ID: 965722153

View in Genome Browser
Species Human (GRCh38)
Location 3:171673844-171673866
Sequence ATGTGGGGACAGAAGTAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 445}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965722153_965722159 11 Left 965722153 3:171673844-171673866 CCATCCTACTTCTGTCCCCACAT 0: 1
1: 0
2: 0
3: 42
4: 445
Right 965722159 3:171673878-171673900 ATTTGAGCTGTAGTTGGTAAAGG 0: 1
1: 0
2: 0
3: 6
4: 121
965722153_965722161 23 Left 965722153 3:171673844-171673866 CCATCCTACTTCTGTCCCCACAT 0: 1
1: 0
2: 0
3: 42
4: 445
Right 965722161 3:171673890-171673912 GTTGGTAAAGGAAGCAGATTGGG 0: 1
1: 0
2: 1
3: 18
4: 219
965722153_965722160 22 Left 965722153 3:171673844-171673866 CCATCCTACTTCTGTCCCCACAT 0: 1
1: 0
2: 0
3: 42
4: 445
Right 965722160 3:171673889-171673911 AGTTGGTAAAGGAAGCAGATTGG 0: 1
1: 0
2: 4
3: 28
4: 463
965722153_965722158 5 Left 965722153 3:171673844-171673866 CCATCCTACTTCTGTCCCCACAT 0: 1
1: 0
2: 0
3: 42
4: 445
Right 965722158 3:171673872-171673894 CAAGATATTTGAGCTGTAGTTGG 0: 1
1: 0
2: 0
3: 15
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965722153 Original CRISPR ATGTGGGGACAGAAGTAGGA TGG (reversed) Intronic
900648451 1:3719453-3719475 GGTTGGGGACAGAAGGAGGAGGG - Intronic
900686361 1:3950664-3950686 ATATGAGGAAAGAAGTAGCAGGG + Intergenic
901154335 1:7125377-7125399 ATGGGGAGACAGAAGTAGATAGG + Intronic
901639914 1:10687967-10687989 TAGTGGGGGCAGAAGGAGGAAGG - Intronic
901741185 1:11343026-11343048 AGGTGGGGAGAGGAGCAGGAGGG + Intergenic
902468970 1:16634921-16634943 ATCTGGGGTCAGAGGTGGGAGGG + Intergenic
902675611 1:18006556-18006578 AGGGGGGAACAGAAGAAGGAAGG + Intergenic
903191839 1:21660939-21660961 AGCTGGGGACAGGAGGAGGAGGG + Intronic
903261946 1:22136315-22136337 TTGTGGGGACACAGGTCGGATGG - Intronic
903410563 1:23140082-23140104 ATGTGGGGGTAGTAGTAGGGTGG - Intronic
904392518 1:30195372-30195394 ATGTGAGAAGAGAAGGAGGAAGG - Intergenic
904523040 1:31110876-31110898 GGGTGGGGACAGAAATATGAGGG + Intergenic
905278712 1:36835516-36835538 ATGTGGAGAAGGAAGGAGGAAGG - Intronic
905310688 1:37046903-37046925 GTGGGGGGTCAGAAGGAGGAGGG + Intergenic
907114086 1:51953333-51953355 ATGTGGGGAGAGAAGTGAGGTGG + Intronic
907394291 1:54178531-54178553 ATGTGGAGTCAGAGGGAGGAGGG + Intronic
907604697 1:55804997-55805019 TCCTGGGGCCAGAAGTAGGAGGG - Intergenic
907819410 1:57952509-57952531 ATGTGGGGACAGAAAAGGAATGG + Intronic
907875692 1:58485137-58485159 ATGCGGGGACAGATGTATAAGGG + Intronic
908004051 1:59710072-59710094 ATGTGTGGTCAGCAGTGGGATGG + Intronic
909573306 1:77142779-77142801 ATGTGTGGAGAGAAGGAGGAAGG - Intronic
910307636 1:85784601-85784623 ATGTGTGGAAAGAAGAGGGAAGG + Intronic
911117497 1:94260990-94261012 ATGGGGGTGCAGAATTAGGAAGG - Intronic
911994513 1:104747529-104747551 ATGAGGGGATAGCAGTGGGAGGG + Intergenic
912189747 1:107323999-107324021 ATGTGGTCACAGAAGCACGAAGG - Intronic
912309971 1:108610341-108610363 ATGTGGGCACAGATGCAGGTAGG + Intronic
913199427 1:116484058-116484080 ATGTGGGGGCAGGAGGGGGAGGG + Intergenic
914442370 1:147718693-147718715 ATGTGGTGTCAGAACTAGGCTGG - Intergenic
914780370 1:150780320-150780342 TTGAGGGGCCAGAAGTGGGAGGG - Intergenic
915091376 1:153428659-153428681 ATGTGTGGGCAGAGGGAGGAGGG + Intergenic
915822720 1:159042539-159042561 ATCTGGGGACAGAACTGAGATGG - Intronic
915823088 1:159046699-159046721 ATTTGGGGACAGAATTGAGATGG - Intronic
915969923 1:160347427-160347449 CTGTGGGGACAGACGAAAGAAGG - Intronic
916058943 1:161086042-161086064 ATGTGGGGAACGAAGTCAGAAGG - Intronic
916265768 1:162888515-162888537 ATCTTGGGACAGAAATAGGTAGG + Intergenic
916588104 1:166165884-166165906 CGATGGGGACAGCAGTAGGAAGG + Intronic
917080544 1:171252807-171252829 GTGAGGGGACAGAAGAGGGAGGG + Intronic
917193760 1:172445441-172445463 ATGTGGGGTGAGAAAGAGGATGG - Intronic
917226656 1:172790787-172790809 ATGTGGGGATAAATGGAGGAGGG + Intergenic
917303605 1:173604781-173604803 CTGAGGGGACAGCAGTAGGATGG - Intergenic
918003983 1:180524739-180524761 ATGTGGAATCAGAAGTAGGGAGG + Intergenic
918027830 1:180770346-180770368 ATGTGAGGACATAATCAGGAAGG - Intronic
918437763 1:184533930-184533952 CTATGGGGACAGAAGTTGGTTGG + Intronic
918490590 1:185077301-185077323 AGGGAGGGAGAGAAGTAGGAGGG - Intronic
919724122 1:200871142-200871164 CAGTGGGGACAGAAATGGGAGGG - Intergenic
919839520 1:201598831-201598853 GTTTGGGGACAGAAGTAAGTGGG + Intergenic
