ID: 965722584

View in Genome Browser
Species Human (GRCh38)
Location 3:171678003-171678025
Sequence CTGTGAATAAAGAACTCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 221}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965722582_965722584 13 Left 965722582 3:171677967-171677989 CCTACCAGATCACTGGAAGAACT 0: 1
1: 0
2: 0
3: 9
4: 106
Right 965722584 3:171678003-171678025 CTGTGAATAAAGAACTCACAAGG 0: 1
1: 0
2: 1
3: 13
4: 221
965722580_965722584 19 Left 965722580 3:171677961-171677983 CCACCACCTACCAGATCACTGGA 0: 1
1: 0
2: 1
3: 23
4: 322
Right 965722584 3:171678003-171678025 CTGTGAATAAAGAACTCACAAGG 0: 1
1: 0
2: 1
3: 13
4: 221
965722583_965722584 9 Left 965722583 3:171677971-171677993 CCAGATCACTGGAAGAACTATCA 0: 1
1: 0
2: 0
3: 8
4: 94
Right 965722584 3:171678003-171678025 CTGTGAATAAAGAACTCACAAGG 0: 1
1: 0
2: 1
3: 13
4: 221
965722581_965722584 16 Left 965722581 3:171677964-171677986 CCACCTACCAGATCACTGGAAGA 0: 1
1: 0
2: 0
3: 11
4: 160
Right 965722584 3:171678003-171678025 CTGTGAATAAAGAACTCACAAGG 0: 1
1: 0
2: 1
3: 13
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965722584 Original CRISPR CTGTGAATAAAGAACTCACA AGG Intronic
904880658 1:33694346-33694368 CTGTGAGTATACTACTCACATGG + Intronic
910349590 1:86280565-86280587 CTGATCATAGAGAACTCACAAGG - Intergenic
912252928 1:108029919-108029941 TTGTGAAGAATGAACTCAAATGG + Intergenic
912574026 1:110648105-110648127 CTGTGAATACAGAGATTACAAGG + Intergenic
916504240 1:165413577-165413599 CTATTAATAAAGACCACACAGGG + Intronic
917884650 1:179371561-179371583 CTGTGAATACATACCTCACCTGG + Intronic
918663752 1:187121723-187121745 CTGTGAAAAAACATTTCACAGGG + Intergenic
923819047 1:237415276-237415298 CGCTGCATAAAGTACTCACATGG - Intronic
1063019827 10:2116732-2116754 CTCTGTGTGAAGAACTCACAGGG - Intergenic
1063609405 10:7550328-7550350 CAGAGAGTAAAGAACTCAGAAGG + Intergenic
1063658452 10:8014856-8014878 CTGTGGATAAAGAACCCAGGAGG + Exonic
1065785901 10:29214536-29214558 CTGGGCAATAAGAACTCACAGGG + Intergenic
1067989160 10:51190478-51190500 ATGTGAATAAACAACTCATAGGG + Intronic
1068909711 10:62366368-62366390 CTGTATATAAAGAAAACACATGG - Intergenic
1069059502 10:63880453-63880475 GTGTCAATAAAGAAATCAAAAGG - Intergenic
1070323830 10:75374656-75374678 CAGTGAATAAAGAAACCACACGG - Intergenic
1072078630 10:92005013-92005035 CTTTGACAAAAGAACACACAAGG - Intronic
1072510942 10:96124306-96124328 CTTTCAACAAAGAAATCACAAGG - Intergenic
1072557681 10:96535324-96535346 CTGTTAAAAAAAAATTCACATGG + Intronic
1073639356 10:105234908-105234930 CTGTGAAGAAAAAAATTACAAGG - Intronic
1073853969 10:107654192-107654214 CTGTGTGTAAAGAGATCACATGG + Intergenic
1074536509 10:114331985-114332007 CTGCTCAAAAAGAACTCACAGGG - Intronic
1079492802 11:21008582-21008604 ATGTGTATAAAGAACTAATAAGG + Intronic
1080045460 11:27803190-27803212 GTGTTAATAAGTAACTCACAGGG - Intergenic
1080310823 11:30889779-30889801 CTGTAAATAAAGAAATGGCATGG - Intronic
