ID: 965722603

View in Genome Browser
Species Human (GRCh38)
Location 3:171678069-171678091
Sequence CAGAGTGGGAAGGGCGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1194
Summary {0: 1, 1: 1, 2: 8, 3: 108, 4: 1076}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965722603 Original CRISPR CAGAGTGGGAAGGGCGGGGA GGG Intronic
900482336 1:2905315-2905337 CTGAGTGGGTAGGGAGGTGAGGG - Intergenic
900656238 1:3759391-3759413 CAGCTTGGGCAGGGTGGGGACGG + Intronic
900713959 1:4132420-4132442 AAGAGAGGAGAGGGCGGGGAGGG - Intergenic
900906397 1:5562678-5562700 CAGAGGGGGAAGTGTGGGGTTGG - Intergenic
901266203 1:7912792-7912814 CAGAGTGAGAAGTCCTGGGATGG - Intergenic
901377367 1:8848974-8848996 GAGAGAAGGAAGGGCTGGGATGG + Intergenic
901402705 1:9025529-9025551 TAGGGTGGGCAGGGCAGGGAAGG + Intronic
901643782 1:10706046-10706068 CAGAGGGGCAAGGGCGGGCCAGG + Intronic
901653834 1:10757938-10757960 CAGAGTGGCCAGGACGTGGATGG - Intronic
901738539 1:11327576-11327598 CTGAGTGGGAAGAGCTGGGCTGG + Intergenic
902342923 1:15796111-15796133 CTGAATGGGAAGGGAGGGGAGGG + Intergenic
902387399 1:16083644-16083666 CGGAGTGGGAAGGGCAGGAGTGG - Intergenic
902435399 1:16395321-16395343 CACAGTGGGAAGGGGGAGAAGGG - Exonic
902478909 1:16701588-16701610 CAGAGGGGGCCGGGCGGGTAGGG - Intergenic
902686207 1:18079301-18079323 GAGAGGGGGAAGGAAGGGGAGGG + Intergenic
902690160 1:18106048-18106070 CAGAGTGGGGAGGGAGGGCCAGG + Intergenic
902955935 1:19924076-19924098 CAGAGCAGGAGGGTCGGGGAGGG - Intergenic
903369368 1:22825408-22825430 AAGAGTGGAGAGGGCTGGGAAGG + Intronic
903378915 1:22883664-22883686 CAGAGTGGGAAGGCCGGGCTGGG - Intronic
903407079 1:23106817-23106839 CAGACTGTGGAGGGTGGGGAAGG - Intronic
903480929 1:23652728-23652750 CAGGGTGGGAAGGGTGGAGAGGG - Intergenic
903657365 1:24957529-24957551 GAGAAAGGGAAGGGCTGGGAAGG + Intronic
903852328 1:26315591-26315613 TGGAGAGGGAGGGGCGGGGAGGG - Intronic
904005316 1:27360484-27360506 CAGGGTAGTAAGGGTGGGGAAGG - Intronic
904131768 1:28280883-28280905 CAGCGTGGGGAGGGTGGGCATGG - Exonic
904604333 1:31690636-31690658 CAGAGGGGCACGGGTGGGGAAGG - Intronic
904612964 1:31735354-31735376 CCGAGTGGGGTGGGAGGGGAGGG + Intronic
904615691 1:31748359-31748381 CTGAGTGGGATGGGTGGGAATGG - Intronic
904810421 1:33160033-33160055 CAGAGAGGAAAGGGTGGGAAAGG + Intronic
904834001 1:33323355-33323377 CCAAGTGGGAATGGCGGGTAGGG + Intergenic
904880110 1:33690066-33690088 CGGAGTGGGACGGGCTGGGCCGG - Intronic
905034023 1:34905332-34905354 CAAAGCGGGCTGGGCGGGGATGG + Exonic
905273032 1:36799451-36799473 CACAGTGGGGAGCGGGGGGAAGG - Exonic
905580535 1:39080859-39080881 AAGAGCGCCAAGGGCGGGGACGG + Intergenic
905796368 1:40818733-40818755 CAGAGCGGGCAGGGCGGAGAGGG + Intronic
906208759 1:44000731-44000753 CAGCGGGGGAAGGGAGGGGCCGG + Intronic
906237487 1:44220713-44220735 CCTAGTGGGAAGGGTGGGCAAGG + Intergenic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
907274831 1:53311260-53311282 CAGGGTGTGAGGAGCGGGGAGGG + Intronic
907303816 1:53503081-53503103 CAGAGAGGGAAGGGCGGGACAGG + Intergenic
907330289 1:53666581-53666603 AAGAGTGGGCAGAGTGGGGATGG - Intronic
907975364 1:59426361-59426383 CAGGGTGGGAAGGGGAGTGAAGG + Intronic
908187920 1:61670378-61670400 TAGAGTGGGGAGGGAGAGGAGGG + Intergenic
908766096 1:67555728-67555750 CAGCGTGAGGAGGGAGGGGAGGG + Intergenic
909342858 1:74551078-74551100 CAGAGTGAGAAGGGAGAGGAGGG - Intergenic
909473626 1:76057526-76057548 CAGGGTGGGAAGCAAGGGGAGGG - Intergenic
909541137 1:76792777-76792799 CAGTGTGGGAAAGGAGGGCAAGG - Intergenic
909595061 1:77397321-77397343 CATTGTGGGAAGGGCTGTGATGG - Intronic
910272989 1:85417302-85417324 GTGAGTGGGAACAGCGGGGAGGG + Intronic
910408406 1:86914599-86914621 CGGAGGGGGATGGGCGGGGGCGG + Intergenic
910425319 1:87115282-87115304 CACAGTGGGAAGTGAGGGGATGG - Intronic
910649292 1:89547796-89547818 CATAGTGGGCGGGGAGGGGAGGG + Intronic
911026145 1:93436986-93437008 CAGAGTGGGATGGGAGAGGTGGG + Intergenic
911412174 1:97523574-97523596 GAGATTAGAAAGGGCGGGGAGGG - Intronic
911519299 1:98909244-98909266 GGGAGGGGGAAGGGAGGGGAAGG - Intronic
911767919 1:101701653-101701675 GGGAGTGGGGAGGGGGGGGAGGG - Intergenic
912631255 1:111248510-111248532 CAGTGTGGTAAGGGCTGTGATGG + Intergenic
912660200 1:111521002-111521024 TAGGGTGGGAAGGGGTGGGAGGG - Intronic
912738659 1:112173674-112173696 CAGAGTGGGAAAGGGGGTGAGGG - Intergenic
913188366 1:116391135-116391157 CAAAGTGGGAGGGGAGGAGACGG + Intronic
913271686 1:117100363-117100385 CAGAGTGGGAAGGGGGGACCTGG - Intronic
913484336 1:119320145-119320167 GAGAAGGGGAAGGGAGGGGAGGG - Intergenic
913583955 1:120254780-120254802 GGGAGGGGGAAGGGAGGGGAGGG + Intergenic
913624226 1:120643560-120643582 GGGAGGGGGAAGGGAGGGGAGGG - Intergenic
914411986 1:147438289-147438311 CAGTGTGGGAAGGGTGGGGGAGG + Intergenic
914565942 1:148866624-148866646 GGGAGGGGGAAGGGAGGGGAGGG + Intronic
914606879 1:149263612-149263634 GGGAGGGGGAAGGGAGGGGAGGG - Intergenic
915741130 1:158119049-158119071 CAGAGTGGGAGGGGGTGGGCTGG + Intergenic
917129917 1:171730678-171730700 GAGAGAGGGAAGGAGGGGGAAGG + Intronic
917433897 1:174999876-174999898 CAGACTCGGCGGGGCGGGGAGGG + Exonic
917695941 1:177524172-177524194 CAGAGTGGCAAGGTTGGGAAAGG + Intergenic
917832516 1:178908080-178908102 CAGAGTGGGGAGGGTGGGAGAGG - Intronic
917995979 1:180438911-180438933 GAGAGTGGGGAGGGAGGGAAGGG - Intronic
918409465 1:184243788-184243810 CAGAGTGGTGATGCCGGGGAGGG - Intergenic
918410269 1:184251207-184251229 GAGAGAGGGAAGGGAGAGGAAGG - Intergenic
918939482 1:190973146-190973168 CAGGGTGGGAAGCTAGGGGAGGG - Intergenic
919150404 1:193690030-193690052 CAGGGTGGGAAGGGGGTGGATGG + Intergenic
919638235 1:200024777-200024799 GAGAGGGGGAAGGGAGGGGAGGG + Intergenic
919736129 1:200952314-200952336 CAGAGAGTGAGGGGCGGGGTGGG - Intergenic
920013335 1:202886280-202886302 AAGCGGGGGAAGGGAGGGGAGGG + Intronic
920013353 1:202886317-202886339 GGGAGTGGGAAGGGAAGGGAGGG + Intronic
920311482 1:205051491-205051513 GAGAGTGGCAAGGACAGGGAGGG + Intronic
920385655 1:205568953-205568975 CGGGGAGGGAGGGGCGGGGAGGG - Intronic
920403466 1:205692079-205692101 CAGAGGGGGAAAGGTGTGGAGGG - Intergenic
920453638 1:206080464-206080486 CAGAGTGGGGAGGCTTGGGAAGG + Intronic
920974608 1:210774054-210774076 CAGGGTGGGAAAGGTGGGCATGG + Intronic
921177660 1:212608325-212608347 AAGAGCGGGGGGGGCGGGGAAGG - Intronic
921220111 1:212967638-212967660 CAGATTGGGAAAGGCTGGGCTGG + Intronic
921308147 1:213817313-213817335 CAGAGAAGGAAGGCGGGGGAAGG + Intergenic
921440115 1:215175643-215175665 TAGAGTGGGAAGGGAGGGAAGGG - Intronic
922125808 1:222722100-222722122 CAGAGTCGGAAAGCCTGGGATGG - Intronic
922133879 1:222806176-222806198 CAGGATGGGAAGGGAGGGGAGGG - Intergenic
922196567 1:223364452-223364474 GAGACTGGCGAGGGCGGGGACGG + Intergenic
922216235 1:223522440-223522462 CAAAGTGGGATGTGTGGGGAAGG - Intergenic
922239905 1:223748733-223748755 CAGGCTGGGAAGGGCGGGAAAGG - Intronic
922466985 1:225851166-225851188 CAGCATGGGAAGGGCTGGGGAGG - Intronic
922712022 1:227841442-227841464 CCATGTGGGAAAGGCGGGGAAGG + Intronic
922949022 1:229542674-229542696 CAGAGTGGGAAGAGACAGGATGG + Intronic
922979907 1:229816877-229816899 CAGAGTGGGAAGAGGAGAGAAGG - Intergenic
923144387 1:231187685-231187707 CGGAGTGGGAGAGGCGGGGTGGG + Intronic
923249348 1:232165773-232165795 CAGAGTGGGGAGGGTGGGAGAGG + Intergenic
923265086 1:232306503-232306525 GAGTGTGGGAAGGGAGAGGAAGG - Intergenic
924198820 1:241639656-241639678 CAGCGTGGGGCGGGAGGGGACGG + Intronic
924445177 1:244123190-244123212 GAGAGTGGGAACATCGGGGAGGG - Intergenic
924466707 1:244304906-244304928 CATATTGAGAAGGGCGTGGAAGG - Intergenic
924552694 1:245093071-245093093 GAGAGAGGGAGGGGCAGGGATGG + Intronic
924606506 1:245540051-245540073 CAGAGTGTGAAGGCAGGGAAAGG - Intronic
924740911 1:246793942-246793964 AAGCATGGGAAGGGCGGGGACGG + Intergenic
1062801618 10:385244-385266 CAGTGTGGGAATGGCAGGGATGG + Intronic
1063114310 10:3063460-3063482 AAGAGTGGGTAGGGAGAGGAGGG + Intergenic
1064114590 10:12567407-12567429 TAGAGTGGGGAAGGCAGGGATGG + Intronic
1065245374 10:23750957-23750979 AAGAAAGGGAAGGGAGGGGAGGG - Intronic
1065372152 10:24998319-24998341 GAGAGAGGGAAGGGAGGGGAGGG - Intronic
1065399810 10:25286258-25286280 CAGAGTGGGAGGCAAGGGGAAGG - Intronic
1065493654 10:26307669-26307691 GAGAGTGGGCAGGATGGGGAAGG - Intergenic
1065506335 10:26433626-26433648 CAGAGGGAGAAGAGCGGGGGAGG - Intergenic
1066044537 10:31584099-31584121 CTGTGTGGGAAGGTCGGGGGCGG - Intergenic
1066046603 10:31600821-31600843 CAGAGTGGGAAGGAAGAGGCTGG - Intergenic
1066199032 10:33128098-33128120 AGGAGTGGGAAAGGAGGGGAGGG - Intergenic
1066533712 10:36367468-36367490 CAGTAAGGGAAGGGCAGGGAAGG + Intergenic
1066696916 10:38087402-38087424 GAGGGTGGGGAGGGTGGGGAGGG - Intergenic
1066696921 10:38087411-38087433 GAGGGTGGGGAGGGTGGGGAGGG - Intergenic
1067929848 10:50549538-50549560 CAGAGAGGGATGGTGGGGGAGGG + Intronic