919980669 1:202641249-202641271 CTCTGGTGACAGAAGTGGGAGGG + Intronic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
920319980 1:205112754-205112776 ATGTCGAGACAGTATTAGGAGGG + Intronic
921235066 1:213118323-213118345 ATTTGGGGGCAGGGGTAGGAGGG + Intronic
922598445 1:226832086-226832108 AAGTTGGGACAGAAGGAAGATGG + Intergenic
923035220 1:230280754-230280776 CTTTGGGGAAAGAATTAGGAAGG + Exonic
923268504 1:232334698-232334720 AGGGGAGGACAGAAGAAGGAGGG - Intergenic
1063313924 10:4983612-4983634 ATGGGTGGAGAGAATTAGGATGG - Intronic
1063327863 10:5123080-5123102 ATGGGTGGAGAGAATTAGGATGG - Intronic
1063556430 10:7084062-7084084 TGGTGGGAACAGAAGGAGGAGGG + Intergenic
1063567159 10:7180756-7180778 ATGTGGGGACAGCTGTTGGGAGG + Intronic
1063780706 10:9319985-9320007 ATGTGGGGACAGATGAAAGTGGG + Intergenic
1064497580 10:15929651-15929673 ATGTGTTGACAGAATTGGGAAGG - Intergenic
1064867199 10:19894434-19894456 CTGAGGGGACAAAAGTAGGTTGG + Intronic
1065164006 10:22955522-22955544 ATGTGGTGACAGAATTAGATAGG + Intronic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1067716798 10:48696433-48696455 ATGTGGAGACACGAGCAGGAGGG - Intronic
1067743253 10:48913103-48913125 ATCTGGGGGCAAGAGTAGGATGG + Intronic
1068561512 10:58519929-58519951 ATGTGTGGACAGTGGGAGGAGGG - Intronic
1068721154 10:60247547-60247569 ATTCGGAGACAAAAGTAGGATGG - Intronic
1069807928 10:71137604-71137626 ATGAGGGGACAGGAGGGGGAAGG - Intergenic
1070078092 10:73157756-73157778 AGATAGGGACAAAAGTAGGAGGG - Intronic
1070693949 10:78547998-78548020 ATGTGGGTGGAGAATTAGGAGGG - Intergenic
1070920976 10:80186277-80186299 CTGTGGGGACTGAAGGGGGAAGG + Intronic
1071757753 10:88563676-88563698 ATGTGAGGAAAGGAGTGGGATGG + Intronic
1072275279 10:93816701-93816723 AGGTAGGGAGAGAAGGAGGAAGG + Intergenic
1072341175 10:94452190-94452212 ATGTGGGGACAGGAGTTATATGG - Intronic
1072704565 10:97671367-97671389 ATTTGAGGCCAGAAGTTGGAGGG + Intronic
1073662645 10:105493861-105493883 ATGGAGGGAAAGAAGAAGGAAGG + Intergenic
1074286494 10:112102783-112102805 ATGTGGGGAAAATAGAAGGAAGG - Intergenic
1075540568 10:123310027-123310049 GTGTGGGGCCAGCAGTGGGAGGG + Intergenic
1075639808 10:124056536-124056558 GTGTGGGGACAGGGGAAGGAAGG + Intronic
1075832119 10:125420141-125420163 GTGTGGGGACAGGGGCAGGAAGG + Intergenic
1077358047 11:2127682-2127704 CAGTGGGGACAGGAGCAGGAGGG + Intergenic
1077613501 11:3659560-3659582 CTGAGGGGACAGGAGTAGCAGGG - Intronic
1077934964 11:6773866-6773888 TTGTGAGGTCAGAAGTAAGATGG + Intergenic
1078147333 11:8730721-8730743 ATGTGTGGAGAGAAGCGGGAGGG - Exonic
1078397778 11:10996813-10996835 CTTTGAGGACAGAAGTTGGAAGG - Intergenic
1078405264 11:11065321-11065343 ATGAGGATACAAAAGTAGGAGGG - Intergenic
1078529466 11:12125781-12125803 AGATGGGGACAGGAGTAGGAGGG + Intronic
1078736354 11:14024425-14024447 ATGGGGGGCCAGAAGAGGGATGG + Intronic
1079396644 11:20069331-20069353 GAGAGGGGACAGAAGTAGGGAGG + Intronic
1080408043 11:31997373-31997395 TGGTGGGGAAAGAAATAGGAGGG - Intronic
1080951270 11:37035958-37035980 ATATGTAGACAGAACTAGGAAGG - Intergenic
1081517711 11:43849457-43849479 AGGAGGCCACAGAAGTAGGAAGG - Intronic
1081704085 11:45170564-45170586 ATGTGGGGTGGGGAGTAGGAAGG + Intronic
1081759696 11:45568637-45568659 AGGTGGGGCAAGAAGTAGGAGGG - Intergenic
1084030563 11:66478276-66478298 ATGTGATGAGAGAAGGAGGAGGG + Intergenic
1084060466 11:66669839-66669861 TTGTGGAGACAGAAACAGGAGGG - Intronic
1084769302 11:71332255-71332277 ATGTGGGAAGAGGAGTAGGGTGG - Intergenic
1084792522 11:71483523-71483545 ATGTGAGGACAGTGGAAGGAGGG + Intronic
1085241612 11:75061319-75061341 ATGTGGGGACAGTTGTGGGGTGG + Intergenic
1085243751 11:75080436-75080458 AGGTGGGGGCAGTAGGAGGAGGG - Intergenic
1086101313 11:83102750-83102772 GTGTGGGAAGAGAAGTGGGAAGG - Intergenic
1086245125 11:84742549-84742571 TTGTGGGGACAGAGGTATGTAGG - Intronic
1086284666 11:85233185-85233207 AGCTGGGGACAGAAATAGGTGGG - Intronic
1086344106 11:85878333-85878355 ATGAGGGGGCAGAACTGGGAGGG - Intronic
1086815906 11:91370393-91370415 ATGTGGGCCCAGAATGAGGAGGG + Intergenic
1086917366 11:92546480-92546502 ATGAGGAGAAAGAAGTAAGAAGG + Intronic
1088257748 11:107916796-107916818 ATGTGGAGCCAGAAGGAGGATGG - Intronic
1088905272 11:114150869-114150891 ATGTGGGGACAGCATAAGGTAGG - Intronic
1089308041 11:117538951-117538973 TGCTGGGGACAGAAGGAGGAGGG - Intronic
1089950602 11:122522159-122522181 ATGAGGAGAAAGAAGAAGGAAGG + Intergenic