1085372455 11:76021724-76021746 TGGTCAATAAAGAAATCACAGGG - Intronic
1087120208 11:94566464-94566486 CTGTGAATAAATAAATCAGTTGG + Intronic
1087159573 11:94935677-94935699 CTGTGAGTGCAGAAATCACATGG - Intergenic
1087658464 11:100955971-100955993 CTGTGGATGAAGTAGTCACAAGG - Intronic
1088071177 11:105787171-105787193 CTGTGTATAAAGAAGTCTAAAGG + Intronic
1088725046 11:112627126-112627148 CTTTTAGTATAGAACTCACAGGG - Intergenic
1089950544 11:122521499-122521521 CTTTGAATAAAGGACTTTCATGG + Intergenic
1090388353 11:126369835-126369857 ATGTGAATAGAGTACTCAGAAGG - Intronic
1091726154 12:2848144-2848166 CTGGGAATCAAGACATCACAGGG - Intronic
1092604351 12:10102229-10102251 GTGTGAATAAAGAATCCAGATGG + Intronic
1092842959 12:12561508-12561530 GTGTAAATAAAGAAGTCACTAGG + Intronic
1093247756 12:16761364-16761386 CTGTGAATTAAGGGCACACAGGG - Intergenic
1093540025 12:20271200-20271222 CTGTAAATAAAGAAATAAAAAGG - Intergenic
1094063408 12:26339325-26339347 CACTGAATAAAGAACTGAGATGG - Exonic
1094121160 12:26975839-26975861 CTGTGTTTTAAGAACTCATATGG - Intronic
1094363919 12:29660249-29660271 CTCTGGAAAAAGAACTAACAGGG + Intronic
1096335534 12:50752586-50752608 CTATAAATAAATAACTCCCATGG + Intergenic
1096754759 12:53789976-53789998 TTGTTAATAAAGAACTCAGTGGG + Intergenic
1098043448 12:66376484-66376506 CTTTGATTAAAGAACTCACCAGG + Intronic
1101421777 12:104556629-104556651 GTGTGAAGACAGAACACACAGGG - Intronic
1101458655 12:104865086-104865108 CTTTCATTAAAGGACTCACAAGG + Intronic
1106850950 13:33790837-33790859 TTTTTAATAAAGAACTTACATGG - Intergenic
1107050106 13:36037898-36037920 CTGTAAAAAAAGAACTTCCAAGG + Intronic
1107722617 13:43264769-43264791 CTGAGACTAAAGAACTTTCAAGG + Intronic
1108232681 13:48365871-48365893 GTGTGAAAAAAGTATTCACAGGG + Intronic
1109548060 13:63855024-63855046 ATATAAATCAAGAACTCACAAGG - Intergenic
1110124095 13:71920432-71920454 CTGTGAATAAAGGAGCTACATGG - Intergenic
1110216243 13:73027804-73027826 CTGTGACTAAAGACCCCACATGG - Intergenic
1113310117 13:109123070-109123092 CTGTAAATTAAGACCTTACATGG + Intronic
1113883939 13:113647505-113647527 CTGTGTATTAAGAACACTCAGGG - Intergenic
1114781101 14:25539042-25539064 CTGTGATTAAGGACCCCACATGG - Intergenic
1115999378 14:39226617-39226639 ATGTCTATAAAGAACTCAGATGG - Intergenic
1117403575 14:55379916-55379938 TTTTTAATAAAAAACTCACATGG - Intronic
1118635917 14:67748568-67748590 CTGTGAAGCAAGAACACTCACGG - Exonic
1119812176 14:77531387-77531409 CTGTGAAGAAATAACTTTCAGGG - Intronic
1120250402 14:82056320-82056342 CTGTCAATGAACAAATCACATGG + Intergenic
1123221675 14:106863293-106863315 CTGTGAGTAAAGAGCTCGCTTGG - Intergenic
1123457348 15:20438138-20438160 CTGTGAATCAAGGATGCACAGGG - Intergenic
1123660710 15:22562221-22562243 CTGTGAATCAAGGATGCACAGGG + Intergenic
1124263498 15:28213288-28213310 CTGTGAATCAAGGATGCACAGGG - Intronic
1124314510 15:28656458-28656480 CTGTGAATCAAGGATGCACAGGG + Intergenic
1124390273 15:29249343-29249365 CAGTTAAAAAAGAAATCACAAGG + Intronic