1068062471 10:52086183-52086205 CAGGGTGGAAAGGATGGGGAGGG - Intronic
1068532508 10:58205678-58205700 AAGAGTGGGAAGGGTGGCTAGGG + Intronic
1068687153 10:59881969-59881991 CAGAGAGGGAAGGAGAGGGAGGG + Intronic
1068689955 10:59905541-59905563 TCGAGAGGGAAGGGCGGGTACGG - Intronic
1068984405 10:63094025-63094047 CAGAGTGGAAAGGGAGGTCAGGG - Intergenic
1069032909 10:63617054-63617076 CAGTGTGGCAAGGAAGGGGATGG - Intronic
1069861632 10:71475304-71475326 CACAGTGGGGAGGGCGGGGTAGG + Intronic
1069868915 10:71521369-71521391 CAGACTGGGAGGTGCAGGGATGG - Intronic
1069959367 10:72070557-72070579 CAGTGTGGGGAGGGTGGGCAGGG - Intronic
1070515269 10:77199704-77199726 CAGCGTGAGAAGGCAGGGGAAGG + Intronic
1070537762 10:77392244-77392266 GAGAGAGGGAAGGGAAGGGAGGG + Intronic
1070626412 10:78054212-78054234 AGGAGTGGGAAGGGAAGGGAAGG + Intronic
1070661102 10:78305825-78305847 CAGAGTTGGAATTGTGGGGAAGG - Intergenic
1072009370 10:91290241-91290263 CAGAGTGGGAAGCAGGAGGAGGG + Intergenic
1072039232 10:91591434-91591456 CAGAGAGGGTAGGGTGGGGAGGG - Intergenic
1072581332 10:96742350-96742372 GAGAGAGGAAAGGGAGGGGAGGG + Intergenic
1072744901 10:97933101-97933123 GAGAGTGGGAAGGGTGGCAATGG + Intronic
1073046123 10:100639566-100639588 AGGAGTGGGAAGAGCGGAGAAGG + Intergenic
1073136689 10:101224351-101224373 CAGAAGGGGAAGGGCGGGGGAGG + Intergenic
1073136700 10:101224375-101224397 GAGAGGGGGAAGGGAGGGGAGGG + Intergenic
1073267655 10:102237879-102237901 CATAGTGGGGTGGGCGGGGGAGG - Intronic
1073348467 10:102802002-102802024 AAGGGTGGGAAGGTGGGGGAGGG - Intronic
1073842956 10:107519057-107519079 CACAGTGGGAAAGGAAGGGAGGG + Intergenic
1073894920 10:108144334-108144356 CAGAGGGAGGAGGGGGGGGAAGG - Intergenic
1074112061 10:110429736-110429758 CAGAGAAGGAAGGGAGGGAAGGG - Intergenic
1074116507 10:110460656-110460678 CAGAGAGGGAGGTGCTGGGAAGG + Intergenic
1074445638 10:113519100-113519122 CTGAATGGGAAGTGCGGTGATGG + Intergenic
1074544152 10:114389354-114389376 CAGGGTGGGAAGTGGGGAGAGGG + Intronic
1074755859 10:116623743-116623765 CGGGGTGGGAAGGGCGGGTGGGG - Intronic
1075070143 10:119314994-119315016 CTGAGTGGGCAAGGCAGGGAAGG - Intronic
1075101567 10:119509948-119509970 GAGAGGGGGAAGGGGGGAGAGGG + Intronic
1075382181 10:122028741-122028763 CAGAAGGGGAAGGGAGGAGAGGG - Intronic
1075559956 10:123460956-123460978 CAGAGTGGGTGGGGAGGGAAGGG - Intergenic
1075575224 10:123572818-123572840 GAGAAGGGGAAGGGAGGGGAGGG + Intergenic
1075667105 10:124239445-124239467 GAGAGAGGGAGGGGAGGGGAGGG + Intergenic
1076057422 10:127387026-127387048 CAGAATGGGCAGGGCAGGGCAGG + Intronic
1076138145 10:128058830-128058852 AAGACTGGGAAAGGCAGGGAAGG - Intronic
1076186025 10:128449791-128449813 GAGAATGGAAATGGCGGGGAGGG + Intergenic
1076402585 10:130193643-130193665 CAGCCTGGGAAGGCCTGGGAAGG - Intergenic
1076402762 10:130194503-130194525 GAGAGAGGGAGGGGAGGGGAGGG + Intergenic
1076405947 10:130212668-130212690 CCCAGTGGGAGGGGAGGGGAAGG - Intergenic
1076681344 10:132173110-132173132 GAGAGAGGGAAGGAGGGGGAGGG - Intronic
1076806695 10:132862432-132862454 CAGGGTGGGTGGGGCGGGGTGGG + Intronic
1076888278 10:133272375-133272397 CAGGGTGGGGAGGGCTGGGGAGG - Intronic
1076888282 10:133272384-133272406 CGGAGCGGGCAGGGTGGGGAGGG - Intronic
1077093309 11:789145-789167 CAGGGGGAGGAGGGCGGGGAGGG + Intronic
1077219015 11:1407211-1407233 CAGAGAGGGCAGGGGTGGGAAGG - Intronic
1077307378 11:1874266-1874288 CAGTGGGGGCAGGCCGGGGACGG + Intronic
1077311773 11:1891975-1891997 CTGGGTGGGGAGGGCGGGGGCGG - Exonic
1077553957 11:3217219-3217241 CAGTGTGGGAGGGGATGGGAGGG + Intergenic
1077630551 11:3808549-3808571 CAGAGCGCGAACGGCGGGGGCGG - Exonic
1077754028 11:5006068-5006090 CAGAAGGGGAAGGGCAAGGAAGG - Intergenic
1078014129 11:7597854-7597876 CAGAGGGGGTAGGGAAGGGAAGG + Intronic
1078164498 11:8870872-8870894 CAGAGGGAAAAGGGCTGGGAGGG + Intronic
1078549469 11:12270277-12270299 CAGCCAGAGAAGGGCGGGGAAGG - Intergenic
1078931062 11:15912552-15912574 CAGAGTCTGTGGGGCGGGGAGGG - Intergenic
1079095051 11:17504586-17504608 CAGAGTGGGAGGGACGGGGGTGG + Intronic
1079330462 11:19528639-19528661 AAGAATGGGAAGGCCGGGCACGG + Intronic
1079880781 11:25923775-25923797 CAGAGGGGGAAGGGAGGGAGGGG - Intergenic
1080332265 11:31153251-31153273 CAGAGTTGTAAGGAAGGGGATGG - Intronic
1080556567 11:33422513-33422535 GAAAGGGGGAAGGGAGGGGAGGG - Intergenic
1081009304 11:37788537-37788559 CACAGGGGGAAAGGCTGGGAAGG - Intergenic
1081664177 11:44906774-44906796 GAGAGTGGGAAAGGAGGGGATGG + Intronic
1081831753 11:46120834-46120856 CAGAGGGGGAAGGGGGAGGGAGG + Intronic
1082076632 11:47980506-47980528 CAGAGGGGGAGGGGAAGGGAGGG + Intergenic
1082987425 11:59180623-59180645 CAGGGTGGGGAGGTCGGGGAGGG - Intronic
1083298725 11:61729038-61729060 CAGAGTGGGAGGGATGGGGACGG - Intronic
1083305087 11:61757904-61757926 CAGCCTGGGATGGGCAGGGAAGG + Intronic
1083317791 11:61827371-61827393 GTGAGGGGGAAGGGAGGGGAAGG - Intronic
1083328041 11:61883648-61883670 GATAGAGGGAAGGGCTGGGAGGG - Intronic
1083373274 11:62198841-62198863 AAGAGTGTGAAGGCCGGGCACGG + Intergenic
1083597971 11:63928548-63928570 CAGAGTGGGAGAGGAGGGGCAGG + Intergenic
1083744091 11:64725790-64725812 AAGAGGGGGAAGGGCGGAGGGGG + Intergenic
1083863274 11:65437965-65437987 CAGAGAGCGTAGGGCTGGGATGG + Intergenic
1084216106 11:67647705-67647727 CAGCGTGGGGCGGGCGGGGCAGG - Intronic
1084310182 11:68312410-68312432 CAGGGCGGGGAGCGCGGGGAGGG + Intergenic
1084421863 11:69064303-69064325 CTGGCGGGGAAGGGCGGGGAGGG - Intronic
1084557853 11:69885610-69885632 CAGAGTGGGGAGGGCAGAGTGGG + Intergenic
1084557867 11:69885652-69885674 CAGAGTGGGGAGGGCAGAGTGGG + Intergenic
1084557872 11:69885666-69885688 CAGAGTGGGGAGGGCAGAGTGGG + Intergenic
1084557888 11:69885708-69885730 CAGAGTGGGGAGGGCTGAGGGGG + Intergenic
1084557906 11:69885750-69885772 CAGAGTGGGGAGGGCTGAGGGGG + Intergenic
1084580439 11:70019925-70019947 CGGAGTGGGAAGGGGGCCGAGGG + Intergenic
1084660566 11:70544235-70544257 CAGAGTGGGCAGGCCGGGGCTGG - Intronic
1084870954 11:72098246-72098268 CAGTGTGAGAAGGGTGGGCAGGG + Intronic
1084985595 11:72868350-72868372 CAGAGGGCGATGGGTGGGGAAGG + Intronic
1085038758 11:73314734-73314756 GAGTGTGGGAGGGGCGGGGCAGG - Intronic
1085085552 11:73664374-73664396 GGGAGGGGGAAGGGAGGGGAAGG - Intergenic
1085410847 11:76289407-76289429 CACTGTGGGGAGGGAGGGGAAGG - Intergenic
1085453771 11:76654660-76654682 GAGAATGGGGAGGGCGGGGTGGG - Intergenic
1086097186 11:83062172-83062194 CAGAGTGGGAGGGGAGGGCTAGG + Intronic
1086575895 11:88338534-88338556 CAGGGTGAGAAGGGTGAGGAAGG + Intergenic
1086666722 11:89491975-89491997 CAGTATGGGATGGGCGGGCAAGG - Intronic
1087127304 11:94640690-94640712 CAGAGGGGCAGGGGCGGGGCGGG - Intergenic
1087767978 11:102177031-102177053 CAGAGTGGGAAGGGATGAGAGGG + Intronic
1088180120 11:107099733-107099755 AAGGGTGGGAAGGGGGGTGAGGG + Intergenic
1088985730 11:114906206-114906228 CAGGCTGGGAAGGGTGGGGGTGG + Intergenic
1089069586 11:115689158-115689180 CAGCGAGGGAAGGGCCGGGGAGG - Intergenic
1089147534 11:116340775-116340797 CAGGGTGGGGAGCGCGGGGCGGG + Intergenic
1089374788 11:117986555-117986577 CGGAGAGGGCAGGGCAGGGAAGG - Intronic
1090007561 11:123016532-123016554 AACAGTGGGAGGGGTGGGGAGGG - Intergenic
1090062697 11:123477628-123477650 AAGGGAGGGAAGGGAGGGGAGGG - Intergenic
1090208527 11:124899027-124899049 CAGGATGGGAAGGGGGAGGAAGG - Intergenic
1090245389 11:125212622-125212644 CAGAGAGGGAAGAGAGGAGAGGG + Intronic
1090246137 11:125217218-125217240 AGGAGTGGGAAAGGAGGGGATGG - Intronic
1090372798 11:126268577-126268599 CAGTGTGAGGTGGGCGGGGAGGG + Intronic
1090435968 11:126686509-126686531 CTGAGCGGGGAGGGTGGGGAGGG + Intronic
1090773022 11:129938511-129938533 CAGGGTGGCAAAAGCGGGGATGG - Intronic
1091188593 11:133669881-133669903 CAGAGAGGGAAGGGCTGAGCAGG + Intergenic
1091747167 12:2999802-2999824 CTGAGTGTGAGGAGCGGGGAAGG - Intronic
1091759525 12:3077596-3077618 CAGTGTGGGCAGGGCGGCGGTGG + Intronic
1091789028 12:3260717-3260739 CAGAGGTGGAGGGGCAGGGAGGG + Intronic
1092049906 12:5461057-5461079 CAGAGTGGGATTGGGGGGGAAGG + Intronic
1092218268 12:6697264-6697286 GTGAGTGGGAAAGGCTGGGAGGG - Intronic
1092233312 12:6789974-6789996 CAGGCTGGGAAAGGCGTGGAAGG + Intronic
1092817261 12:12322977-12322999 GAGAGGGGGAGGGGAGGGGAGGG + Intergenic
1092941943 12:13418057-13418079 CAGAGATGGAAGGATGGGGATGG - Intergenic
1093971106 12:25376852-25376874 CAAAGAGGGAAGGGAGGGAAAGG + Intergenic
1094161012 12:27391185-27391207 TAGAGGGGGAAGGGAGGGAAGGG - Intronic
1094257376 12:28447704-28447726 AAGAATGGGAAGGGCAGGGCAGG + Intronic
1094470453 12:30796916-30796938 CAGAGTGAAAGGGGTGGGGATGG - Intergenic
1094636334 12:32230115-32230137 CTGAGAGGGAAGGTAGGGGAGGG + Intronic
1095444514 12:42270683-42270705 AAGGGTGGGGAGGACGGGGAGGG + Intronic
1095604527 12:44051125-44051147 CAGAGTGGGAAGCTCAGGAATGG + Intronic