1091937283 12:4443913-4443935 AGGTGGGAACAGAAGAAGCACGG + Intronic
1092166912 12:6348021-6348043 GGGTGGGGGCAGAAGTGGGAAGG + Exonic
1092524014 12:9298559-9298581 TTGTGGGGAAAGGAGCAGGATGG - Intergenic
1092543256 12:9433255-9433277 TTGTGGGGAAAGGAGCAGGATGG + Intergenic
1092961453 12:13600208-13600230 ATGAGGGGAAAGAGGAAGGAAGG - Intronic
1092994766 12:13939437-13939459 ATGTGGCAACAGAAGGAGCAAGG - Intronic
1094196744 12:27757701-27757723 AGTTGGTGTCAGAAGTAGGATGG + Intergenic
1095365426 12:41398429-41398451 GTGAAGGGAAAGAAGTAGGAAGG + Intronic
1096260246 12:50085614-50085636 GGGTGGGGGGAGAAGTAGGAGGG + Intronic
1096537712 12:52286117-52286139 ATGTGAGGCCAGGAGTGGGAGGG + Exonic
1097007269 12:55928260-55928282 AAGTGGGGATATAAGCAGGAAGG - Intronic
1097044574 12:56177973-56177995 ATGTGGGGACAGGAGGGAGAAGG + Intronic
1097219279 12:57437743-57437765 ATGAGGGGCCAGAAATGGGAAGG - Intronic
1097374303 12:58822232-58822254 ATGTGGGCTCAGGAGTAGAAGGG - Intergenic
1097703651 12:62845945-62845967 ATGTGGGGAGAGTAGTAAGCTGG - Intronic
1098221418 12:68273911-68273933 ATGTGTAGATAGAAGTAGGGGGG + Intronic
1098487926 12:71043205-71043227 ATGGGGGCACTGAAGTGGGATGG - Intergenic
1098955896 12:76689451-76689473 AGGTGGGGACAGAGGAAGGAAGG - Intergenic
1099530885 12:83779649-83779671 ATGTAGTTACAGAAGTAGGGTGG - Intergenic
1100409565 12:94301879-94301901 ATTTGGGGATAGAGGTTGGAAGG - Intronic
1100960625 12:99958776-99958798 CTGAGTGGACAGAAGTAGTAAGG + Intronic
1101035449 12:100701470-100701492 AGGTGGGGACAGGAGTAGGCTGG - Intergenic
1101452224 12:104790104-104790126 CTCTGGGGACAGAAATAAGAAGG - Intergenic
1101581341 12:106043972-106043994 ATGAGGGGAAGGAAATAGGAAGG + Intergenic
1101581728 12:106047922-106047944 ATGAGGGAACAGAAATAGGAAGG - Intergenic
1101661265 12:106767636-106767658 AGGTGGGAAGAAAAGTAGGAAGG - Intronic
1102815845 12:115865774-115865796 ATGTGGGGTCAGGAGCAGGTAGG - Intergenic
1104752199 12:131246815-131246837 CTGTGAGCACAGAAGTGGGAAGG - Intergenic
1107728530 13:43324630-43324652 AGGTGGGGAAAGTAGCAGGAAGG + Intronic
1107996801 13:45869175-45869197 GTGTGAGGACAGGAGAAGGAAGG - Intergenic
1108811227 13:54225515-54225537 ATGAGGGGCCAGAGATAGGAGGG + Intergenic
1109608586 13:64732967-64732989 ATGTGAGGACAAAACTAGAAGGG - Intergenic
1112207229 13:97336925-97336947 AGGAGTGGACAGAAGAAGGAGGG - Intronic
1113348087 13:109500247-109500269 GTTTGTGGACAGAAGCAGGATGG + Intergenic
1113588316 13:111480780-111480802 ATGGGGAGCCAGAAGAAGGAGGG - Intergenic
1114638709 14:24204455-24204477 ATGTAGGGACTGAGGCAGGAGGG + Intronic
1117098958 14:52325804-52325826 ATGTTGGGACAAGAGCAGGAAGG - Intronic
1117507682 14:56418910-56418932 AGGTGGGGTCAGAAGAAAGAGGG - Intergenic
1117971011 14:61250819-61250841 ATGTGGGGCAAGAAGTAGATGGG + Intronic
1117988661 14:61413086-61413108 AAGGGGGGAAAGAAATAGGATGG - Intronic
1118438532 14:65792447-65792469 GTGTGGAGACAGAAGTTGGGAGG + Intergenic
1118793857 14:69121696-69121718 ATGTGGGGTCAGAAGGAGTATGG + Intronic
1118906611 14:70028026-70028048 AGGTGGGGACAGAAGCTGGCTGG + Intronic
1120440079 14:84525563-84525585 ATGTGGGTAGATAAGTAGGTAGG + Intergenic
1121518219 14:94568008-94568030 TTGTGGGGACAGAACTCAGATGG + Intronic
1121573377 14:94964218-94964240 TTGTGGGTACAGAAGCAGGAGGG - Intergenic
1121577277 14:94998424-94998446 ATTTGGAGAAGGAAGTAGGAGGG + Intergenic
1121662501 14:95645998-95646020 CTGTGGGGCCAGAACTGGGAAGG - Intergenic
1122313394 14:100811505-100811527 TGGTGGAGACAGAAGTGGGAAGG + Intergenic
1122364965 14:101189581-101189603 ATGTGGGTACATAAGGAGGGAGG + Intergenic
1122994653 14:105256484-105256506 AGGTGGGGAAAGATGCAGGACGG + Intronic
1123072144 14:105647117-105647139 AGGTGGGGGCAGAAGGAGCAGGG - Intergenic
1123092153 14:105746635-105746657 AGGTGGGGGCAGAAGGAGCAGGG - Intergenic
1123883268 15:24695759-24695781 ATATGAGGACAGGAGCAGGAAGG + Intergenic
1124496364 15:30189999-30190021 CTCTGGTGACAGAAGTGGGAGGG + Intergenic
1124597905 15:31106101-31106123 TTGTGGGGAAAGAAGAATGAGGG - Intronic
1124747211 15:32348649-32348671 CTCTGGTGACAGAAGTGGGAGGG - Intergenic
1125233963 15:37490278-37490300 ATGAGGAGATAGAATTAGGAAGG + Intergenic
1125731843 15:41896815-41896837 AGGTGGGGACAGAAGAGGGTAGG - Exonic
1126183078 15:45804972-45804994 TTGTGGGAACAGAAGTGGGTAGG - Intergenic
1127822937 15:62676102-62676124 ATCCAGGGACTGAAGTAGGAAGG + Intronic
1127827287 15:62715861-62715883 AGGTGGGGACAGAGGGAAGAGGG - Intronic