1125028957 15:35057341-35057363 CTGCCAATGAAGAAATCACAAGG + Intergenic
1127478258 15:59354910-59354932 CTGTGAAAAGAAAACTCAAAAGG + Intronic
1127564616 15:60174977-60174999 CTATGAATAAAGAAATTAGATGG - Intergenic
1130653197 15:85773864-85773886 CTGTCACTTAAGGACTCACAGGG + Intronic
1131726100 15:95226894-95226916 GTGTGAATAATGAACACACCTGG + Intergenic
1131930046 15:97431768-97431790 CTGTGAAAGAAGAAATCATAAGG - Intergenic
1133837313 16:9378517-9378539 CTGTGGATAAAGAGTTAACAAGG + Intergenic
1136015258 16:27394665-27394687 ATGTCAATGAAGAAATCACAAGG + Intergenic
1143253748 17:5540871-5540893 GTGTGAACAAAGATCTCGCAAGG + Intronic
1143549558 17:7621700-7621722 CTGTGAAAAAAAAAATCCCATGG + Intronic
1144111542 17:12039692-12039714 CTGTAAATAAAGCATTTACAAGG - Intronic
1144789599 17:17850046-17850068 CTGTGGTTAAAGAACTCAACAGG + Intronic
1148463799 17:47852414-47852436 CTGTGAAAAAAGGGGTCACATGG - Intronic
1148816832 17:50334087-50334109 CTGTAAAGAAAGAACTCAACTGG + Intergenic
1150259293 17:63774898-63774920 ATGTGAATAAATAATTTACATGG + Intronic
1151350169 17:73527171-73527193 CCGTGAACAAATGACTCACAGGG - Intronic
1153068927 18:1082271-1082293 CTGAGACTAAAGAAGTCAGAGGG - Intergenic
1154088358 18:11329759-11329781 CTGTAATTAAAGATCTCTCAAGG - Intergenic
1155531012 18:26766473-26766495 GTGTGAAAAGAGGACTCACAGGG - Intergenic
1155649753 18:28127100-28127122 CTGTGTATAAAGAAACCAAATGG + Intronic
1156302991 18:35851728-35851750 CTGTGAATAAAAAATTCAAGAGG - Intergenic
1156461889 18:37325915-37325937 CTGAGAATTAAGAAAGCACAGGG - Intronic
1156680587 18:39583958-39583980 CTGTGAATAAAGCACTCCATTGG - Intergenic
1156867073 18:41900724-41900746 CTGTGAATAAAAATCTCAGGCGG - Intergenic
1157109072 18:44802622-44802644 GTGTGCATAAAGCAATCACATGG - Intronic
1157477525 18:48032981-48033003 CTCTGAATAATGAATTCCCAGGG - Intronic
1158022108 18:52855353-52855375 CTGTGAATATAGAAAATACAGGG - Intronic
1158214642 18:55087184-55087206 CTGTGAACAGAGAGCTCACTTGG - Intergenic
1158540673 18:58350996-58351018 CTGGGAAGAAAGAATTCACTTGG + Exonic
1162419907 19:10560202-10560224 CTGTGAAAAAAATACACACATGG + Intronic
1163219482 19:15904877-15904899 CTGAGAAAAAAGAACTTAGATGG - Intergenic
1163875434 19:19863916-19863938 CTCTGAATGAACAACTCAGAAGG + Intergenic
1167508085 19:49881685-49881707 CAGAGAATAACGAACTCAGAGGG - Intronic
1168386849 19:55970766-55970788 CTGTGAGAAAAGAAGTCATAGGG + Intronic
925283227 2:2699310-2699332 CTGGGAACAAATAACTCCCAGGG + Intergenic
929336622 2:40755565-40755587 CTGTGAATAAGAAACTACCAAGG - Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
931113380 2:59137741-59137763 TTGTTAATAAAAGACTCACAGGG + Intergenic
931613805 2:64133804-64133826 CTGGGAATAAACACCTCAGATGG + Intronic
931980333 2:67687494-67687516 CTATGAATAAAGAAGTCATTTGG + Intergenic
938593592 2:132764158-132764180 GTGAGAAGAAAGCACTCACAAGG + Intronic
938779659 2:134573898-134573920 CAGGGAGTAAAGAACTCTCAGGG + Intronic