1095716474 12:45351564-45351586 CAGAGTGGGAAGTGAGTTGAGGG + Intronic
1096155119 12:49337248-49337270 CAGAGTGGGAAGTGCGGGGGCGG + Intergenic
1096182713 12:49559419-49559441 CAGCCTAAGAAGGGCGGGGATGG + Intronic
1096226316 12:49868928-49868950 GGGAGTAGGAAGGGTGGGGAGGG + Exonic
1097092594 12:56519054-56519076 CAGGGTGGGGAGGGGTGGGATGG + Intergenic
1097166848 12:57090562-57090584 CTGAGTGGGAAAGCCAGGGAAGG + Intronic
1098106178 12:67070058-67070080 CAGGGTGGGGAGGGCGTGAATGG + Intergenic
1098620630 12:72593656-72593678 CAGGGTGGGAGGAGGGGGGAGGG - Intronic
1098807921 12:75043925-75043947 CTGGGTGGGAAGGTCGGGGGTGG - Intronic
1098992738 12:77082442-77082464 CAGAAGGGTGAGGGCGGGGAGGG + Intergenic
1100104087 12:91147342-91147364 CAGAATGGGATGGTCAGGGAAGG - Intronic
1100828084 12:98493383-98493405 CAGAGAGGGAAGGGCTGGAGTGG - Intronic
1101150264 12:101877345-101877367 CAGAGTGGGAAGGCCAGAGCGGG + Exonic
1101209719 12:102523841-102523863 GAGAGGGGGAAGGAGGGGGAGGG + Intergenic
1101581885 12:106049130-106049152 CAGAGTGGAAAGGACAGGCAGGG + Intergenic
1101651547 12:106681811-106681833 CAGAGTGGGGAGTGCTTGGATGG - Intronic
1101937482 12:109069962-109069984 CAGGGAGGCCAGGGCGGGGAGGG + Intronic
1102001642 12:109561257-109561279 CAGAGTGGGCAGGGCTGGGAGGG + Intronic
1102006513 12:109592469-109592491 CAGAGTGCGGGGCGCGGGGAGGG - Intronic
1102565496 12:113794811-113794833 CACAGTGGGGAGGGGGGGGGTGG - Intergenic
1102858934 12:116318840-116318862 CAGTGTGGGGAGGGGGGGTAGGG - Intergenic
1102915120 12:116746811-116746833 CAGAATGGGAAGCCCTGGGAGGG + Intronic
1103000635 12:117383084-117383106 CAGAGGGGGAAGTGCAGAGAGGG - Intronic
1103586908 12:121962925-121962947 CAGAGTGGAATGGGCAAGGAGGG + Intronic
1103610557 12:122121661-122121683 CAGAGAGGGCAGGCCGGGCATGG - Intronic
1103869220 12:124079164-124079186 CTGAGTGGGAAGGCCCTGGAGGG + Intronic
1104498982 12:129266594-129266616 GAGAAAGGGAAGGGAGGGGAGGG - Intronic
1104566884 12:129893395-129893417 CAGGGTGGGTAGGGTGGGGAGGG - Intronic
1104605512 12:130184778-130184800 CAGGGTGGGGAGGGAGCGGAAGG - Intergenic
1104807583 12:131599310-131599332 CAGAGTGAGAAATGCGGGCAGGG - Intergenic
1104836635 12:131795993-131796015 GAGAGGGGGAGGGGAGGGGAGGG + Intronic
1104836648 12:131796016-131796038 GAGAGGGGGAGGGGAGGGGAGGG + Intronic
1104836662 12:131796044-131796066 GAGAGGGGGAGGGGAGGGGAGGG + Intronic
1104893711 12:132151979-132152001 CAGAGTGGGCGGGGTCGGGACGG - Intronic
1105509263 13:21037790-21037812 CAGAGTGGGCAGGGCCAGGGTGG + Intronic
1105709997 13:22998278-22998300 GAGAAGGGGAAGGGAGGGGAAGG + Intergenic
1105734189 13:23250873-23250895 CAGAGTGGGGTGGGGGGTGAGGG + Intronic
1105920514 13:24958955-24958977 CAGAGTGGGGAGGGGGTGGCAGG + Intergenic
1106090755 13:26591173-26591195 CAGAGTGGTTAGGGGAGGGAAGG + Intronic
1106519027 13:30480763-30480785 ATGAGAGAGAAGGGCGGGGAGGG - Intronic
1106655640 13:31743581-31743603 AACAGTGGGAAGGGGGAGGATGG - Intronic
1107893271 13:44932810-44932832 CAGAGTGGCAAGGGCAGGGTAGG - Intergenic
1108272796 13:48778841-48778863 TACAGAGGGAAGGGCGGGGGTGG - Intergenic
1108536420 13:51385202-51385224 CAGAGTGGGAAGGGGTATGAGGG - Intronic
1109273856 13:60283034-60283056 CAGAGAGGGAGAGGCAGGGAGGG - Intergenic
1109514069 13:63418039-63418061 CAGGGTGGGGAGAGGGGGGAGGG + Intergenic
1111541439 13:89672284-89672306 CAGAGTGGGAGTGGGGTGGATGG - Intergenic
1111891526 13:94088538-94088560 AAGAGAGGGAAGGGAAGGGAAGG + Intronic
1112030787 13:95454527-95454549 CAGGGTGGGGAGAGAGGGGAGGG - Intronic
1112825962 13:103392890-103392912 CAGGGTGGGACGGTAGGGGAGGG + Intergenic
1113521644 13:110946159-110946181 CTGAGTGGGAGGTGCTGGGATGG + Intergenic
1113754845 13:112804012-112804034 CAGAGAGGGGATGGCAGGGAGGG - Intronic
1113754902 13:112804169-112804191 CAGAGAGGGGATGGCAGGGAGGG - Intronic
1113755004 13:112804439-112804461 CAGAGAGGGGATGGGGGGGAGGG - Intronic
1113768315 13:112894271-112894293 CGGAGGGGGAGGGGCGGAGAGGG - Intergenic
1113796557 13:113061790-113061812 GGGAGAGGGAAGGGAGGGGAAGG - Intronic
1114756884 14:25269609-25269631 CAGAGTGGGCAGGTGGGGAAGGG - Intergenic
1115279533 14:31646175-31646197 AAGCGGGGGAAGGGCAGGGAAGG - Intronic
1115353665 14:32424427-32424449 CAGAGATGGAAGGGAGGTGAAGG - Intronic
1115802713 14:37013665-37013687 CAGAGTGGTGAGGGGGGTGAGGG - Intronic
1116788974 14:49319010-49319032 AAGAGAGGGAAGGGAAGGGAAGG + Intergenic
1117616203 14:57536191-57536213 CAGAGAGTGAAGAGAGGGGAAGG - Intergenic
1117872822 14:60218696-60218718 CAGGGTGGGAAGGGGTGGGGTGG - Intergenic
1118023482 14:61743834-61743856 CATAGTGGGAAGAGCAGGGGAGG + Intronic
1118137831 14:63047182-63047204 GAGAGAGGGAGGGGAGGGGAGGG - Intronic
1118785073 14:69038873-69038895 CACAGTGGGAAAGGGGTGGATGG - Intergenic
1118918043 14:70124437-70124459 CATAGTGGGAATGGAGGGAAAGG - Intronic
1118970960 14:70637336-70637358 CAGAATGGGGAGAGTGGGGAGGG - Intergenic
1119171818 14:72541423-72541445 CAGAGAGGGAAGACCGAGGAAGG - Intronic
1119472479 14:74908624-74908646 TAGAGTGGGATGGTCAGGGAAGG - Intronic
1119673719 14:76538879-76538901 GGGAGGGGGAAGGGAGGGGAGGG - Intergenic
1119722333 14:76899651-76899673 AAGAGTGAGGAGGGCGGTGAAGG + Intergenic
1120023203 14:79553290-79553312 CAGAGAGGGAGGGAAGGGGAAGG + Intronic
1120545268 14:85803796-85803818 AAGAGTGGGAGGGTGGGGGAGGG - Intergenic
1120876668 14:89381841-89381863 CAGAGAAGGAGGGGAGGGGAGGG + Intronic
1121093697 14:91201084-91201106 CATTATGGCAAGGGCGGGGAGGG + Intronic
1121242554 14:92440849-92440871 CAGAGAGGGAAGGGAAGGGAAGG + Intronic
1121324443 14:93011870-93011892 CAGGGAGGGTGGGGCGGGGATGG - Intronic
1121341581 14:93108144-93108166 CAGAGTGGGAGAGGCTGGGCTGG + Intronic
1122149264 14:99715979-99716001 CGGACTGGGGAGGGCGGGGTGGG + Intronic
1122526762 14:102391687-102391709 CAGAGAGGGGAGGGCAGGAAAGG - Intronic
1122550830 14:102548862-102548884 AAGAGTGGGATAGGTGGGGAGGG + Intergenic
1122695377 14:103549754-103549776 CAGACTGGTGAGGGCTGGGAAGG - Intergenic
1122830067 14:104391523-104391545 CAGAGGGGCAAGGTTGGGGAGGG + Intergenic
1122838543 14:104443280-104443302 CAGAGTGGGGAGGGCCGGAGTGG - Intergenic
1123028561 14:105439912-105439934 CAGAGGGGGCAGCGGGGGGAAGG + Intronic
1123434907 15:20247808-20247830 AAGGATGGGAAGGGAGGGGAGGG + Intergenic
1124100383 15:26687518-26687540 CAAAGAGAGAAGGGAGGGGATGG - Intronic
1124100462 15:26688345-26688367 TAGAGTGGGAAGGGCTGGCTGGG - Intronic
1124482150 15:30087917-30087939 CAGACAGGTAAGGGCGGGGCAGG - Intronic
1124592442 15:31065268-31065290 CAGAGTGGGTAGAATGGGGATGG - Intronic
1124754920 15:32398305-32398327 CAGACAGGTAAGGGCGGGGCAGG + Intronic
1125539642 15:40462559-40462581 CAAAGTGAGCAGGGAGGGGAGGG - Intronic
1126042671 15:44607949-44607971 CAGAGTGGGAAGGGTGGAGGTGG - Intronic
1126405467 15:48318293-48318315 CAGAGGGAGAAGGGCGGGAAAGG - Intergenic
1126417966 15:48438622-48438644 CAGAGAGGGAAGGAAGAGGAGGG + Intronic
1126482524 15:49141825-49141847 CAGAGTGGGAAGGAAGGGAGAGG - Intronic
1127064481 15:55222616-55222638 TATAGTGGGAAGGGAGGGGGAGG - Intronic
1127561161 15:60137775-60137797 CAGAGTGGGAAAGGAGCTGATGG + Intergenic
1127907576 15:63387646-63387668 CAGAGAGGGAAGGGGGAGGAAGG + Intergenic
1127983381 15:64050428-64050450 CAGAGTGGGCATGGCTGGGAAGG - Intronic
1128534509 15:68480552-68480574 CACAGTGGGAATGGAGGGGGTGG - Intergenic
1128610656 15:69070492-69070514 AAGAGAGGGAAGGGAAGGGAAGG + Intergenic
1128634921 15:69297086-69297108 AGGAGGGGGAAGGGCAGGGAGGG - Intergenic
1128740969 15:70083510-70083532 GAGAGAGGGAAGGGTGGGGGCGG - Intronic
1128911224 15:71517282-71517304 GAGAATGGGAGTGGCGGGGATGG - Intronic
1129395126 15:75240071-75240093 GAGAGAGGGAGGGGGGGGGAGGG - Intergenic
1129923941 15:79345294-79345316 CAGAGGGTGAAGGGTGGGAAGGG - Intronic
1130520616 15:84658290-84658312 GAGGGTGGGGACGGCGGGGAGGG - Exonic
1130555303 15:84918411-84918433 CTGAGTGGCAAGGCCTGGGATGG + Intronic
1131166556 15:90145850-90145872 CAGAGAGGCAAGAGAGGGGATGG + Intergenic
1131298334 15:91172309-91172331 CACACTGGGAAGGGTGAGGAGGG - Intronic
1131318705 15:91366055-91366077 CACAGTGGGAGGGGAGAGGAGGG + Intergenic
1131501551 15:92972471-92972493 CAGTGTAGGAAGGTTGGGGAGGG - Intronic
1131673318 15:94645502-94645524 CAGCTTGGGAAGGGAGGTGAAGG - Intergenic
1132033893 15:98463476-98463498 CTGAGTGGGAAAGGGTGGGAAGG + Intronic
1132456444 16:26311-26333 GAGAGTGGGAGGGGTGTGGACGG - Intergenic
1132515572 16:364237-364259 GGGCGTGGGGAGGGCGGGGAGGG + Intergenic
1132515577 16:364246-364268 GAGGGCGGGGAGGGCGGGGAGGG + Intergenic
1132560125 16:589805-589827 CCGTGTGGGAAAGGCGGGGGAGG + Intronic
1132582973 16:693859-693881 CAGAGCGGGTGTGGCGGGGAAGG + Exonic
1132666562 16:1083595-1083617 GAGAGTGGGTGGGGTGGGGACGG + Intergenic
1132829085 16:1918749-1918771 CGGAGTGGGGTGGGGGGGGAAGG - Intergenic
1132848756 16:2014090-2014112 CAGGGTGTGAAGGGTGGGCAGGG + Intronic
1132860833 16:2070981-2071003 CTGAGAGGGCAGGGCAGGGATGG + Intronic