1127901887 15:63346903-63346925 ATGTGGGGAAAGAAGGACTAGGG + Intronic
1128296469 15:66524866-66524888 ATGTGAGGGCAAAAGTATGATGG - Intronic
1128452243 15:67812265-67812287 ATGTGGGGTCAGGAATAGGGAGG + Intergenic
1128489048 15:68127576-68127598 ATGAGGAGAAAGAAATAGGAGGG - Intronic
1128624130 15:69181977-69181999 ATGTGGGCACAGACGTAGTTAGG + Intronic
1128981859 15:72194021-72194043 ATGTGGGAAAGGAAGGAGGAGGG - Intronic
1129572318 15:76700936-76700958 TTTTGGGGACATAAGTAGGAGGG + Intronic
1130311096 15:82755058-82755080 ATGTTTGGAAGGAAGTAGGAGGG + Intergenic
1131035696 15:89220636-89220658 ATGTGGGCACAGAGGTAGACAGG + Intronic
1131116043 15:89796401-89796423 ATGTGGGGAAAGCAGTAAGAGGG + Intronic
1131557746 15:93414248-93414270 ATGGGGGGCCAGAAGGGGGACGG + Intergenic
1133821541 16:9241529-9241551 ATGAGGTCAAAGAAGTAGGAAGG - Intergenic
1134287978 16:12879120-12879142 ATGGAGGGAGAGAAGGAGGAAGG - Intergenic
1134682381 16:16135311-16135333 AAGTGGGGACAGATGGAGGAGGG - Intronic
1135830663 16:25769953-25769975 ATATGGTGACAGAACTAGAAAGG - Intronic
1136022119 16:27446906-27446928 ATGTGGTGACAGAGGTGGGAGGG + Intronic
1136363559 16:29797454-29797476 ATTTGGGGACAGAACTCAGAAGG + Intronic
1137827153 16:51508705-51508727 ATGTAGGGAAAGAGGTTGGAAGG + Intergenic
1138385836 16:56635322-56635344 ATCCGGGGACAGGAGCAGGAGGG + Intergenic
1138628827 16:58277017-58277039 ATGGGGTGACAGGAGTGGGATGG + Intronic
1139004126 16:62550455-62550477 AAGCAGGGACAGAAGAAGGAAGG - Intergenic
1140519293 16:75567525-75567547 GTCTGGGGAAAGGAGTAGGAGGG + Intronic
1140914668 16:79483088-79483110 AAGTAGGGACAGAGGGAGGAAGG - Intergenic
1141817514 16:86422724-86422746 CTCTGGGGACAGAAGTTGGAAGG + Intergenic
1143029247 17:3958498-3958520 AGGTGGGGACAGATCCAGGAAGG - Intronic
1143538881 17:7558032-7558054 AGGTGGGAGCAGAGGTAGGAAGG + Intronic
1143569219 17:7744322-7744344 TTGTGGGGCCAAATGTAGGAGGG + Intronic
1143589608 17:7874309-7874331 AGATGGGGCCAGAAGTGGGATGG + Intronic
1143964254 17:10745347-10745369 ATGTGTGGACAGAAGCAGGGGGG - Intergenic
1143974752 17:10821600-10821622 AGGGGAGGACAGAAGAAGGAGGG - Intergenic
1144041825 17:11418764-11418786 ATGTGATGACAGCAGTAGGCAGG - Intronic
1144350278 17:14388595-14388617 AGGTGGGGATAGAAGGAAGAGGG + Intergenic
1144422893 17:15114201-15114223 ATGAGGGGAAAGAAGCAAGATGG - Intergenic
1144703917 17:17355162-17355184 CTGTGGGGAAAGAAGGGGGAAGG + Intergenic
1146545953 17:33738627-33738649 ATGTGGGGATAGTAGAAGTAGGG - Intronic
1146846535 17:36184617-36184639 ATGTGGAGAAAGAAGCAGAATGG - Intronic
1147447581 17:40484209-40484231 ATGGTGGGAGAGAAGGAGGAGGG - Intronic
1148808527 17:50276366-50276388 TTGTGGGGACAGGAACAGGAAGG - Intronic
1149148999 17:53536456-53536478 ATGTGGTGAAAGAAGGAGCAAGG - Intergenic
1149515807 17:57280089-57280111 ATGTAGGGAGGGAAGTAGCAGGG + Intronic
1150742068 17:67787382-67787404 AAATGGGGGCAGAAATAGGAGGG - Intergenic
1152451391 17:80383227-80383249 ACTTGGGGACAGGAGGAGGATGG - Intronic
1156127240 18:33921096-33921118 ATGGTGGGACAGACATAGGATGG - Intronic
1156540918 18:37909449-37909471 TTGTGGGGAGAGAAGGAGGAAGG + Intergenic
1157630722 18:49092757-49092779 ATCTGGGGACAGAAGGAGAAGGG + Intronic
1158346624 18:56522829-56522851 AAGGGAGGACAGAAGAAGGAAGG - Intergenic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1159726352 18:71965284-71965306 TTTTGGGGTCAGATGTAGGATGG - Intergenic
1159950337 18:74478298-74478320 AGGTGGGGGCAGGAGCAGGAAGG - Intergenic
1161510521 19:4668369-4668391 ATGTCTGGACAGAAGGAGGGAGG - Intronic
1161851842 19:6741200-6741222 AAGGGGAGACAGAGGTAGGAGGG - Intronic
1161984440 19:7645897-7645919 AGATGGGGACAGAAGGGGGACGG - Intronic
1162143798 19:8600807-8600829 ACGTGGGGACAGGGGTAGAAAGG - Intronic
1163089589 19:15010651-15010673 AGGTGGGGGGAGGAGTAGGATGG - Intronic
1163272525 19:16262757-16262779 CTGGGGAGTCAGAAGTAGGATGG - Intergenic
1163477129 19:17532932-17532954 TTATGGGGGCAGAGGTAGGATGG + Intronic
1165462521 19:35952542-35952564 ATGTGAGTACAGAGGCAGGAAGG - Intergenic
1165488248 19:36108359-36108381 ATGTGGGGGTAGAAGCAGGGGGG - Intergenic
1166235087 19:41449921-41449943 ATGTGATAACAGAAGTAGGAGGG + Intergenic
1166288372 19:41846328-41846350 ATGTGAGGACATGAGTAGGTTGG + Intronic
1167575676 19:50316359-50316381 AGGTGAGGGCAGATGTAGGAGGG + Intronic
1167796967 19:51715872-51715894 CAGTGGGGAGTGAAGTAGGAAGG - Intronic
1168456871 19:56519028-56519050 ATGAGGTTATAGAAGTAGGAAGG - Intronic