938985285 2:136569518-136569540 CTGAGTAAAAAGAACTCCCAGGG - Intergenic
940170195 2:150820960-150820982 CTGTGGTTTAAGAACTTACATGG + Intergenic
940203250 2:151174667-151174689 CTCTGTATAAAGAAACCACAAGG + Intergenic
940801119 2:158133959-158133981 CTGACAATAAAGAATTCATATGG + Intronic
941719530 2:168798712-168798734 CTGAGAACAGAGAACTCAAAAGG + Intronic
943015429 2:182504300-182504322 CTGGGAAACAAGAAATCACATGG - Intronic
943545024 2:189265459-189265481 ATTTGAATACAGAACACACATGG - Intergenic
945136373 2:206632501-206632523 CTGAGAATAAAGAAGTTCCATGG + Intergenic
946460797 2:219866699-219866721 CAGAGAATAAAGAAATCAAAAGG - Intergenic
947414665 2:229882118-229882140 ATGAGGATAAAGAACTCACATGG + Intronic
947755679 2:232562710-232562732 TTGTGAATAAGGAACTGAAAGGG - Intronic
1168903285 20:1384134-1384156 TTGTGAACACAGAACTCATATGG - Intronic
1171042313 20:21776799-21776821 ATGTGAAGAAGGAACCCACAGGG - Intergenic
1172162403 20:32877843-32877865 GAGTGAATAAAGAGCTCCCAGGG + Intronic
1172309737 20:33908371-33908393 CTCTGAAGAAAAATCTCACATGG - Intergenic
1174752255 20:53123200-53123222 CTGTCAATAGATAACTGACACGG - Intronic
950697108 3:14710581-14710603 AGGTGGATAAAGAAATCACAAGG - Intronic
952275690 3:31873689-31873711 CTGAGAATAAAGAAGAAACACGG + Intronic
952286355 3:31973176-31973198 CTGGGAAGAAAGAAGCCACATGG - Intronic
952326176 3:32322536-32322558 CTGTGAACAAATAACTCAACAGG - Intronic
953660794 3:44890244-44890266 CTGTGGATAAAGTACGCATAAGG - Intronic
956150416 3:66236245-66236267 TTGTTAATATAGTACTCACATGG - Intronic
956205091 3:66747344-66747366 CTTTGAAAAAAGAAATCTCAGGG + Intergenic
959223418 3:103551264-103551286 CTGTCAAAAAAAAAGTCACATGG + Intergenic
959232926 3:103680208-103680230 CAGTGAATAAAGAAGTCATCTGG - Intergenic
960041967 3:113159177-113159199 CTGTGTATAAGGAATTGACAAGG - Intergenic
960211571 3:114973806-114973828 TTGTGTATAAAGAGCTCACAGGG - Intronic
961146162 3:124595181-124595203 CTGAGAAAAAAAAACACACATGG - Intronic
963444362 3:145384562-145384584 TTATGCATAAAGAAATCACACGG + Intergenic
963877755 3:150495638-150495660 TTGTGAATAAGCCACTCACAGGG - Intergenic
963969330 3:151412313-151412335 CAGTGAATAACGAAAACACAAGG - Intronic
965722584 3:171678003-171678025 CTGTGAATAAAGAACTCACAAGG + Intronic
967775415 3:193381331-193381353 CTGTGAAGAAAGTAATCACATGG + Intergenic
968875655 4:3266391-3266413 CTTTGAATAAAGAGCCCATATGG - Intronic
969197604 4:5575638-5575660 CTGTGAATAAAAAATGGACATGG - Intronic
971470830 4:27024767-27024789 TTGTGCATAAAGAACTGAAAAGG + Intronic
972140179 4:35949404-35949426 CTGTTCACAAAGAACTCCCATGG - Intronic
974529420 4:63088761-63088783 CTGGGTAAAAAGACCTCACAGGG - Intergenic
975713397 4:77182627-77182649 CTGTGAATATTGATTTCACAAGG - Intronic
977420409 4:96792478-96792500 CTGTGAGCTAAGGACTCACATGG - Intergenic
977835879 4:101646029-101646051 CTGAGAATAAAGAAGTAAAAAGG + Intronic
979723701 4:123934548-123934570 CTTTGAATAAAGAAGTGACATGG - Intergenic
980124248 4:128758421-128758443 CTTTGAAAAAAGAAATCAAAGGG - Intergenic