1132871181 16:2116455-2116477 CACAGTGGGCAGGGCAGGCAAGG + Intronic
1132935487 16:2478417-2478439 CAGAGTGTGGAGGGAGGGGGCGG + Intronic
1133157988 16:3889397-3889419 GGGAGGGGGAAGGGAGGGGAGGG - Intergenic
1133279500 16:4657173-4657195 CGGAGTGGGAGGGACGGGCACGG + Intronic
1133594009 16:7273036-7273058 GAGGGAGGGAAGGGAGGGGAAGG - Intronic
1133810635 16:9158464-9158486 AAGAAAGGGAAGGGAGGGGAGGG - Intergenic
1134288617 16:12884245-12884267 AAGGGTGGGAAGGGTGGGAAGGG + Intergenic
1134332701 16:13265228-13265250 AAGAAAGGGAAGGGAGGGGAGGG - Intergenic
1134690571 16:16188709-16188731 CAGAGTGGGAGGGAGAGGGATGG - Intronic
1135110034 16:19683443-19683465 TAGAGTGGGGAGGAAGGGGAGGG - Intronic
1135165793 16:20138171-20138193 GGGAGAGGGAAGGGAGGGGAGGG - Intergenic
1135200769 16:20436223-20436245 GAGAGTGGGGAGGGAAGGGAAGG - Intronic
1135531072 16:23255151-23255173 AAGAGTGGGAAGGGAGGGAGTGG + Intergenic
1135607438 16:23836430-23836452 CAGGGTGCGGAGGGCGCGGAGGG - Intronic
1136089122 16:27905848-27905870 GGGAGTGGGAAGGTGGGGGAAGG - Intronic
1136160251 16:28415172-28415194 GACAGTGGAGAGGGCGGGGAGGG - Intergenic
1136202837 16:28700118-28700140 GACAGTGGAGAGGGCGGGGAGGG + Intronic
1136294464 16:29293634-29293656 CTGAGTGGAAATGGAGGGGAGGG + Intergenic
1136342957 16:29656871-29656893 CCGGGTGGCAAGGGCGTGGATGG + Intergenic
1136403472 16:30030655-30030677 CAAAGGGGCCAGGGCGGGGACGG + Exonic
1136576823 16:31130176-31130198 CGGGGTGGGGAGGGTGGGGAGGG + Intronic
1136686176 16:31996142-31996164 AAGAGGAGGAAGGGCAGGGAAGG + Intergenic
1136786789 16:32939671-32939693 AAGAGGAGGAAGGGCAGGGAAGG + Intergenic
1136849713 16:33603180-33603202 AAGGATGGGAAGGGAGGGGAGGG - Intergenic
1136882983 16:33914119-33914141 AAGAGGAGGAAGGGCAGGGAAGG - Intergenic
1137497641 16:48983193-48983215 AAGAGGGGGAGGGGAGGGGAGGG - Intergenic
1137721567 16:50630490-50630512 AAGGGTGGGAAGGGGAGGGAAGG + Intronic
1137758673 16:50922847-50922869 CAGAGTGGGAAGGAAGAGGGTGG + Intergenic
1137776427 16:51058443-51058465 GAGAGAGGGAAGGGAAGGGAAGG + Intergenic
1138339684 16:56280567-56280589 CAGAGTGGACAGGGCAGGGAGGG + Intronic
1138510471 16:57505812-57505834 CAGGGTGGGGATGGTGGGGACGG + Intergenic
1138889847 16:61128843-61128865 CGGTGGGGGAGGGGCGGGGAAGG + Intergenic
1139202937 16:64997496-64997518 CTGAGTGTCAAGGGTGGGGATGG - Intronic
1139317695 16:66087448-66087470 TAGAGTGGGATGGGGTGGGATGG + Intergenic
1139320443 16:66109794-66109816 CAGAAGGGGAAGGGAGGGAAGGG + Intergenic
1139446378 16:67001043-67001065 CTGGGTGGGAAGGGAGGGGCGGG + Intronic
1139733407 16:68967209-68967231 CGGTGTTGGGAGGGCGGGGATGG + Intronic
1140195727 16:72853716-72853738 CAGATTCAGGAGGGCGGGGAAGG + Intronic
1140270399 16:73460109-73460131 GAGAGTGGGAATGGGAGGGAAGG - Intergenic
1140359515 16:74332523-74332545 CAGTGGGGGAGGGGAGGGGAGGG + Intergenic
1140782573 16:78310053-78310075 GAGAGGGGGAAGGAGGGGGAAGG - Intronic
1141198995 16:81882875-81882897 AAGAGTGGGAATGGCTGAGAAGG - Intronic
1141498348 16:84425890-84425912 CAGAATAGGAAGGGTTGGGAAGG + Intronic
1141515822 16:84544332-84544354 CAGAAAGGGAAGGTAGGGGACGG - Intronic
1141721751 16:85759812-85759834 TAGAGAGGGCAGGGCCGGGAGGG + Intergenic
1142012775 16:87725194-87725216 CCGAGTGGGAAGGGCACGGCAGG + Intronic
1142089638 16:88203130-88203152 CGGAGTGGGAAGGGCAGAGGTGG + Intergenic
1142100366 16:88267678-88267700 CTGAGTGGAAATGGAGGGGAGGG + Intergenic
1142187471 16:88701359-88701381 CAGAGTGGGCACAGCGGGGATGG + Exonic
1142262661 16:89050161-89050183 CTGAGTAGGAAGGGTGGGCAGGG - Intergenic
1142280963 16:89147315-89147337 CAGAGTGAGCAAGGGGGGGAGGG + Intronic
1142358908 16:89617022-89617044 CAGAAGGGGAAGGGAGGGGTGGG + Intronic
1142398721 16:89848094-89848116 CCCAGAGGGAAGGGCAGGGAAGG - Intronic
1203089025 16_KI270728v1_random:1201341-1201363 AAGAGGAGGAAGGGCAGGGAAGG + Intergenic
1142669737 17:1482670-1482692 CAGTGCGGGAGGGGAGGGGAGGG - Intronic
1142669765 17:1482745-1482767 TAGTGTGGGAGGGGAGGGGAGGG - Intronic
1142669776 17:1482777-1482799 CAGTGTGGGAGGGGAGGGCAGGG - Intronic
1142717037 17:1752824-1752846 CAGGCTGGGCAGGGCGGGTAAGG + Intronic
1142847958 17:2691144-2691166 CAGGATGGGAAGCGTGGGGAGGG + Intronic
1142850564 17:2702684-2702706 TAGAGTGGGGAGGTCGGGCACGG - Intronic
1142980426 17:3668239-3668261 CTGCGTGCGCAGGGCGGGGAGGG - Intronic
1143048343 17:4101002-4101024 CAAAGTGGGTGGGGCTGGGAGGG - Intronic
1143126648 17:4645700-4645722 GAGAGTGGGGAGGGAGGAGACGG - Intergenic
1143316688 17:6038264-6038286 CAGTGTGGCCAGAGCGGGGAGGG + Intronic
1143382132 17:6503161-6503183 CAGAGAGAGGAGGACGGGGATGG - Intronic
1143520494 17:7441602-7441624 CAGGGTGGGAAGGGGGAGAATGG + Intronic
1143611262 17:8019241-8019263 GAGAGAGGGAAGGAAGGGGAAGG - Intronic
1143632697 17:8147960-8147982 GACAGTGGGAAGGGCGAGCAGGG + Intronic
1143704548 17:8687573-8687595 GAGAGTGGGAAGAGGAGGGAAGG - Intergenic
1143750872 17:9026649-9026671 AAAAAAGGGAAGGGCGGGGAGGG - Intronic
1143785305 17:9251253-9251275 CAGAGGAGGCAGGGCGGGGCTGG - Intronic
1143797620 17:9350233-9350255 CAGGGTGGGATGGGGTGGGATGG + Intronic
1143864834 17:9916435-9916457 GAGACTGGGAAGGGCTGGCAGGG + Exonic
1143977032 17:10837602-10837624 CATTGTGGGAAGGGCTGGGCAGG - Intronic
1144071198 17:11672631-11672653 GAAAGTGGGAAGGGTGGGAAGGG - Intronic
1144217037 17:13065471-13065493 CAGAGAGGGAAAGACGGCGATGG - Intergenic
1144340981 17:14310136-14310158 GAAAGTGGGAAGGACTGGGATGG + Intronic
1144585120 17:16483038-16483060 CAGAGTGGGAAGTAGAGGGAGGG + Intronic
1144775463 17:17782681-17782703 GGGAGGGGGAAGGGCGGGGGCGG + Intronic
1146410509 17:32579656-32579678 GAGAGTGGATAGGGAGGGGAAGG - Intronic
1146687511 17:34851107-34851129 AATAGGGGGAGGGGCGGGGAGGG + Intergenic
1146687528 17:34851149-34851171 AATAGGGGGAGGGGCGGGGAGGG + Intergenic
1147147138 17:38491810-38491832 AAGAGGAGGAAGGGCAGGGAAGG + Intronic
1147193039 17:38748241-38748263 GAGGGAGGGAAGGGAGGGGAGGG + Exonic
1147862320 17:43530814-43530836 CAGTGGGGGGAGGGCGGGAAGGG - Intronic
1147981874 17:44279893-44279915 CTGGCTGGGTAGGGCGGGGACGG + Intergenic
1148404691 17:47400614-47400636 GAGAGTGGGAAGGGAAGGGAAGG - Intronic
1148562863 17:48616132-48616154 CAGAGAGGGCAGGGCAGAGAAGG - Intronic
1148682227 17:49481043-49481065 CAGAGTGGGCAGAGGGGTGAAGG + Intergenic
1148846330 17:50532324-50532346 CCGTGTGGGAAAGGCAGGGAGGG + Intergenic
1148863206 17:50615217-50615239 CAGCGTGGGGAGGGCGAGGATGG + Intronic
1149174117 17:53848549-53848571 CAGACTGGGAAATTCGGGGAAGG - Intergenic
1149571309 17:57674232-57674254 ATGAATGGGAAGGGCGGGAAGGG + Intronic
1149650358 17:58272665-58272687 TAGAGTGGGAAGGGGGGTGATGG + Intronic
1150220479 17:63493288-63493310 CACTGTGGGGAGGGAGGGGAAGG - Intronic
1150456882 17:65313416-65313438 CAGAGTGGGGCTGGCGGGGGTGG - Intergenic
1150624802 17:66835056-66835078 CCGAGAGGGAGGGGCGGGCAGGG - Intergenic
1151218370 17:72592862-72592884 CGGAGCGGGGTGGGCGGGGAGGG + Intergenic
1151431140 17:74064066-74064088 GAGGGTGGGAAGGGAGAGGAGGG + Intergenic
1151514376 17:74582745-74582767 CAGAGAGGGAAGAGCGGAGGTGG - Intronic
1151564052 17:74887423-74887445 CAGGGTGGGAAGAGCAGGGCAGG - Intronic
1151591612 17:75047798-75047820 CAGAGAACGAAGGGCGGGGTCGG - Intronic
1151601632 17:75109641-75109663 GAGAGTGGGAAAGGTGGGGCGGG + Intergenic
1151671438 17:75573666-75573688 CAGAGAGGGCAGGGAGGGGCGGG - Intronic
1151750916 17:76037081-76037103 TAGAGTGGGAGGGGCTGGGAGGG + Intergenic
1152001192 17:77646187-77646209 CCGAGTGGGCACGGTGGGGAGGG + Intergenic
1152021385 17:77781710-77781732 CAGAATGGGAAGGGAAGGGAGGG - Intergenic
1152228576 17:79103724-79103746 CAGAGAGGGCAGGCTGGGGAGGG - Intronic
1152258271 17:79252884-79252906 TAGAGGGGGAAGGGTGGGGTTGG - Intronic
1152320794 17:79608091-79608113 CAGAGGAGGGAGGGCGAGGAGGG + Intergenic
1152351408 17:79785779-79785801 CAGCGTGGGTGGGGCGGGGGTGG + Exonic
1152469662 17:80483683-80483705 CAAACTGGGGAGGGCTGGGACGG - Intergenic
1152677892 17:81651027-81651049 CACAGTGGGCAGGAGGGGGAGGG + Exonic
1152707351 17:81851476-81851498 CAGAGGGGCAAAGGCGGGTAAGG + Intronic
1152710533 17:81868753-81868775 CAGGGTGGGAGGGGCACGGAGGG + Exonic
1152778349 17:82215687-82215709 CAGTGTGGGGGGGGCAGGGAAGG - Intergenic
1152799429 17:82323977-82323999 GGGAGTGGGAGGGGCGGGGCAGG + Intronic
1152849933 17:82627549-82627571 GAGAGAGGAATGGGCGGGGAGGG - Intronic
1152891540 17:82884383-82884405 CAGCGTGTGAAGGGCGGTCAGGG + Intronic
1152891882 17:82886684-82886706 CAGAGTGGGAGGGGAGGGGAGGG - Intronic
1153285210 18:3450155-3450177 CAGAGTGAGAGAGGCGAGGAGGG - Intronic
1153310304 18:3671083-3671105 CAGAGATGGAGGGGAGGGGAGGG - Intronic
1155068060 18:22285657-22285679 GGGAGTGGGAAGTGAGGGGAAGG + Intergenic
1155195392 18:23469373-23469395 GAGAGAGGGGAGGGAGGGGAGGG - Intronic
1156863295 18:41863006-41863028 GGGAATGGGAAGGGAGGGGAGGG + Intergenic
1157269935 18:46265581-46265603 CAGAGGGGGAGGGGAAGGGATGG + Exonic
1157274713 18:46302433-46302455 CAGAGTGGGGCGGGGTGGGATGG - Intergenic