1168668500 19:58222928-58222950 ATGAGGGGGAAGAAGTAGGCTGG + Intergenic
925315761 2:2921914-2921936 CGGTGGGGAGGGAAGTAGGAAGG + Intergenic
925508441 2:4596918-4596940 ATTTGGGTAAAGAAGAAGGAAGG + Intergenic
925742475 2:7018172-7018194 AGGTGGGGACAGCAGTGAGACGG + Intronic
926357736 2:12056802-12056824 ATGTGGGGGCTGAACTAGGGTGG + Intergenic
928200853 2:29246810-29246832 AGGTGGGGAGAGCAGTTGGAAGG - Intronic
928407306 2:31024419-31024441 GTGAGGGGAGAGCAGTAGGAGGG - Intronic
929002568 2:37362649-37362671 ATATGAAGACAGAAGTTGGATGG + Intronic
930572569 2:53106013-53106035 ATTTGGGGACTGTAGTAGGCAGG - Intergenic
930873052 2:56185958-56185980 ATGTGGGGATAGGAGTGGAAAGG - Intronic
930919036 2:56728805-56728827 GTGAGGGGAGAGAAGGAGGAGGG - Intergenic
931066243 2:58590783-58590805 ATGTGGCAAGAGAATTAGGAAGG - Intergenic
932740902 2:74290400-74290422 GTGTGGGGAGAGAAGAAGGGGGG + Intronic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933783860 2:85822563-85822585 ATGTGGAGAGAGAGGGAGGAAGG - Intergenic
936371267 2:111904150-111904172 GTATGGGGGCAGGAGTAGGAGGG - Intronic
937280553 2:120714535-120714557 ATTTGGGGACAGAAGCACTATGG - Intergenic
938575205 2:132597080-132597102 AGGTGAGGACAGGAGTAGCATGG + Intronic
939167080 2:138651757-138651779 GTGTGAGGACAGAGGCAGGAAGG + Intergenic
939623246 2:144446396-144446418 ATGTGGAGAGGGAAGAAGGAGGG - Intronic
940153043 2:150624016-150624038 ATGTGGGGATTGGAGCAGGAAGG - Intergenic
941864662 2:170322264-170322286 TTGAGGGGACAGAAATAGGAAGG - Intronic
941990567 2:171552421-171552443 ATGGGGAGACAGAAGAAGGGAGG - Intronic
942268021 2:174247833-174247855 ATTTGGAGACAGAACTAGTAAGG - Intronic
942496551 2:176546247-176546269 ATGTGGGGACAGAGTTGGAAAGG - Intergenic
942641709 2:178067367-178067389 AGGTGAGGACAAAAGAAGGAAGG - Intronic
942709341 2:178815007-178815029 ATGTGGAGACAGGAGGAAGATGG + Intronic
942961039 2:181829937-181829959 CTGTTGGGAGAGAAGGAGGAGGG - Intergenic
942983174 2:182106525-182106547 ATGGGGAGCCAGAAGTGGGATGG - Intronic
942999754 2:182311511-182311533 CTGTAGGACCAGAAGTAGGAAGG - Intronic
944884514 2:204048967-204048989 TTGAGGTTACAGAAGTAGGAGGG + Intergenic
945267456 2:207904670-207904692 ATGTGAGGAAAGAAATAGCAAGG - Intronic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
947388530 2:229616555-229616577 TTCTGGGGACAGAAAGAGGAAGG - Intronic
947544275 2:231000343-231000365 CTGTGGGGACAGAAGGAGAGAGG - Intronic
948061903 2:235048251-235048273 ATGTTGGGAAGGAAGCAGGATGG + Intronic
948477141 2:238227486-238227508 AGGTGGGGACAGAGTCAGGAGGG - Intronic
1169137102 20:3203949-3203971 ATGGGGGGAAAGAGGGAGGATGG + Intronic
1169205411 20:3737341-3737363 ATGTGAGGGCAGTAGTTGGAGGG - Intronic
1170436289 20:16333087-16333109 ATGTGGGCAAAGAGGTAGGAAGG - Intronic
1172028056 20:31962895-31962917 AGGTGGGGACAGGAGCAGGCTGG - Intergenic
1172115371 20:32570507-32570529 CTGTGGGGACAGGAGGGGGAAGG - Intronic
1172206202 20:33164527-33164549 ATGTGGAGAGAGAAGAAGAAAGG - Intronic
1172263888 20:33593842-33593864 ATGTGTGGACAGAAGGGGAAAGG - Intronic
1172447299 20:34999913-34999935 AGGTGGGGACGGGAGAAGGATGG - Intronic
1173025641 20:39305251-39305273 ATGAGGTGAGAGAAGCAGGATGG + Intergenic
1173751816 20:45482348-45482370 GAGTGGGGAGAGAAGTAGAAGGG - Intergenic
1173992999 20:47317398-47317420 ATGTGGGGGCAGGAGTGGGGTGG - Intronic
1174029807 20:47613945-47613967 CTGTGAGGAGATAAGTAGGAGGG - Intronic
1174388748 20:50203910-50203932 ATGTGGGGGCAGGAGTGGGAGGG - Intergenic
1174390130 20:50213893-50213915 TGATGGGGAGAGAAGTAGGATGG + Intergenic
1174800623 20:53560423-53560445 AAGTGGGGAGAGAAGAAGGCAGG + Intergenic
1174978131 20:55358193-55358215 ATGTGGGTAATGAAGTAGGATGG - Intergenic
1175742249 20:61427891-61427913 AGGCGGGGAGAGAAGGAGGAAGG + Intronic
1176130318 20:63494044-63494066 GTCTGGGGACAGAACTGGGAGGG - Intronic
1176256956 20:64157984-64158006 AGGTGGGGACAGGAGCAGGTGGG - Intronic
1182471856 22:30553762-30553784 ATAGGGGGGCAGAAGTAGGAGGG + Intergenic
1183989900 22:41590683-41590705 ATGTGTGGACAGAAGGAATAAGG - Intergenic
1184125220 22:42481985-42482007 ATGTGAGGTCTGAAGTAGGAAGG + Intergenic
949808031 3:7976732-7976754 ATGTGGAGCCAGAAGGGGGATGG - Intergenic
950290445 3:11779830-11779852 ATTTGGGGATAGCAGGAGGATGG - Intergenic
951430560 3:22602204-22602226 ATTTGGGGCCAGAAGTGGGGTGG + Intergenic
952101756 3:30021501-30021523 ATTTGGGGAGAAGAGTAGGAGGG + Intergenic
952210108 3:31221984-31222006 ATGTGGGGTCAGGAGTGAGAAGG + Intergenic
