGGGTTTCCCAACTGTGG - Intergenic
964885883 3:161481870-161481892 ATCTCTGGGTCTCCAAAATTGGG + Intergenic
965720986 3:171661977-171661999 ATTTCAGGGTCCCCAAACTTAGG - Intronic
967000759 3:185331761-185331783 CATTCAGGGTCCCCAAACCACGG + Intronic
967417556 3:189235542-189235564 CTTTCAGTGTCCCCTAGCTTGGG - Intronic
971125603 4:23750597-23750619 ATTTCAGGTTCCTCACACCTTGG - Intergenic
972095964 4:35347457-35347479 TTTTCAGGGTCCCTAAGCTGTGG + Intergenic
972739472 4:41877057-41877079 ATTTCAGGATTCCAAAACTCTGG - Intergenic
974023514 4:56712036-56712058 CTTTCAGGGAACCCAGACTTAGG + Intergenic
974214807 4:58830569-58830591 AAGTCAGGGTCCCCAAACTGAGG - Intergenic
975729180 4:77320948-77320970 AAGTCAGGGACCCCAAACTGAGG - Intronic
979219369 4:118203931-118203953 ATTTCAGGGGATGCAAACTTTGG - Intronic
984837144 4:184032701-184032723 ATTTCAGAGTCCCCGAAGTCAGG + Intergenic
986321982 5:6639004-6639026 ATTTCATTGTTCCCAAACTTGGG + Intronic
991247457 5:64523155-64523177 ATTTCAAGGTCTCCAAACCCAGG + Intronic
991652226 5:68866786-68866808 CTTTCAGGTGCACCAAACTTAGG - Intergenic
993467337 5:88265405-88265427 ATTTAAGGGTCACCTAACTCAGG + Intronic
995639771 5:114242108-114242130 ATTTTAGGGTCCCTAAGCTCAGG - Intergenic
995654096 5:114405108-114405130 ATTTCTAGGTCTCCAAATTTTGG - Intronic
995880096 5:116835282-116835304 ATTTCAAGGTTTCCAAACATTGG + Intergenic
996105761 5:119500676-119500698 ATTTCAGGGCCTCTAAACTCAGG - Intronic
996999142 5:129738504-129738526 GTTTCAGGTTCCCTAAAATTGGG + Exonic
997943366 5:138178425-138178447 ATTTCTGGGCCCCCAAACGTTGG + Intronic
998906404 5:146909770-146909792 ATTTAAGAGTCCCCAAGCTCTGG + Intronic
999428827 5:151508980-151509002 GTTTTAGGGCTCCCAAACTTGGG - Intronic
1000913305 5:167048426-167048448 ATTTCAGAGTCACCATACATTGG + Intergenic
1001579541 5:172789488-172789510 ATTTCAGGGTCCTAAAATTCAGG - Intergenic
1001870947 5:175155348-175155370 ATTTTAGGGACATCAAACTTGGG + Intergenic
1004179492 6:13368609-13368631 ATTTCAAGGTCCCCAAAAGCAGG + Intronic
1007105375 6:39280008-39280030 ATTTCATGGCCCCCAATCTCTGG + Intergenic
1007519804 6:42442818-42442840 ATTTCAGAGTGCACAAAATTTGG + Intronic
1014163641 6:118199058-118199080 CTTTCAGGGTCCCTCAGCTTTGG - Intronic
1017697890 6:157037171-157037193 ATTTCAGTAGCCCCAAACTGGGG - Intronic
1018659898 6:166076391-166076413 CCTTCAGGGACCCCAGACTTGGG - Intergenic
1020803577 7:12761100-12761122 ATGTCAGGGACCCCAAACAGAGG - Intergenic
1021451854 7:20789863-20789885 ATTTCAGGGTGCATACACTTCGG + Intergenic
1025587304 7:62807068-62807090 AATACAGTGTTCCCAAACTTTGG + Intergenic
1026609643 7:71846236-71846258 GTTTCAGCTTTCCCAAACTTTGG - Intronic
1027957686 7:84902461-84902483 ATTCCAGGGTCCCAAACCTTTGG + Intergenic
1028584953 7:92443655-92443677 AATTCAGGGACCCCAAACGGAGG - Intergenic
1028704681 7:93826426-93826448 ATTTGCGAGTCCCCAAACTCAGG - Intronic
1031561552 7:123244719-123244741 ATTTCAGGCTTCCCCAAATTGGG + Intergenic
1034609341 7:152351594-152351616 AAGTCAGGGACCCCAAACTGAGG + Intronic
1035974618 8:4294193-4294215 ATTTCAGGGACACCAAAATGCGG + Intronic
1036016827 8:4794767-4794789 ACTTCAGAGTCCCCGAATTTGGG - Intronic
1038266547 8:26043107-26043129 CCTTCCGGGTCCCCCAACTTGGG - Intronic
1041292516 8:56320446-56320468 ATTCCAGGGTTCCCAACCTCGGG - Exonic
1044754226 8:95445021-95445043 ATTTCAGGGTTCCAAGCCTTGGG + Intergenic
1045654956 8:104377174-104377196 ATGTCAGGGTCTCCAACCCTTGG - Intronic
1046896760 8:119481242-119481264 ATTGAAGGGCCTCCAAACTTGGG - Intergenic
1047019173 8:120756546-120756568 ATTTGAGGTTCCCCAAATTTTGG - Intronic
1047970301 8:130078661-130078683 TTTACAGGGTCCCCCAAATTAGG + Intronic
1049995725 9:1032105-1032127 ATTTCAGGGTTCCCAGGCTGGGG + Intergenic
1051629807 9:19130759-19130781 AGATTGGGGTCCCCAAACTTTGG - Intronic
1053069235 9:35091417-35091439 ATCTCAGGGTCCCCTGACTGTGG - Exonic
1056503129 9:87230426-87230448 ATTTAAATATCCCCAAACTTAGG + Intergenic
1057871250 9:98719883-98719905 ATGTCAGTGTCTCTAAACTTTGG + Intergenic
1059834223 9:118131978-118132000 ATTTCTGGGTCCTCAATTTTAGG - Intergenic
1061944758 9:133902398-133902420 ATTTCAGGCTCCGCAAATCTGGG - Intronic
1187315806 X:18193748-18193770 ATTTCAAACTCACCAAACTTGGG + Intronic
1188814580 X:34695644-34695666 TTTTCAGTGTACCTAAACTTTGG + Intergenic
1191060203 X:56287131-56287153 ATGTCAGGGACCCCAATATTTGG - Intronic
1194952874 X:100147562-100147584 TTTTCAGTGTTTCCAAACTTAGG - Intergenic
1195920238 X:109976413-109976435 ATTTCAGGGGACCAAGACTTGGG - Intergenic
1196888560 X:120270680-120270702 CTTTCAGGATCCCACAACTTTGG + Intronic
1199202110 X:145103826-145103848 TTATCAGGGCCCCGAAACTTAGG - Intergenic
1200424801 Y:3009002-3009024 CTTTCAGGGAGCCCAAACCTAGG - Intergenic