984034010 4:174643538-174643560 CTGTGAAAAAACAAATCACCTGG + Exonic
985355882 4:189117970-189117992 CTGTAAATGAAGAACACACTTGG + Intergenic
986783454 5:11088242-11088264 CTGTTACTAAGGAACACACAGGG - Intronic
988863777 5:35312556-35312578 TTGTGAGTAAAGAACTCTTATGG + Intergenic
989438488 5:41442218-41442240 CAATGAATAAACAACTCAGAAGG + Intronic
989686483 5:44094081-44094103 TTGTGAACAAAGAACTCAATTGG - Intergenic
989712131 5:44411774-44411796 TTCTGAAGAAAGAACTCCCAGGG - Intergenic
990539877 5:56761493-56761515 ATGTGAATATAGAACACACAAGG - Intergenic
992955764 5:81906605-81906627 CTGTGCATGAAGAAATCACGTGG + Intergenic
994753603 5:103768040-103768062 GTGATAATAAAGAAGTCACACGG - Intergenic
995295574 5:110517138-110517160 CTATGAATAAAGACCTTTCAGGG + Intronic
995814539 5:116152343-116152365 CTGTGAAAAAAAATCCCACAGGG - Intronic
998456490 5:142277857-142277879 CTGTGAATGAAGAACAAAGAGGG - Intergenic
999949434 5:156633052-156633074 CAGAGAAAAAAGAAGTCACATGG - Intronic
1001693156 5:173647629-173647651 CAATGAGTAAAGAACTCACGAGG - Intergenic
1004830374 6:19471158-19471180 CTATGAAAAAATAACTCCCATGG + Intergenic
1006046510 6:31303480-31303502 CTCAGAAGAAAGAACACACAGGG + Intronic
1008116050 6:47551673-47551695 CTGTGAGTCAAGAATTCAGATGG + Intronic
1008868901 6:56248147-56248169 CTGTGAAGAATGCACTCAAAGGG - Intronic
1010487319 6:76431022-76431044 CTCTGAAGAAAGGACACACAAGG + Intergenic
1011695671 6:89910519-89910541 CTGTAAAGAAAGAACTCAGCTGG - Intergenic
1011949176 6:92942845-92942867 CTATGTATAAAGAAACCACAAGG - Intergenic
1012291414 6:97459974-97459996 CTGGGAGTAGAGATCTCACAGGG + Intergenic
1013782079 6:113739796-113739818 CTTTTAATAAAGTACTCACATGG - Intergenic
1015519638 6:134117523-134117545 CTGTGAATAAACAAGACTCACGG + Intergenic
1015547210 6:134373711-134373733 GTGTGTATAAAAAACTCACATGG - Intergenic
1019384861 7:748927-748949 CTATCAATAAGGAATTCACATGG + Intronic
1021615814 7:22501423-22501445 CTGTGAATAAAAAACAATCATGG - Intronic
1022371652 7:29777182-29777204 TTGTGAAGACAGAACTAACAGGG + Intergenic
1023220196 7:37914354-37914376 CCATGAAGAAAGAACTCACCGGG + Exonic
1024549890 7:50553885-50553907 CTGTGATTAAAAAGCTCTCATGG - Intronic
1026464255 7:70640397-70640419 CTCTGAAAAATAAACTCACAGGG + Intronic
1027676291 7:81162577-81162599 TTGTAAATACAGAACTCAAAAGG - Intergenic
1028585045 7:92444410-92444432 GTGTGAATTAAGTACTCAAAAGG + Intergenic
1028601722 7:92608270-92608292 GTGTGACCAAACAACTCACACGG + Exonic
1029369027 7:100135942-100135964 CTTTTCATAAAAAACTCACAGGG + Intergenic
1031316052 7:120258672-120258694 TTATGAATAAAGAAATCACGAGG - Intergenic
1031817791 7:126460656-126460678 CTCTGAATAAAGCACCTACAGGG + Intronic
1032607828 7:133376521-133376543 CTGAGAAAAAAGAACACACTAGG + Intronic
1033756602 7:144401870-144401892 CTGGGAAAAGGGAACTCACAAGG - Exonic
1034859305 7:154582317-154582339 CTGTGAACAAAGAACATATAGGG + Intronic
1034995244 7:155572770-155572792 CTGTCCATAAAGATCTCACAAGG - Intergenic