952964027 3:38610077-38610099 AGGTGGGGACAGAATAAGGGAGG + Intronic
953007814 3:38994538-38994560 ATATGAGGGCAGAAGTAGGGAGG - Intergenic
953192650 3:40702059-40702081 GTGTGGGGACAGAAGTATATGGG - Intergenic
953516889 3:43602176-43602198 ATTTGTGGAAAGAAGGAGGAGGG - Intronic
953908428 3:46880204-46880226 ATGTGGGCACACAAGGAGGGAGG + Intronic
953919591 3:46942868-46942890 ATAGGGGGAGAGAAGTGGGAAGG + Intronic
954454896 3:50592536-50592558 ATGAGGGGACAGATGCTGGAGGG - Intergenic
954622729 3:52005189-52005211 AGGTGGGCACAGGAGTAGGCAGG - Intergenic
955035641 3:55264571-55264593 ATGAGGAGAGAGAAGAAGGAGGG + Intergenic
956976511 3:74587172-74587194 AGGTGGGGGCAGAAGGAGGCAGG + Intergenic
959094336 3:101936899-101936921 ATGCCGGAACAGAAGTAGTAAGG - Intergenic
960729491 3:120710535-120710557 ATGTGGGCACAGATGGAGAAAGG - Intronic
960882813 3:122362929-122362951 GTGTTTGGAAAGAAGTAGGAGGG - Intronic
960999784 3:123366484-123366506 ATGTGGTGACAGAAAAGGGAAGG + Intronic
961031191 3:123605358-123605380 TAGTGGGGACAGAAGTATGCGGG + Intergenic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
962522049 3:136206509-136206531 AGGAGGGGACAGAGGAAGGAGGG - Intergenic
962778498 3:138687799-138687821 ATGTTGGGGGAGATGTAGGAAGG + Intronic
962855058 3:139337582-139337604 ATTTGGGAACAGCAGGAGGAAGG + Intronic
962866511 3:139451887-139451909 ATGGTGGGACAGAAGGATGAAGG + Intergenic
963325271 3:143855616-143855638 ATGTAGGGATAGAAGCAGAAGGG + Intergenic
963525036 3:146406528-146406550 AGGTGAGGAGAGGAGTAGGAAGG + Intronic
963781655 3:149492549-149492571 GTGTGGGGACAGCCATAGGAGGG + Intronic
964065429 3:152572426-152572448 ATTTGGTGACAGAAGTGGCAAGG - Intergenic
965351482 3:167617008-167617030 ATGTGGGTACAGAAATTGGTAGG + Intronic
965581938 3:170277910-170277932 ATGGAGGAACAGACGTAGGAAGG - Intronic
965722153 3:171673844-171673866 ATGTGGGGACAGAAGTAGGATGG - Intronic
966321604 3:178707078-178707100 AAGTGGAGACAGAAGGAGAAAGG + Intronic
966835621 3:184047344-184047366 ATTTAGGGACAGAAGTGTGAGGG + Intergenic
967295699 3:187962707-187962729 ATGTGGGCACAGATGCAGGTGGG + Intergenic
969131370 4:4993346-4993368 GTGGGGGGACAGCAGCAGGAGGG - Intergenic
969368064 4:6711468-6711490 ATGTGAGGACTGCAGCAGGAAGG - Intergenic
970173767 4:13315550-13315572 CTGTGGGGAAAAAAGTAGGGTGG - Intergenic
970382037 4:15518102-15518124 ATGTGAGGACAGATTTGGGAGGG - Intronic
971240904 4:24887933-24887955 GTGTGGGGGCAGCAGTAGGTGGG - Intronic
972367168 4:38386975-38386997 ACGTGGTCCCAGAAGTAGGAAGG - Intergenic
973685199 4:53362920-53362942 ACATGGGTACAGATGTAGGAAGG + Intronic
976668386 4:87624950-87624972 ATTTATGGACAGAAATAGGAAGG - Intergenic
976671074 4:87654330-87654352 ATGAGGGGCCAGAGATAGGAGGG + Intronic
976713169 4:88094921-88094943 AATTGGGGAGAGAAGGAGGAAGG - Intronic
976960024 4:90958882-90958904 AAGTAGAGACAGAAGAAGGATGG - Intronic
977790798 4:101100210-101100232 ATGTTGGGAGAGAAGAAGGCAGG + Intronic
978939470 4:114419208-114419230 AGGTGGGGAAAAAAGTATGAGGG + Intergenic
979352060 4:119655685-119655707 ATGTGGGTCCAGCTGTAGGAAGG - Intergenic
982290275 4:153773982-153774004 ATGTGGGCAAAGAAGAAGGTAGG - Intergenic
983535843 4:168855995-168856017 AAGTGGGGAGAGAAGGAGGTGGG - Intronic
983768952 4:171523769-171523791 AACTGGAGACAGAAGTGGGAAGG + Intergenic
984040649 4:174728854-174728876 GTGTTGGGACAGAGGGAGGATGG + Intronic
984456673 4:179977739-179977761 ATGTGAGGAGAGAAGCAGGAAGG - Intergenic
984799677 4:183702680-183702702 ATGGGGGGATACAAGCAGGAAGG + Intronic
985018609 4:185663399-185663421 ATTTGGGGACATAAGTGGTATGG - Intronic
985285464 4:188332335-188332357 ATGTGGGAACACAGCTAGGAGGG + Intergenic
985853149 5:2403535-2403557 ATGTGGGGAAAGGAGAGGGAAGG - Intergenic
986025507 5:3846863-3846885 ATGTGGGGACAAGTGTAAGAGGG - Intergenic
986033890 5:3919134-3919156 ATGTGGGGACAGATTTATGTGGG - Intergenic
986418611 5:7553660-7553682 CTGAGGGGACAGAAGCAGGGAGG + Intronic
987120719 5:14764149-14764171 GAGTGGGGATATAAGTAGGAGGG - Intronic
987589477 5:19904823-19904845 TTGTGGGAACAGGAGGAGGAAGG + Intronic
989259549 5:39403797-39403819 AGGTGGGTACAAAATTAGGATGG - Intronic
989512979 5:42309881-42309903 ATGTGGGTAGAGAAGGAGAAAGG + Intergenic
990058421 5:51615684-51615706 TTGTGGGGAGAGAAGTGAGATGG + Intergenic
990061731 5:51658520-51658542 TTCTGGGGACAGAAATAGGCAGG + Intergenic
990205981 5:53430176-53430198 ATGAGGGGCCAGAGGCAGGAGGG - Intergenic