1157307564 18:46528309-46528331 CTGAGGAGCAAGGGCGGGGAGGG + Intronic
1157544578 18:48539099-48539121 CAGGGAGGGAGGGGCGGGTAGGG - Intronic
1158051020 18:53220095-53220117 CCTAGTGGGAAGGGAGGAGATGG + Intronic
1159442240 18:68496307-68496329 CAGGGTGGGAAGGTGTGGGAGGG + Intergenic
1159550804 18:69894432-69894454 GAGGGAGGGAAGGGAGGGGAGGG + Intronic
1159623520 18:70667345-70667367 GGGAGGGGGAAGGGAGGGGAAGG - Intergenic
1159868718 18:73736199-73736221 CGGAGTGGGAAGGGGAGGAAGGG + Intergenic
1159884887 18:73894503-73894525 TAGAGTGGGCAGGGCAGGGCAGG - Intergenic
1160038196 18:75320557-75320579 ATGACTGGGCAGGGCGGGGAAGG + Intergenic
1160161976 18:76480104-76480126 CAAACTGGGATGGGCTGGGAAGG + Intronic
1160423776 18:78766949-78766971 CAGAGTGGGGAGGACGCTGAAGG - Intergenic
1160465056 18:79069376-79069398 GAAAGTGGGAGGGGCGGGAAAGG + Exonic
1160478473 18:79216389-79216411 CAGAGAGGGGAGGGTGGAGAGGG - Intronic
1160535586 18:79589797-79589819 CAGGGTGGGGAGGGCAGGGCAGG - Intergenic
1160665756 19:327396-327418 CAGCGTGGGGGGAGCGGGGATGG + Intronic
1160800047 19:963531-963553 TAGGGCTGGAAGGGCGGGGAGGG + Intronic
1160872116 19:1282331-1282353 GAGAGTGGGAAGGGGGAGGAGGG + Intergenic
1160919076 19:1511591-1511613 GATGGTGGGGAGGGCGGGGAGGG - Intronic
1160951493 19:1669691-1669713 GAGAGAGGGGAGGGAGGGGAGGG - Intergenic
1160975465 19:1790384-1790406 GGGAGAGGGAAGGGAGGGGAGGG - Intronic
1160975481 19:1790417-1790439 GGGAGAGGGAAGGGAGGGGAGGG - Intronic
1161302972 19:3551815-3551837 GAGAGAGGGAAGGGCAGGGCAGG - Intronic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161403776 19:4080878-4080900 GAGAGAGGGAGGGGTGGGGAGGG + Intergenic
1161403841 19:4081041-4081063 GAGAGAGGGAGGGGTGGGGACGG + Intergenic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1161627815 19:5337399-5337421 CGGAGAGGGACGGGCAGGGACGG - Intronic
1161723788 19:5917222-5917244 CAGGGTGGGAAGGGTGTGGGTGG + Exonic
1161729676 19:5951647-5951669 CACAGCAGGAAGGGCGGGCAGGG + Intronic
1161785667 19:6324005-6324027 CAGAGTCGGAAGGGGGTGGAGGG - Intronic
1161857056 19:6772168-6772190 GGGAGTGGGGAGGGCAGGGAGGG + Intergenic
1161865935 19:6832234-6832256 CAGAGGGGCAGGGGCTGGGAAGG + Intronic
1161951489 19:7470325-7470347 AAGGGTGGGCAGGGCAGGGAGGG - Intronic
1162367212 19:10256835-10256857 CAGGGTGGAGGGGGCGGGGAGGG + Intronic
1162560652 19:11416577-11416599 CAGATAGGGGAGTGCGGGGAGGG - Intronic
1162573147 19:11483893-11483915 CAGAGTGGGCGGGGCGGGGCGGG + Intronic
1162594013 19:11613140-11613162 GAGGGGGGGAAGGGAGGGGAGGG - Intronic
1162735714 19:12745858-12745880 CAGAGTGAGAAGGGGTGGGAAGG - Intronic
1162765322 19:12915843-12915865 AAGTGTGGGCAGGGTGGGGAAGG - Intronic
1162872680 19:13598301-13598323 AAGAGAGGGAAGGGAAGGGAAGG + Intronic
1162876803 19:13626640-13626662 AAGAATGGGAAGGGAAGGGAGGG + Intergenic
1162879701 19:13648937-13648959 GAGAGAGGGAAGGAGGGGGAGGG + Intergenic
1162941580 19:14013374-14013396 CAGTGGGGGAAGGGTGGGAAGGG + Intergenic
1162948575 19:14057633-14057655 CGGAGTGGGGGGGGCGGGGCGGG + Intronic
1163051847 19:14690170-14690192 GAGGGCGGGGAGGGCGGGGAGGG + Intronic
1163258954 19:16175152-16175174 CAAAGTGAGAAGGGCATGGAGGG - Intergenic
1163407798 19:17134216-17134238 CATAGTGGGAAAGGGGAGGAAGG - Intronic
1163600907 19:18248422-18248444 TGGAGGGGGAGGGGCGGGGAGGG + Intronic
1163636205 19:18438191-18438213 CAGCGCGGGAGAGGCGGGGAAGG - Exonic
1163644930 19:18483829-18483851 CAGGGTGGGCAGGGCAGGCAGGG - Intronic
1164309731 19:24035073-24035095 AAAAGTGGGAAGGGGAGGGAGGG + Intronic
1164589992 19:29501527-29501549 CATGGTGGGAAAGGCGGGGAGGG + Intergenic
1164594798 19:29525968-29525990 GAGAGGGGGAGGGGAGGGGAAGG - Intergenic
1164758554 19:30709363-30709385 CAGAGTTGGAAGGGCTGAGCTGG - Intronic
1165091380 19:33389898-33389920 GAGAATGGGAAGGGCTGGGCCGG + Intronic
1165140199 19:33694931-33694953 CAGAAGGGGAAGGGAGGGGAGGG - Intronic
1165310126 19:35024691-35024713 CACACTGGAAAGGGCGGGGCAGG + Intronic
1165328945 19:35130824-35130846 CAGAGGGGTCAGGGCAGGGATGG - Intronic
1165342734 19:35224404-35224426 CACAGTGGGGAGGGTGGGCAAGG + Intergenic
1165396874 19:35569304-35569326 CAGAGTGGTCAGGGCTGTGATGG - Intergenic
1165792425 19:38500225-38500247 CAGAGTGGTCAGGGCTGGGATGG + Intronic
1165803644 19:38567534-38567556 CAGAGTGGTCGGGGCTGGGATGG - Intronic
1165804650 19:38572971-38572993 CAGAGGGGTCAGGGCAGGGATGG - Intronic
1165806554 19:38584344-38584366 CAGAGGGGTCAGGGCCGGGATGG - Intronic
1165806652 19:38584617-38584639 CAGAGGGGTCAGGGCTGGGATGG - Intronic
1165906203 19:39196361-39196383 CAGAGTGGGGAGGGGGAGGAGGG + Intergenic
1165999726 19:39870959-39870981 CAGAGGGGTCAGGGCCGGGATGG + Intronic
1166069039 19:40377067-40377089 CAGAGGGGTCAGGGCTGGGATGG + Intronic
1166069129 19:40377305-40377327 CAGAGGGGTCAGGGCTGGGATGG + Intronic
1166069140 19:40377340-40377362 CAGAGGGGTCAGGGCTGGGATGG + Intronic
1166069154 19:40377374-40377396 CAGAGGGGTCAGGGCTGGGATGG + Intronic
1166072956 19:40397434-40397456 CAGAGTGGGCAGTGAGGGCAAGG + Exonic
1166121613 19:40690441-40690463 CAGCGTGAGAAGGGCGGGAGAGG - Exonic
1166190429 19:41173071-41173093 CAGAGTGGTCGGGGCTGGGATGG - Intergenic
1166200139 19:41232098-41232120 CAGAGTGGCCAGGGCTGGGATGG - Intronic
1166217011 19:41342347-41342369 CAGAGTGGGGTGGGTGGGGGAGG - Intronic
1166217368 19:41344412-41344434 CAGAGTGGGTGGGACTGGGATGG - Intronic
1166299106 19:41904150-41904172 CAGTGAGCCAAGGGCGGGGAGGG + Intronic
1166305207 19:41933480-41933502 CAGAGAGGGAAAGAGGGGGAGGG + Intergenic
1166317542 19:41997557-41997579 CAGAGTGGGCGGGAGGGGGATGG - Intergenic
1166339831 19:42130957-42130979 CAGAGGGGTCAGGGCTGGGATGG - Intronic
1166339896 19:42131129-42131151 CAGAGGGGTCAGGGCTGGGATGG - Intronic
1166375416 19:42324624-42324646 CGGGGTGGGAAGGGTCGGGAAGG - Intronic
1166645788 19:44530715-44530737 CAGAGTGGGCAGGGCTGGGATGG + Intergenic
1166658020 19:44626504-44626526 CAGAGTGGGCAGGGCTGGGATGG + Intronic
1166664348 19:44669830-44669852 CAGAGTGATCAGGGCTGGGATGG - Intronic
1166765715 19:45251424-45251446 GAGAGGGGGCAGGGCGGGGGAGG - Exonic
1166795742 19:45424376-45424398 CAGAATGGGCAGGTCTGGGATGG + Intronic
1166868177 19:45853772-45853794 CAGTGTGGGCAGGGCTGGGATGG - Intronic
1166919793 19:46221397-46221419 CAGAGTGGGCAGCTCTGGGATGG + Intergenic
1166931811 19:46305531-46305553 CAGAATGGTCAGGGCTGGGATGG + Intronic
1167008789 19:46792638-46792660 CAGAGTGGGCAGGGCTGGGATGG + Intergenic
1167101111 19:47404788-47404810 CAGAACGGGCAGGGCTGGGATGG - Intronic
1167107014 19:47436279-47436301 CAGAGTAGGCAGGGCTGGGATGG - Intronic
1167417915 19:49386786-49386808 GGGAGGGGGAAGGGAGGGGAAGG + Intergenic
1167417961 19:49386897-49386919 GAGAGGGGGAGGGGAGGGGAAGG + Intergenic
1167602113 19:50460250-50460272 CACAGCTGGAAGGGCAGGGAGGG + Intronic
1167706282 19:51083017-51083039 CAGACAGGGGAGGGAGGGGATGG - Intronic
1168629728 19:57947398-57947420 TAGCGTGGGGAGGGCGGGGAAGG + Intronic
1168654441 19:58117444-58117466 CACAGTGGGTAGGAAGGGGAAGG + Intronic
1202712950 1_KI270714v1_random:27495-27517 CAGAGGGGGCCGGGCGGGTAGGG - Intergenic
925018729 2:552213-552235 CAGAGTGGAACAGGCAGGGAAGG - Intergenic
925102344 2:1258120-1258142 AGGAGTGGGAAGGGAGGGGCAGG + Intronic
925144442 2:1571567-1571589 GGGAGTGGGAAGGCAGGGGAGGG - Intergenic
925296318 2:2779886-2779908 CAGGGTGTGAAGGTAGGGGAGGG - Intergenic
925296583 2:2781149-2781171 CAGAGTGTGAAGGTGGGGGAGGG - Intergenic
925546104 2:5018388-5018410 CAGAGGGGGACAGGCTGGGAGGG + Intergenic
925610015 2:5694442-5694464 CAGAGGGGGCGGGGCGGGGGAGG + Exonic
925617385 2:5756536-5756558 CAGTGTGGGAAAGGCATGGAAGG + Intergenic
925885344 2:8390554-8390576 TAGGGTGGGAAGGGCTGGTATGG + Intergenic
926088012 2:10032288-10032310 GAGAGTGGGGAGGGCGGTGTGGG - Intergenic
926331018 2:11825262-11825284 CACAGTGGGGAGGGCTGTGAAGG + Intronic
926705738 2:15836130-15836152 CAGAGATGGAAGGGAGGGGCAGG + Intergenic
926857589 2:17273545-17273567 CAAAGTGTGAAGGGGTGGGATGG - Intergenic
927088156 2:19690470-19690492 AAAAGCAGGAAGGGCGGGGAGGG + Intergenic
927146552 2:20169935-20169957 CAAAGTGGGCAGGGCTGGGCGGG + Intergenic
927190375 2:20513091-20513113 CAGGGTGGGAGTGGTGGGGAGGG - Intergenic
927279172 2:21288532-21288554 TGGAGTGGGAGGGGAGGGGAGGG + Intergenic
927515786 2:23670874-23670896 CAGAGTGGGCAGAGAAGGGAGGG + Intronic
927573768 2:24183160-24183182 AAGAGTGGGAAGGGCAGGAGGGG - Intronic
927799312 2:26083395-26083417 CTGAGGGGGAAGGGAGGGGAGGG - Intronic
927842240 2:26453151-26453173 AAGAGTGGGAAGAAGGGGGATGG - Intronic
927843337 2:26458658-26458680 GAGAGTGGGCAGGTCGGTGAGGG - Intronic
928392839 2:30922470-30922492 GAGAGTGGGATGTGAGGGGAAGG - Intronic
928704475 2:33933288-33933310 CAGGGAGGGAGGGGAGGGGAGGG - Intergenic
929120020 2:38476801-38476823 CAGTGTGGAGAGGGAGGGGATGG - Intergenic
929426937 2:41853498-41853520 CAGAATTGGAAGGGAGGGGCTGG - Intergenic