1035052650 7:156010090-156010112 GTGTAAATAAAGAAATCCCAAGG - Intergenic
1035585566 8:770355-770377 CTGTGATTAAATAACCCAGAAGG - Intergenic
1040043041 8:42936110-42936132 CTAGGAATACACAACTCACAAGG - Intronic
1041677474 8:60549956-60549978 CTGTGATTAAATAACAAACATGG + Intronic
1042234314 8:66593567-66593589 ATATGAATGAAGCACTCACAAGG + Intronic
1044769919 8:95620469-95620491 CTGTGAAGGAAGGATTCACAGGG + Intergenic
1045700427 8:104860528-104860550 TTGTGAAAAAATATCTCACATGG - Intronic
1045935503 8:107674225-107674247 TTGTGAACCAAGAACTCACATGG + Intergenic
1046767981 8:118090845-118090867 CTGTGTATACAGGATTCACAAGG - Intronic
1046895747 8:119470525-119470547 CTGTGAATAAGGAATTTAGAAGG - Intergenic
1050795914 9:9541360-9541382 ATGTGAATATAGCAGTCACATGG + Intronic
1050834451 9:10058213-10058235 ATGTGAATACATAACTCAAAAGG - Intronic
1050889330 9:10804064-10804086 CTGTAAATAAAGGAATCAAATGG - Intergenic
1052531733 9:29693575-29693597 TTGTGAATGAAGAAATCAAAAGG + Intergenic
1053957001 9:43488895-43488917 CTGTTAATTGAGAACACACATGG - Intergenic
1054031575 9:44780366-44780388 CTGTTAATTGAGAACACACATGG - Intergenic
1054073335 9:45493584-45493606 CTGTTAGTTAAGAACACACATGG - Intergenic
1054827815 9:69590538-69590560 CTGAGAATAATGCATTCACATGG + Intronic
1055320826 9:75081855-75081877 CTATGAAGAAACAAGTCACAGGG + Intronic
1059298488 9:113294115-113294137 CTGTGAAGAAATAGCCCACAAGG - Intergenic
1059913362 9:119071369-119071391 CGCTGAATAAAGAAATCAAAGGG + Intergenic
1060374020 9:123102544-123102566 CTGTGATCAAAGAATGCACAGGG + Intronic
1060395812 9:123315615-123315637 CTTTAAAAAAAGAAATCACAGGG - Intergenic
1188467769 X:30501604-30501626 GTGTGAATGAGAAACTCACATGG + Intergenic
1188582650 X:31733999-31734021 CAGTGAATAAAGAACAAAAAAGG - Intronic
1188658363 X:32728375-32728397 ATTTGAATATAGACCTCACATGG - Intronic
1191146842 X:57175662-57175684 TTGTAAATATAAAACTCACAGGG - Intergenic
1193083631 X:77428778-77428800 CTGAGAATAAAGAAGTAAGAAGG + Intergenic
1194192353 X:90853335-90853357 CTGAGAATAAAGAACAAAAACGG - Intergenic
1196018348 X:110963327-110963349 CTGAGAACAAAGAGCTCACTGGG - Intronic
1196485415 X:116201626-116201648 CTGAGAGTACAAAACTCACAGGG - Intergenic
1196532687 X:116807354-116807376 ATATGATTAGAGAACTCACATGG + Intergenic
1197402110 X:126005516-126005538 CTCTGAAAAAAAAACTCTCAGGG + Intergenic
1197597702 X:128486453-128486475 CTCTGAATAAAGAACTGACATGG + Intergenic
1198025652 X:132703968-132703990 CTGTGAATATAGAACATATAGGG - Intronic
1198534416 X:137573244-137573266 CTTTGAACAAAGATCTTACAAGG - Intronic
1199113944 X:143967890-143967912 CTAGGAATAAAGAAATCTCAAGG - Intergenic
1200845169 Y:7824936-7824958 ATGTAAATAAAGAACACAGATGG - Intergenic
1202174055 Y:22081250-22081272 CGGTGAATGAAATACTCACATGG + Intronic
1202217305 Y:22505132-22505154 CGGTGAATGAAATACTCACATGG - Intronic
1202325881 Y:23690927-23690949 CGGTGAATGAAATACTCACATGG + Intergenic
1202544890 Y:25979127-25979149 CGGTGAATGAAATACTCACATGG - Intergenic