991251372 5:64565612-64565634 ATGTGGTGTGAGAAGTTGGAAGG - Intronic
992215184 5:74518712-74518734 ATTTTGGAACAGAAGTAGCATGG - Intergenic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
995342584 5:111075765-111075787 AGGTGGGTACAGAAACAGGAAGG + Intronic
995369265 5:111400570-111400592 ATGTGGGGCAAGAATTAGCATGG - Intronic
995523071 5:113029125-113029147 AAGTGGTGACAGAAAGAGGAAGG + Intronic
996339218 5:122417717-122417739 AGGTGGGGAGGGAAGGAGGAAGG - Intronic
996387512 5:122925017-122925039 ATGTGGGGAGAGAAGGAGAAGGG - Intronic
996424335 5:123296468-123296490 ATTTGGGGACAGAAGGGAGAGGG + Intergenic
997212458 5:132085493-132085515 CTGTGGGGAGAGAAGCAGGAAGG - Intergenic
997918720 5:137956385-137956407 ATATGGGGACAGCAGGAGAAGGG + Intronic
998375387 5:141687174-141687196 ATGTGAGGAGGGAAGTGGGAAGG - Intergenic
999228926 5:150050078-150050100 ATTTAAGGACAGAAGTAGGAAGG + Intronic
1000470202 5:161631079-161631101 ATGGGGGGCCAGAAGGGGGATGG + Intronic
1001170038 5:169410584-169410606 ATGTGGGGACAGAGGTATGCAGG + Intergenic
1001414482 5:171535301-171535323 CTGTGGGGGCAGGAGAAGGATGG + Intergenic
1001442617 5:171756040-171756062 CTCTGGGGACAGAAGTTCGATGG - Intergenic
1002839484 6:893749-893771 CTGTGGGGACAGAGGAAGAAAGG - Intergenic
1003434651 6:6074668-6074690 ATTTGGGGATAGAAGAATGATGG - Intergenic
1004331804 6:14728697-14728719 ATGTGGGCAGAGAAGGAGGAGGG + Intergenic
1004554193 6:16679444-16679466 AAGGGGGGACAGAAGTAGGGAGG + Intronic
1005423882 6:25680880-25680902 ATTTGGAGACAGAGGAAGGATGG + Intronic
1005867686 6:29948449-29948471 GTCTGGGGAAAGAAGCAGGATGG + Intergenic
1006479107 6:34277613-34277635 ACGTGGGGGGTGAAGTAGGAAGG - Intergenic
1007523777 6:42473259-42473281 AAGTAGGGGCAGAGGTAGGAGGG - Intergenic
1007915241 6:45555471-45555493 ATTTGGGGGCAGAAGAATGAAGG - Intronic
1007959783 6:45948275-45948297 ATCGGGGGAGAGGAGTAGGAAGG - Intronic
1008195202 6:48510305-48510327 ATGTGGGGACTGAGGCTGGAAGG - Intergenic
1008420322 6:51291701-51291723 ATGTGGAGACAGGAGGGGGATGG + Intergenic
1008620793 6:53269871-53269893 TTGTGGGCACAGAAGAAGAAAGG + Intronic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010354260 6:74911899-74911921 GTGTGGTTACAGAAGTAGAAAGG - Intergenic
1010756763 6:79674053-79674075 CTTTGGAAACAGAAGTAGGAAGG + Intronic
1011733260 6:90287964-90287986 AAGTGAGCACAGAAGGAGGATGG + Intronic
1013299882 6:108794996-108795018 CTTTGGGGACAAAAGGAGGAAGG + Intergenic
1013441456 6:110174458-110174480 ATGAGGGGACAGTAGCAGGCAGG + Intronic
1013480593 6:110549627-110549649 TGGTGGGGACACAGGTAGGAAGG + Intergenic
1015945156 6:138492212-138492234 ATGTGGGGATGGGAGCAGGAGGG + Intronic
1017048150 6:150366235-150366257 ATTTGGGGCCAGAAATAGAACGG - Intergenic
1017315028 6:153020905-153020927 GTGTGGGGACAGCAGTAAGGAGG + Intronic
1017460810 6:154647892-154647914 ATGTGGGGTCAGAGGTAGGGAGG + Intergenic
1017792436 6:157813245-157813267 ATGTCGTGACAGAAACAGGACGG - Intronic
1019102376 6:169641587-169641609 GTGTGGGGACATAAGCAGCATGG + Intronic
1019351057 7:554130-554152 ATGTGGGGGCAGATGGCGGAGGG + Intronic
1020480540 7:8654820-8654842 AGGTGGGCACAGAAGAAAGAAGG + Intronic
1022521328 7:31009035-31009057 ATGGGGGGAGAGAAGCAGGAGGG - Intergenic
1023003896 7:35841659-35841681 ATGTTGGGACAGAAATATGAAGG + Intronic
1023181049 7:37484224-37484246 ATGTGGTGACAGCTGGAGGAAGG + Intergenic
1023454934 7:40328457-40328479 GTGTGGGGACAGAGCTGGGATGG + Intronic
1023491014 7:40741959-40741981 ATTTGGGGATAGAAGAGGGAGGG + Intronic
1023777085 7:43618040-43618062 ATGAGAGGACAGAAGTCAGATGG + Intronic
1025219898 7:57098367-57098389 ATGTTGGGACAGAAATGTGAAGG - Intergenic
1025630680 7:63269915-63269937 ATGTTGGGACAGAAATGTGAAGG - Intergenic
1025651792 7:63476693-63476715 ATGTTGGGACAGAAATGTGAAGG + Intergenic
1026823798 7:73568479-73568501 AGGTGGGGACAGAAGTGAGCTGG - Intergenic
1026956575 7:74380060-74380082 ATGTATGAACAGAAGTATGAGGG + Intronic
1027965611 7:85002140-85002162 CTGTGGGGACAGAACTAGAGGGG - Intronic
1029305823 7:99619505-99619527 ATGTAGAGACAGAACTGGGATGG + Intronic
1030415886 7:109241780-109241802 ATAGGGGCACAGAAGTAGGCTGG - Intergenic
1030524309 7:110635199-110635221 CTGTGGGCACATAGGTAGGATGG - Intergenic
1031020287 7:116620451-116620473 AAGTGGAGACTGAAGAAGGAAGG + Intergenic
1031224063 7:119011951-119011973 ATGTGGGTACATATGTACGATGG + Intergenic
1031237271 7:119192119-119192141 ATGTGAGGACAGAATTCAGAAGG - Intergenic