929703717 2:44188786-44188808 GGGAGTGGGAAGGGGAGGGAAGG - Intronic
929962124 2:46504805-46504827 GAGAGAGGGAAGGAGGGGGAGGG - Intronic
930140348 2:47945163-47945185 CAGAGTAGGAAGGGTGTGGAAGG - Intergenic
931770484 2:65492923-65492945 CACAGTGGAAAGGGCAGAGAAGG - Intergenic
932182644 2:69662433-69662455 CTGAGTGGGGAGGGGTGGGAGGG + Intronic
932190545 2:69738510-69738532 CTGAGTGGGGAGGGGTGGGAGGG - Intronic
932400260 2:71475602-71475624 CAGAGTGGGCACAGAGGGGAGGG + Intronic
932406023 2:71513127-71513149 CAGGCTGGGGTGGGCGGGGAAGG + Intronic
932447660 2:71790725-71790747 CAGCCTGAGAAGGACGGGGAGGG + Intergenic
932703860 2:74008749-74008771 GAGAGTAGGAAGGGAGGGGTGGG + Intronic
933648418 2:84830525-84830547 CAGAGGGAGAAGGGCCTGGAAGG + Intronic
933832379 2:86221544-86221566 CAGAGTGGGGAGGCCAGGGAGGG - Intronic
933972619 2:87482376-87482398 GAGAGAGAGAAGGGCGAGGAGGG - Intergenic
933993937 2:87654124-87654146 CAGGGTGAGAGGGGCAGGGAAGG - Intergenic
934712962 2:96527647-96527669 GGGAGGGGGGAGGGCGGGGAGGG - Intergenic
935111035 2:100094548-100094570 CAGAGTGGGAGGTGAGTGGATGG - Intronic
935270863 2:101433058-101433080 CAGATGGGGAAGACCGGGGAGGG + Intronic
935281166 2:101519036-101519058 CAGGGAGGGGAGGGAGGGGAGGG - Intergenic
935592168 2:104853854-104853876 CGGCGGGGGAGGGGCGGGGAGGG + Intergenic
935671361 2:105559754-105559776 CAGTGAGGGAAGAGAGGGGAGGG - Intergenic
935928855 2:108101428-108101450 TACAGTGGGGAGGGTGGGGAGGG - Intergenic
936040663 2:109146839-109146861 AAGAGAGGGAGGGGAGGGGAGGG - Intronic
936123942 2:109770614-109770636 CAGAGTGGGAGGTGAGTGGAGGG + Intergenic
936220747 2:110600850-110600872 CAGAGTGGGAGGTGAGTGGAGGG - Intergenic
936299928 2:111296790-111296812 CAGGGTGAGAGGGGCAGGGAAGG + Intergenic
936321111 2:111467804-111467826 GAGAGAGAGAAGGGCGAGGAGGG + Intergenic
936351690 2:111717438-111717460 CAGCGTGAGGAGGCCGGGGAAGG + Intergenic
936600599 2:113890579-113890601 TAGTGGGGGAAGGGCCGGGAGGG - Intronic
937005046 2:118503785-118503807 TAGAGTGGGAAGAGGGAGGAAGG + Intergenic
937037987 2:118797641-118797663 CAGAGTGGAAGTGGTGGGGATGG + Intergenic
937039217 2:118807998-118808020 CAGAGTGGGCAGGAGGGAGAGGG + Intergenic
937295570 2:120807902-120807924 CTGGGTGGGCAGGGTGGGGAGGG + Intronic
937897084 2:126985600-126985622 CAGAGCGGGGAGGGAGGGAAGGG - Intergenic
937988386 2:127648939-127648961 AAGAGAGGGAGGGGAGGGGAGGG + Intronic
939230159 2:139414038-139414060 AAGTGTGGGAAGGGGGGTGAGGG - Intergenic
939992359 2:148887807-148887829 TAGCGTGGGGAGGGCGGGAAGGG - Intronic
940669348 2:156648834-156648856 AGGAGTGGGAGGGGAGGGGAGGG - Intergenic
941625642 2:167827580-167827602 CAGAGAGGGAAGGGGTGGGGTGG - Intergenic
941830780 2:169956431-169956453 CAGAAAGGGAAGAGAGGGGATGG + Intronic
941862027 2:170292707-170292729 CAGTGTGGGAAGGCTGGGTAGGG + Intronic
941905705 2:170715369-170715391 GCGAGGGGCAAGGGCGGGGAGGG + Exonic
941927224 2:170908294-170908316 GAGTGGGGGAAGAGCGGGGAGGG + Intergenic
942482297 2:176402818-176402840 AAGAAAGGGAAGGGCAGGGAAGG - Intergenic
942806641 2:179938709-179938731 TAGAGAGGGGAGGGAGGGGATGG + Intergenic
943405733 2:187481643-187481665 AAGGGAGGGAAGGGAGGGGAGGG + Intronic
943622813 2:190168415-190168437 CAGAGTGGGGAGGGCGGTGGGGG - Intronic
944075956 2:195731022-195731044 CAGAGTTGGAAGGCAGGGCAAGG - Intronic
944142787 2:196475394-196475416 AAGAGAGTGAAGGGAGGGGAGGG + Intronic
944949120 2:204726997-204727019 CAGAACGTGCAGGGCGGGGAAGG - Intronic
945238343 2:207653559-207653581 GAGAATGGGAGGGGAGGGGAGGG + Intergenic
945533966 2:210989014-210989036 CAGAGTTGGAAGAGTGTGGAGGG + Intergenic
946029496 2:216693429-216693451 GAGATTGGGGAGGGCGGGGTGGG + Intronic
946040744 2:216781169-216781191 AAGAGAGGGAGGGGAGGGGAGGG - Intergenic
946140318 2:217684784-217684806 CAGAGAGGGGAGGAAGGGGAAGG + Intronic
946147716 2:217743500-217743522 GAGAGTGGGAGAGACGGGGAGGG + Intronic
946173092 2:217906957-217906979 CAGAGAGGGAGGGGCAGGGTGGG - Intronic
946230329 2:218287300-218287322 GAGAGTGGGCGGGGCTGGGAAGG - Intronic
946456641 2:219832014-219832036 CAGAGTGTGAAGGGGCAGGAAGG + Intergenic
947181321 2:227413821-227413843 AAGGGTGGGAAGGGAGGGAATGG + Intergenic
947567213 2:231201919-231201941 GAGAGTGGGAACGGAAGGGAGGG - Intronic
947831412 2:233144328-233144350 AAGAGTGGGAGGGGTGGAGATGG + Intronic
947988123 2:234466012-234466034 CAGGGTGGGAATGGTGGGGAGGG + Intergenic
948117701 2:235505783-235505805 CAGCCTGGGAAGAGCGGGGTAGG + Intronic
948152398 2:235754783-235754805 CAGATTGGGAAGCGCAGGCAGGG + Intronic
948260361 2:236599989-236600011 CAGGGTGGGGAGTGAGGGGAGGG - Intergenic
948283770 2:236768807-236768829 CACAGAAGGAAGGGCTGGGATGG - Intergenic
948344376 2:237282780-237282802 AAGGGTGGGAAGGGAAGGGAGGG + Intergenic
948368448 2:237473403-237473425 CAGGGTGGCAAAGGCGGGCAAGG - Intergenic
948456618 2:238107433-238107455 AAGGGAGGGAGGGGCGGGGAGGG - Intronic
948615174 2:239193732-239193754 CAAAGTGGGGAAGGCGGGGCAGG + Intronic
948676571 2:239600511-239600533 CAGAGTGGGAAGGGGGCTGAGGG + Intergenic
948684267 2:239660184-239660206 CTGCGTGGGAGGGGCGGGGGAGG - Intergenic
948721887 2:239905824-239905846 CAGACTGGGAGGGGAGGGGAGGG + Intronic
948790935 2:240376497-240376519 CAGCCTGGGAAGGGAGGGGAAGG + Intergenic
948858796 2:240743073-240743095 GAGGGTGGGAGGGGCCGGGATGG - Intronic
948927484 2:241108578-241108600 CAGAGGGGGGAGCGGGGGGAGGG + Intronic
948936289 2:241167022-241167044 CTGAGTGAGAAGGGCCGGGGAGG - Intronic
949048687 2:241885234-241885256 CAGAGTGGGAGGGGGAGGGTGGG + Intergenic
1168771782 20:420633-420655 CAGGTTGGGAGGGGCGGGGCTGG - Intronic
1168886847 20:1266270-1266292 CCGGGAGGGAGGGGCGGGGAGGG - Intronic
1168895433 20:1320439-1320461 CAGAGTGCAGAGGGTGGGGAAGG + Intronic
1168952188 20:1810163-1810185 CTGAGTGAGAAGGGCAGTGATGG - Intergenic
1169164198 20:3407974-3407996 CAGAGGCGGAGGGGCGGGGCCGG - Intergenic
1169469467 20:5871709-5871731 AAGAGAGGGAAGGGAGGGGAGGG + Intergenic
1169554669 20:6736447-6736469 CTAAGTGGGAAGGGTGGGGGTGG + Intergenic
1170458621 20:16556045-16556067 CAGTGTTGGAAGGGGGAGGATGG - Intronic
1170742122 20:19067258-19067280 CTGAGTGAGAAGAGCAGGGAAGG + Intergenic
1170756782 20:19212436-19212458 CAGAGGAGGAGGAGCGGGGAAGG - Intergenic
1171197843 20:23215226-23215248 CAGGGTAGGAAGGGATGGGAGGG - Intergenic
1171486469 20:25489803-25489825 CAGAGTGGGGGTGGCGGGGGTGG - Intronic
1171955290 20:31457338-31457360 GAAAGTGGGAGGGGAGGGGAGGG - Intergenic
1172021736 20:31919663-31919685 GAGAGAGGGAAGGGAGGGGAAGG - Intronic
1172031382 20:31984477-31984499 CAGAGTTGGATGGGTGGGGAGGG + Intronic
1172034231 20:32000394-32000416 CAGGGTGGGAAGGACAGGGAAGG - Exonic
1172149474 20:32780051-32780073 CAGAGTGGGGAGGCCAGGGCTGG - Intronic
1172288648 20:33759016-33759038 GAGACTGGGAAGGTCAGGGATGG + Intronic
1172662060 20:36574487-36574509 CGGAGGGGGAGGGGAGGGGAAGG - Intronic
1172775025 20:37402323-37402345 AAGTGTGGGGAGGGTGGGGAAGG + Intronic
1172945542 20:38685431-38685453 CTGAGTGGGAAGAGAGGGGTAGG + Intergenic
1173567952 20:44055328-44055350 GAGAGTGGAAAGAGCAGGGACGG + Intronic
1174048020 20:47747724-47747746 CAGATTGGGAGAGGTGGGGAAGG - Intronic
1174118222 20:48242592-48242614 CAGATTGGGAGAGGTGGGGAAGG - Intergenic
1174271042 20:49368769-49368791 CAGAGTGGGCAGGAGGGAGAAGG - Exonic
1175198234 20:57260949-57260971 CAGATGGGGAAGGGTGGAGACGG + Intronic
1175206836 20:57317604-57317626 AAGAGGGCGAAGGGCAGGGATGG + Intergenic
1175265855 20:57703219-57703241 CAGCGGGGGAGGGCCGGGGAGGG - Intronic
1175279590 20:57794168-57794190 GAGAGTGAGGAGGGTGGGGATGG + Intergenic
1175392635 20:58636730-58636752 GGGAGTGGGAAGAGCAGGGAGGG - Intergenic
1175667169 20:60870675-60870697 GAGAGTGGGGAGGGAGGGCAGGG - Intergenic
1175742342 20:61428640-61428662 CAGAGTGGAAGGTGCCGGGATGG + Intronic
1175748079 20:61475524-61475546 GAGAGAGGGAGGGGCGGGCAGGG - Intronic
1175748100 20:61475577-61475599 GAGAGAGGGAGGGGCGGGCAGGG - Intronic
1175909916 20:62400260-62400282 CACAGTGGGGTGGGTGGGGAAGG + Intronic
1176302310 21:5104510-5104532 CAGAGAGGGAGGGGCAGGGCAGG - Intergenic
1177012465 21:15745040-15745062 AGGAGTGGGAAGGGAGGGGAAGG - Intronic
1177497171 21:21903894-21903916 GAGGGAGGGAAGGGAGGGGAGGG + Intergenic
1177567106 21:22838175-22838197 CAGAGGGGGAAGGGAAGGAAGGG + Intergenic
1177729286 21:25007315-25007337 GAGAAGGGGAAGGGAGGGGAAGG + Intergenic
1178239701 21:30884968-30884990 CAGAGCGTGAAGTGAGGGGATGG + Intergenic
1178951188 21:36987149-36987171 CATTGTGGGAAGGGGAGGGAAGG - Intronic
1178978990 21:37245159-37245181 GAGAGTGGGAAGGGAAAGGAAGG + Intronic
1179077416 21:38135997-38136019 CATAGTGGGTAGGGAGGAGAGGG + Intronic
1179172668 21:38984669-38984691 CACAGTTGGGAGGGCGGGGTGGG + Intergenic
1179323737 21:40318934-40318956 CTGGGTGGGAAGGACAGGGAAGG + Intronic
1179358322 21:40682662-40682684 CGGAGGGGGAGGGGAGGGGAGGG + Intronic
1179654672 21:42837778-42837800 CAGAGGGCGGAGGGTGGGGAGGG - Intergenic
1179791352 21:43757615-43757637 CAGAGTGGGAGAGTGGGGGAGGG - Exonic