1031929876 7:127674149-127674171 AAGTGGGGACGGAAGGAGGGAGG - Intronic
1032066964 7:128779010-128779032 GTGTGAGGACAGTATTAGGAGGG + Intergenic
1032378428 7:131448873-131448895 AAGTGGGGAGGGAAGGAGGAAGG - Intronic
1032487703 7:132300569-132300591 GGGTGGGCACAGAAGAAGGAAGG - Intronic
1032793824 7:135261701-135261723 CTGTGGGCACAGAAGCAGTAGGG + Intergenic
1033307967 7:140238884-140238906 CTCTGGGGACAGAACAAGGACGG - Intergenic
1033516580 7:142112554-142112576 AGGTAGAGAAAGAAGTAGGAAGG - Intronic
1035520376 8:271340-271362 ATGTGGGGACAGAGGTGGGCGGG - Intergenic
1035578703 8:725843-725865 AGGAGGGGAGAGAAGAAGGAAGG - Intronic
1035636973 8:1155007-1155029 GAGTGGGAACAGAAGCAGGATGG - Intergenic
1035705827 8:1673857-1673879 ATTTGGAGACAGAGGAAGGAAGG + Intronic
1035822202 8:2605552-2605574 ATGTGGGGTCAGCAGTGGGAGGG - Intergenic
1035939306 8:3878106-3878128 ATGTGGGCAGGGAAGGAGGAAGG - Intronic
1036469319 8:9037294-9037316 TCCTGGGGACAGAAGTAGGATGG - Intronic
1037974588 8:23200441-23200463 CTGTGGGAACAGAAGAAGGCAGG + Intronic
1038031096 8:23641182-23641204 GTGTGGGGACAGGGGTAGAAAGG - Intergenic
1038322798 8:26543989-26544011 TTGGGTTGACAGAAGTAGGAAGG - Intronic
1038705557 8:29890297-29890319 ATGTGGGGAGATCATTAGGAAGG - Intergenic
1039611872 8:38926015-38926037 CTGAGAGGACAGAAGTGGGAGGG - Intronic
1042466722 8:69136482-69136504 ATGTGGGGACAGGGTTAGGTGGG + Intergenic
1043572675 8:81622756-81622778 AACTGGGGACAGAAGTGGCAAGG + Intergenic
1043573625 8:81631863-81631885 ATGTGGGGCCAGAGACAGGAAGG - Intergenic
1043950242 8:86300785-86300807 ATATAGGGACAGAAGAATGAAGG + Intronic
1044994765 8:97828787-97828809 ATGTGGTGATAGAAGTTGCAAGG + Intronic
1045149770 8:99391392-99391414 CTGTGGGGACAGATGAGGGAGGG + Intronic
1046030494 8:108777435-108777457 ATTAGGGGTAAGAAGTAGGATGG + Intronic
1047184094 8:122616444-122616466 ATGTGGTGACAGAAGGAGGCAGG - Intergenic
1047526406 8:125638055-125638077 ATGAGGGGGCAGAAGAAGAAAGG + Intergenic
1048144722 8:131830114-131830136 AAGGGGGGAGAGAAGTAGGAAGG + Intergenic
1048571256 8:135658950-135658972 AGGTGGGTGCAGAAGCAGGAAGG + Intergenic
1051125820 9:13804632-13804654 ATGTGGAGAGACAAGAAGGAAGG - Intergenic
1052364806 9:27600204-27600226 AAGTGGTGACAGAATTAGAAGGG - Intergenic
1055189658 9:73502348-73502370 AAGTGGGGAGAGAAAGAGGAAGG - Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1058784566 9:108374555-108374577 AGGTGGGGGCAGAATTAGGTGGG + Intergenic
1059509164 9:114827970-114827992 AAGTGGGGAAGGAAGGAGGAAGG - Intergenic
1060389527 9:123267363-123267385 AGGTGGGGACAGTAGGAGAAGGG - Intronic
1060493243 9:124100209-124100231 ATGTCGGGGCAGAAGCAGAAGGG - Intergenic
1060827031 9:126693423-126693445 ATGTGCGGAGAGATGGAGGATGG - Intronic
1061377251 9:130233911-130233933 ATGCGGGGACAGAGGCAGCAGGG - Exonic
1061529328 9:131197883-131197905 ATGTGGGGAATGATGTTGGAAGG - Exonic
1061634868 9:131901110-131901132 AGGAGGGGAGAGAAGAAGGAAGG + Intronic
1061853407 9:133428994-133429016 AGGTGGGGACGGACGTAGGGAGG - Intronic
1062701203 9:137904676-137904698 TTGAGGGGACAGCAGGAGGAGGG - Intronic
1062722286 9:138050734-138050756 AAGAGGGGACAGGAGCAGGAGGG - Intronic
1186115178 X:6297800-6297822 ATGTGGAAACAGAACGAGGAAGG + Intergenic
1186883037 X:13885556-13885578 AGGAGGGGCCAGAAGTAGCAGGG - Intronic
1187808069 X:23143109-23143131 TTGTTGGGATAGATGTAGGAGGG - Intergenic
1188618302 X:32187313-32187335 ATGAAGGGACAAGAGTAGGAAGG + Intronic
1189318770 X:40074576-40074598 ATGTGGGGACCGACGTAGTGAGG + Exonic
1190727458 X:53198931-53198953 AAGTGGGGCAAGAAGGAGGATGG - Intronic
1190789102 X:53683252-53683274 ATGGGACGACAGAATTAGGAGGG + Intronic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1193454001 X:81706987-81707009 TTGTGGGGAATGAAGAAGGAAGG - Intergenic
1194304476 X:92226086-92226108 ATGTAGGGACAGAAAGGGGAGGG + Intronic
1194631286 X:96288204-96288226 AAGTGGTGACTGAAGTAGAATGG - Intergenic
1195870566 X:109481029-109481051 ATGAAGGGAGAGAAGAAGGAAGG + Intronic
1196664511 X:118302715-118302737 ATCTGGGGAAAGAAGTAGTATGG - Intergenic
1197027585 X:121773507-121773529 AAGTGGGGAGAGAGGGAGGATGG - Intergenic
1197871878 X:131068930-131068952 ATGTGGTGACATAAGCGGGAGGG - Intronic
1200366097 X:155666212-155666234 ATTAGGGCACAGAAGTAGCAGGG + Intronic
1200559074 Y:4677376-4677398 ATATAGAGACAGAAGAAGGAGGG + Intergenic
1200850079 Y:7874201-7874223 ATGTGGGGAAAAAACTAGGCAGG + Intergenic
1201943502 Y:19484291-19484313 ATGTGGGGACTGAAATAGCAAGG + Intergenic