1179854717 21:44157413-44157435 CAGAGAGGGAGGGGCAGGGCAGG + Intergenic
1179875121 21:44263142-44263164 CAGTGTGGGAGGTGCGGGGTGGG + Intergenic
1180321729 22:11328044-11328066 GAGACTGGGAAGGGCAGGGAGGG - Intergenic
1180542126 22:16459084-16459106 GAGAGGGGGAAGGGAAGGGAAGG + Intergenic
1181169083 22:20998265-20998287 CACATTGGGAAGGGCTGTGAAGG + Exonic
1181277152 22:21694427-21694449 GGGAGTGGCAAGGGCGGGGTCGG - Intronic
1181412441 22:22733927-22733949 ATGAGTGGGAAGGGCGGGATTGG + Intergenic
1181526832 22:23494448-23494470 CAGAGTGCGTAGGGCGTGCAGGG - Intergenic
1181546236 22:23604114-23604136 CAGAGTTGGATGGGTGGGCAGGG - Intergenic
1181642964 22:24214424-24214446 CAGGGTGGGATGAGCAGGGAGGG + Intergenic
1181729914 22:24837581-24837603 CAGACTGGGAAAGGGGGGGGGGG - Intronic
1181999124 22:26905713-26905735 CAGAGAGAGAAGAGAGGGGAGGG + Intergenic
1182354970 22:29718846-29718868 CAGCTTGGGAAGGGCAGGGCAGG + Intergenic
1182369128 22:29798720-29798742 CAGAGTGGGAGGTGCTGGGGTGG - Intronic
1182587318 22:31351972-31351994 CAGATAGGGAAGGGAGAGGAAGG + Intergenic
1183168640 22:36167130-36167152 AAGAGTGGGAAGGAGGAGGAGGG + Intergenic
1183305958 22:37083356-37083378 TAGAGTGGGGAGGGTGGGCAAGG - Intronic
1183647413 22:39134580-39134602 CGGAGCGGGAAGGGCAGGGTGGG + Exonic
1183807152 22:40221074-40221096 CAGAGTTGGGAGGGAGGGGCAGG - Intronic
1183893708 22:40951167-40951189 CGGAGTGGGTGGGGCGGGGCCGG - Intergenic
1184206792 22:43009664-43009686 CAGAGGGGGAGGAGCGTGGATGG - Intronic
1184260393 22:43312031-43312053 AAGGGTGGGAAAGGCAGGGAGGG + Intronic
1184260814 22:43314738-43314760 GAGGGTGGGAAGGGCAGGGAGGG + Intronic
1184327476 22:43800178-43800200 CAGCGTGGGAAGGTTGGGTAGGG - Intronic
1184335955 22:43853417-43853439 CAGAGTGGGCAGGGGTGGGGTGG - Intronic
1184420772 22:44381758-44381780 CAGTGTGGGGAGGAAGGGGAAGG + Intergenic
1184481931 22:44752924-44752946 GAGAGAGGCGAGGGCGGGGAAGG - Intronic
1184567610 22:45301558-45301580 CAGGGTGGGCAGGGGTGGGATGG - Intergenic
1184792242 22:46707412-46707434 CTGAGTGGGAAAGGTGGGGGCGG - Intronic
1184859939 22:47167803-47167825 GAGAGTGGGTAAGACGGGGATGG + Intronic
1185002846 22:48256782-48256804 CACAGTGGGAGGGGAGGGGTGGG + Intergenic
1185110176 22:48896325-48896347 CAGAGTGGGGATGGGGCGGAGGG + Intergenic
1185123914 22:48993364-48993386 CAGAGTGTGCAAGGCGGGGGTGG - Intergenic
1185217209 22:49608223-49608245 AGGAGTGGGAAGGCCGGGGCTGG + Intronic
949105738 3:197972-197994 GAGAGTGGGAACGGAGGGGCTGG - Intronic
949334333 3:2957588-2957610 TAGAGTGGGGAAGGTGGGGAGGG - Intronic
949869013 3:8571083-8571105 GAGAGTGGGAGGGGTGGGGATGG - Intergenic
949952573 3:9241425-9241447 CAGACTGGGAGGGGCCTGGAAGG + Intronic
950425657 3:12923607-12923629 CAGAGTGGGAGGGGCTGGCCTGG - Intronic
950686297 3:14620836-14620858 GAGAGTAGGCAGGGAGGGGAAGG + Intergenic
951390397 3:22096154-22096176 TAGAGGGGGAAGGGAGGGCAGGG + Intronic
951583096 3:24186325-24186347 CAGACTGGGAAGGGAGGAGGAGG + Intronic
952141584 3:30484974-30484996 TAGAGTGGGAAGGGAGGGAGGGG + Intergenic
953098150 3:39799112-39799134 GAGGGTGGGGAGGGTGGGGAGGG - Intergenic
953123644 3:40070700-40070722 CAGGGTGGTAAGGGGGTGGATGG - Intronic
953391480 3:42536311-42536333 GTGAGTGGGAAGGGGCGGGAGGG - Exonic
953469600 3:43155556-43155578 CAGAGTGTGAGGTGCTGGGATGG + Intergenic
953699013 3:45181707-45181729 CACAGTGGGGATGGCGGGGTGGG + Intergenic
954069900 3:48135324-48135346 CAGAGTGGGAAGGGGTGGGTTGG - Intergenic
954361583 3:50125324-50125346 CAGAGTGGGAGGTCCGTGGAAGG + Intergenic
954454923 3:50592656-50592678 CAGAGTCTGAAGGGCTGGGCTGG - Intergenic
955589223 3:60516011-60516033 TATAGTGGGGAAGGCGGGGAAGG + Intronic
955896047 3:63701068-63701090 TAGAGGGGGAAGGGAGGGAAGGG + Intergenic
956854441 3:73262172-73262194 GAGTGTGGGGAGGGCAGGGAAGG - Intergenic
958159666 3:89801504-89801526 CAGAGATGGAAAGGCGGGGTGGG + Intergenic
958904986 3:99932174-99932196 TGGAGTGGGAAGGGAGGAGAAGG - Intronic
959106355 3:102069330-102069352 CAGAGTGGTAAGGGCTGTGGTGG + Intergenic
959787378 3:110316767-110316789 CTGAGGGGGAGGGGAGGGGAGGG + Intergenic
959904931 3:111700826-111700848 CAGACTGTGTAGGGCGGGGCGGG + Intronic
961495523 3:127288418-127288440 CTGGCTGGGAAGGGCAGGGAGGG + Intergenic
963839801 3:150093711-150093733 AAGAGTGGGTGGGGCGGGGGTGG - Intergenic
964002830 3:151796184-151796206 GAGAGGGGGAGGGGAGGGGAGGG + Intergenic
964162354 3:153660513-153660535 CAGGGAGGGAAGGGGGAGGATGG - Intergenic
965120309 3:164546113-164546135 CAGAGTGGGGAGGGTGAGAAGGG + Intergenic
965722603 3:171678069-171678091 CAGAGTGGGAAGGGCGGGGAGGG + Intronic
965971177 3:174558338-174558360 CAGACTGGGTACGGGGGGGATGG + Intronic
966179245 3:177172655-177172677 GAGAGAGAGAAGGGAGGGGAGGG + Intronic
966244102 3:177786701-177786723 CAGAGTGGTAAGTGCTGTGATGG - Intergenic
966340539 3:178920849-178920871 GAGAGTGGCAAGGGGGGTGAGGG + Intergenic
966461475 3:180181650-180181672 GAGGGAGGGAAGGGAGGGGAAGG - Intergenic
966474951 3:180333892-180333914 CAGAGTGGGAAGGTAAGGGGAGG + Intergenic
966483088 3:180433392-180433414 CAGAATGTGAAGGGAGGGGAAGG - Intergenic
966774715 3:183533772-183533794 CAGAGGGGGAAGGACGGAGGCGG - Intronic
966822515 3:183936258-183936280 GAGGCTGGGAAGGCCGGGGATGG - Intronic
966864300 3:184248713-184248735 CCGAGGGGGAGGGGAGGGGAGGG - Intronic
967229173 3:187321306-187321328 CAGAGTGAAAAAGGCAGGGACGG + Intergenic
967390191 3:188947771-188947793 CTGGCTGGGAAGGGCTGGGAAGG - Intronic
967830347 3:193913198-193913220 CATAATGGGAAGGGGGTGGAGGG + Intergenic
967877223 3:194275695-194275717 CAGAGTGGCAGGGGTGGGGTGGG + Intergenic
967994500 3:195156391-195156413 GAGAGGGTGAAGGGTGGGGAGGG + Intronic
968440774 4:623503-623525 GAGAGTGGGTGGGACGGGGAAGG - Intergenic
968487858 4:872563-872585 CACAGTGGGAGGGGCACGGAGGG + Intronic
968555729 4:1245630-1245652 CAGAGTGGCATGGACGGGCAGGG + Intronic
968584332 4:1409146-1409168 CAGAGAGGGGAGGGGAGGGAAGG - Intergenic
968659613 4:1793640-1793662 CAGGGAGGGAAGGGGGAGGAGGG + Intronic
968717743 4:2174254-2174276 CAGTGTGGGAAGGGCCAGGCTGG - Intronic
968809712 4:2794354-2794376 CAGAGTGGGAAGAACCAGGAGGG - Intronic
968961393 4:3746022-3746044 GAGTGGGGGAGGGGCGGGGAGGG + Intergenic
968962219 4:3751454-3751476 CCTAGTGGGCAGGGCGGGGCAGG - Intergenic
969122403 4:4919895-4919917 CAGAGTGGGAAGCTCTTGGAGGG + Intergenic
969342193 4:6549267-6549289 GAGAGTGGGAAGGGTGGGGGTGG - Intronic
969354309 4:6616319-6616341 CTGAGTGGGAAGATCAGGGATGG + Intronic
969370431 4:6727868-6727890 GAGAGGGGGAGGGGAGGGGAGGG - Intergenic
969591238 4:8122995-8123017 CAGAGTGGGAACGCCAGGGGAGG - Intronic
969591809 4:8126424-8126446 GGGAGAGGGAAGGGAGGGGAGGG - Intronic
969663777 4:8545370-8545392 CATGGTGGGCAGGCCGGGGAGGG - Intergenic
969694315 4:8726056-8726078 GAGACTTTGAAGGGCGGGGAAGG - Intergenic
970502729 4:16694590-16694612 AAGATTTGGAAGGGCTGGGAGGG - Intronic
970503476 4:16702836-16702858 CAGAGTGGGAAGGATAGGGCTGG - Intronic
970929851 4:21496883-21496905 CAGACAGAGCAGGGCGGGGATGG - Intronic
971328949 4:25666327-25666349 GAGGGTGGGAAGGACGGGGGAGG + Intronic
971330639 4:25678439-25678461 CAGAGTGGGCGGGGCAGGCATGG - Exonic
971345287 4:25806424-25806446 CAATGTGGGAAGGCTGGGGATGG + Intronic
971377788 4:26069113-26069135 CTGATTGGGAACGGAGGGGAGGG - Intergenic
971509425 4:27405772-27405794 CAGAAAGGGCAGGGTGGGGATGG - Intergenic
971715968 4:30177748-30177770 CAGAATGGGAAGGTAGGGGTGGG + Intergenic
972694040 4:41427217-41427239 GAGAGAGGGAAGGGGTGGGAAGG - Intronic
972935636 4:44131684-44131706 CAGAGTTGGCGGGGCGGGGTTGG - Intergenic
973153763 4:46922374-46922396 CAGTGTGGGAAGTGGTGGGAGGG - Exonic
973613682 4:52659309-52659331 CGGCGCGGGGAGGGCGGGGAGGG + Exonic
974833421 4:67216477-67216499 AAGGGAGGGAAGGGAGGGGAAGG + Intergenic
975089252 4:70381445-70381467 GAGAGAGGGGAGGGAGGGGAGGG + Intronic
975156732 4:71080577-71080599 CAAAGTGAGAAAGGCAGGGATGG - Intergenic
975185665 4:71399467-71399489 GAGAGGGGGAGGGGAGGGGAGGG - Intronic
975385263 4:73750791-73750813 CAGAGTTGGGAGGCCAGGGAGGG + Intergenic
975756960 4:77580714-77580736 GAGAGGGGGAGGGGAGGGGAGGG - Intronic
976246488 4:83010846-83010868 CCGGGTGGGGCGGGCGGGGAGGG - Intronic
976695810 4:87918756-87918778 AAGAGAGGGAAGGGAAGGGAAGG + Intergenic
977190965 4:94000302-94000324 AAGAGAGGGAAGGGAGGGGAGGG + Intergenic
977600762 4:98931419-98931441 GAGAATGGGAGGGGAGGGGAGGG - Intergenic
977642800 4:99376256-99376278 CAGGGTGGGAGGGGCAGGGAGGG - Intergenic
977947599 4:102931290-102931312 GAGAGGGGGAAGGGAAGGGAAGG + Intronic
979700244 4:123658744-123658766 CAGAGGGGGAAGGATGAGGAGGG + Intergenic
980784756 4:137537836-137537858 TGGGGTGGGAAGAGCGGGGAGGG - Intergenic
981012399 4:139938987-139939009 CACAGTGCGCAGAGCGGGGAAGG - Intronic
981251398 4:142606241-142606263 GAGACTGGGAAGGGTGGGGAAGG + Intronic
981503866 4:145479607-145479629 CAGAGTGCTAAAGGAGGGGAAGG + Intergenic
981990055 4:150907331-150907353 CAGAGAGGGGAGGAAGGGGAAGG + Intronic
982331191 4:154183836-154183858 GAGAGTGGGAAGCGCTGAGAAGG + Intergenic
982531410 4:156549158-156549180 AAGAGTGGGAAGGGAAGTGAGGG - Intergenic
983320412 4:166189882-166189904 GAGAGTGGGTAAGGCAGGGATGG + Intergenic
984307222 4:178008963-178008985 TAGAGTGGGGAGGGAGGGAAGGG + Intergenic
984526631 4:180866243-180866265 CAGAGTGGCAAGGGGGTGGCGGG + Intergenic
984911337 4:184676689-184676711 GAGAAAGGGAAGGGGGGGGACGG - Intronic
985126873 4:186703172-186703194 CAGAGTGGGGATGGCGGGCGTGG - Intronic
985678441 5:1244040-1244062 GAGACTGGGGAGGGCAGGGATGG + Intronic
985706304 5:1403313-1403335 CAGGATGGGATGGGAGGGGAGGG - Intronic
985706327 5:1403378-1403400 CAGGATGGGAGGGGAGGGGAGGG - Intronic
985706344 5:1403418-1403440 CAGGATGGGATGGGAGGGGAAGG - Intronic
985725812 5:1515306-1515328 CGGAGTAGGAAGGGCCGGGCAGG - Intronic
985937605 5:3108719-3108741 CAGTGTGGGTAGGGCAGAGACGG - Intergenic
985995043 5:3593098-3593120 GAGAGGGGGAGGGGCGGAGAAGG - Intergenic
986240454 5:5955222-5955244 CAGTGAGGGAAGGGCAGGGAGGG - Intergenic
987101444 5:14594657-14594679 CAGACAGGGACGGGCTGGGAAGG - Intronic
987663170 5:20904135-20904157 GAGAGAGAGAAGGGCGGGGGAGG + Intergenic
987711509 5:21505833-21505855 AAGATTGGGTGGGGCGGGGAGGG - Intergenic
988302896 5:29454961-29454983 AAGATTGGGCGGGGCGGGGAGGG + Intergenic
988683220 5:33503221-33503243 CAGAGGAGGAAGGGAAGGGAGGG - Intergenic
988759516 5:34298050-34298072 GAGAGAGAGAAGGGCGGGGCAGG - Intergenic
989645615 5:43629145-43629167 AAGAGTGGGAGGGGGGGTGAGGG - Intronic
989659548 5:43785503-43785525 CAGGGCTGGAAGGGCTGGGAGGG - Intergenic
990589666 5:57249793-57249815 GGGAGGGGGAAGGACGGGGAGGG - Intronic
991194534 5:63917165-63917187 GAGAGTAGGAAGGGGGAGGATGG - Intergenic
991371809 5:65926418-65926440 GAGAGGGGGAGGGGAGGGGACGG - Intergenic
991481949 5:67090355-67090377 CAGAAGGGGAAGTGGGGGGAAGG - Intronic
991646674 5:68807976-68807998 GGGAGTGGGAAGGGAAGGGAGGG + Intergenic
991761872 5:69924951-69924973 AAGACTGGGTAGGGCGGGGAGGG - Intergenic
991785457 5:70193149-70193171 AAGACTGGGTAGGGCGGGGAGGG + Intergenic
991841100 5:70800000-70800022 AAGACTGGGTAGGGCGGGGAGGG - Intergenic
991877902 5:71193539-71193561 AAGACTGGGTGGGGCGGGGAGGG + Intergenic
991997218 5:72400099-72400121 GAGAAGGGGAAGGGCGGGGTAGG - Intergenic
992396606 5:76374535-76374557 CAAAGTTGGAAGGGCTGGCAGGG - Intergenic
992458300 5:76937071-76937093 CTGAGTGGAAAGGTCAGGGAGGG - Intergenic
993152558 5:84179622-84179644 CATAGTAGGAAGAGTGGGGAAGG - Intronic
993397217 5:87405186-87405208 CTGAGTAGGAAGGGGAGGGAAGG + Intronic
993919289 5:93780541-93780563 AAGAGAGGGAGGGGAGGGGAGGG - Intronic
994497865 5:100535816-100535838 CACGGAGGGAAGGCCGGGGAAGG + Exonic
994653687 5:102562228-102562250 CAGAGTGGGAAGGCTGGCTAGGG - Intergenic
995492558 5:112708012-112708034 CTGAATGGGGAGTGCGGGGAGGG - Intronic
995749561 5:115440054-115440076 CAGAGGGAGAAGGGTGGAGAAGG - Intergenic
995753656 5:115478942-115478964 AAGAGTGGGAGGGGAGGTGAGGG - Intergenic
996363968 5:122680346-122680368 GAGAGAGGGACGGGTGGGGATGG - Intergenic
996436176 5:123434949-123434971 GAGAGAGGGAAGGGAGGGGGAGG + Intergenic
996651927 5:125888662-125888684 AAGAGAGGGAGGGGTGGGGAGGG - Intergenic
997259140 5:132452350-132452372 GGGAGTGAGAAAGGCGGGGAAGG - Intronic
997450691 5:133980686-133980708 CAGGGTGGGAGGGGTGGGGTTGG - Intronic
997473194 5:134128166-134128188 AGGAGTGGGAAGGGATGGGACGG - Intronic
997530767 5:134579948-134579970 CAGAGCAGCAAGGGAGGGGAGGG - Exonic
997582948 5:135028625-135028647 CGGAGTGGGAAGTGGGAGGAGGG + Exonic
997739889 5:136244141-136244163 GAGGGAGGGAAGGGAGGGGAGGG - Intronic
997935107 5:138103526-138103548 CAGAGTGTGAAGGACAGGGCAGG + Intergenic
998130396 5:139648776-139648798 CCGAGGGGGAGGGGCGGGGCAGG - Exonic
998157645 5:139795740-139795762 AGGAGCGGGAAGGGCGGGGAAGG - Intergenic
998232960 5:140373142-140373164 AAGAGTGGGAAGGAAGAGGAAGG + Intronic
998350306 5:141496112-141496134 CAGTGTGTGAGGGGCAGGGAAGG - Intronic
998852619 5:146365196-146365218 CAGAGTGGGAAGGGGAGGTGAGG - Intergenic
999108993 5:149099596-149099618 CACAGTGGGAAGAGCGGGGGTGG + Intergenic
999363817 5:151008192-151008214 CAGGGTGGAAAGGGCTGGAAAGG - Intergenic
999686947 5:154111710-154111732 GTGAGTGAGAAGGGTGGGGAAGG - Intronic
1000033208 5:157420784-157420806 AAGAGTGGGAAGGGCAGGAGGGG + Intronic
1000203281 5:159032891-159032913 CACAGAGAGAAGGGAGGGGAAGG + Intronic
1000345639 5:160311829-160311851 GAGAGTGACAAGGGCAGGGAGGG + Intronic
1000491418 5:161918874-161918896 CAGAGGGGGAAGGGTGGAAAGGG + Intergenic
1000663879 5:163970776-163970798 TCGAGTGGGGAGAGCGGGGAGGG - Intergenic
1001442055 5:171750734-171750756 CAGAGGGGGTAGGGCAGGGAAGG - Intergenic
1001910372 5:175512409-175512431 CAGACTGAGGAGTGCGGGGAGGG + Intronic
1002276466 5:178107244-178107266 GAGAGTGGGGAGGGCTGGGGAGG + Intergenic
1002338325 5:178495659-178495681 GAGAGTGGGAAGGGGGAGGAAGG + Intronic
1002400511 5:178989221-178989243 GAGGGTGGGGAGGGTGGGGAGGG - Intronic
1002400516 5:178989230-178989252 CAGGGTGGTGAGGGTGGGGAGGG - Intronic
1002468961 5:179423252-179423274 CAGAGTGGCCAGGTCGGTGAAGG + Intergenic
1002791466 6:440773-440795 CAGGGTAGGAAGGGATGGGATGG - Intergenic
1002893212 6:1355804-1355826 AAGAGAGGGAAGGGAGGGGAGGG + Intergenic
1003859020 6:10304852-10304874 AAGAATAGGAAGGGCGGGCATGG - Intergenic
1004294264 6:14395714-14395736 CATAGTGGGTAGGGAGGAGAAGG - Intergenic
1004504664 6:16238413-16238435 CTGAGGGGGAAGGACGGGGGCGG + Intergenic
1005447825 6:25943003-25943025 CTGAGTGGAAAGGGCAGGGGTGG - Intergenic
1005512108 6:26520828-26520850 GGGCGTGGGAGGGGCGGGGAGGG - Intergenic
1005800845 6:29422086-29422108 TAGAGTGGGAGGGGGGGTGAAGG + Intronic
1005825238 6:29628172-29628194 GACAGTCGGAGGGGCGGGGAGGG + Intronic
1006118814 6:31791823-31791845 CAGAGTGGGTGGGGTGGGGAAGG - Intronic
1006415422 6:33900847-33900869 CAGAGTTGGAAGGGGCGGGCAGG + Intergenic
1006774287 6:36580023-36580045 CTGAGTGGGAAGGGAGGGTGGGG + Intergenic
1006969885 6:38031830-38031852 CAGCGTGGGGCGGGGGGGGAGGG - Intronic
1007519266 6:42438910-42438932 CAGGATGGGAGGGGAGGGGAAGG + Intronic
1007553541 6:42747316-42747338 TAGGGTTGGAAGGGCGGGCAGGG - Intronic
1007597402 6:43059973-43059995 GAGAGTGAGATGGGCGGGGGCGG - Exonic
1007849773 6:44791947-44791969 CAGAGTGGGTAGAGCAGGGAGGG - Intergenic
1008534205 6:52494689-52494711 CAGAGTGGGAAGGGAAGGAGGGG - Exonic
1008629929 6:53353883-53353905 CAGAGTGTGAAAGGCAGGGAGGG - Intergenic
1009271369 6:61619253-61619275 CAGAAGGGGGAGGGTGGGGAGGG - Intergenic
1009357145 6:62764837-62764859 CAAAGTGGGCCGGGCGGGGAAGG + Intergenic
1010048065 6:71470520-71470542 GAGACTAGGAAGGGTGGGGAGGG - Intergenic
1010678329 6:78769798-78769820 CAGAGGGGGAAAGGTAGGGATGG + Intergenic
1011106625 6:83788888-83788910 CAGAGAATGAAGGGTGGGGAAGG - Intergenic
1011981713 6:93386863-93386885 CACAGATGGAAGGGCTGGGATGG + Intronic
1012014892 6:93837659-93837681 CAGAGGGTGAAGGGTGGTGAAGG + Intergenic
1013273044 6:108560306-108560328 CCGACTGGGAAGGGGGCGGAGGG + Intronic
1013474917 6:110498170-110498192 GAGAGTGGGGAGGGAGGGAAAGG - Intergenic
1013598131 6:111679552-111679574 CAAAAAGGGAAGGGCTGGGAGGG - Intronic
1013659440 6:112279847-112279869 CAGGGTGGGATGGGCAGGGAAGG + Intergenic
1014069282 6:117162279-117162301 CAGAGTGGGCAGCGTGGAGACGG - Intergenic
1015325502 6:131918937-131918959 CAGTGTGGGGAGGGGGTGGATGG - Intergenic
1015622030 6:135141406-135141428 CAGAAAGGGAAGGGAAGGGAAGG + Intergenic
1016303780 6:142661062-142661084 GGGGGCGGGAAGGGCGGGGATGG - Intergenic
1016373549 6:143398022-143398044 CAGAGTTGGAAGGGCTGTGGAGG - Intergenic
1017259663 6:152371661-152371683 CAGAGAGAGAGGGGAGGGGAAGG + Intronic
1017286383 6:152681203-152681225 AAGAGAGAGAAGGGAGGGGAGGG + Intergenic
1017758790 6:157552326-157552348 CAGAGTCGGCAGGGCAGGGCAGG + Intronic
1017931949 6:158963481-158963503 GAGACTGGGAAGGGAAGGGAAGG - Intergenic
1018343390 6:162876263-162876285 AAGAGTGGGAAGGGAGGCCAAGG + Intronic
1018651889 6:165999132-165999154 CAGAGCTGGAAGAGCGGGCAGGG - Intergenic
1018962080 6:168456316-168456338 CAGGGTGGGTGGGGCGTGGAGGG + Intronic
1019360865 7:603646-603668 CAGAGTGGAGAGGGCAGGGGAGG + Intronic
1019360892 7:603732-603754 CAGAGTGGAGAGGGTGGGGGAGG + Intronic
1019360919 7:603810-603832 CAGAGTGGAGAGGGCGGGGGAGG + Intronic
1019360933 7:603857-603879 CAGAATGGACAGGGCGGGGGAGG + Intronic
1019419582 7:944835-944857 CAGGGTGGGTAGAGTGGGGATGG - Intronic
1019578872 7:1750376-1750398 CTGACTGGGAAGAGCCGGGAAGG + Intergenic
1019912157 7:4107111-4107133 CAGGGTGGGGAGGGTGGGGAGGG + Intronic
1019912162 7:4107120-4107142 GAGGGTGGGGAGGGTGGGGAGGG + Intronic
1019912167 7:4107129-4107151 GAGGGTGGGGAGGGTGGGGAGGG + Intronic
1019912172 7:4107138-4107160 GAGGGTGGGGAGGGTGGGGAGGG + Intronic
1020122606 7:5513524-5513546 CAGGATGGGAAGGACGGGGCGGG + Intronic
1020133814 7:5574873-5574895 CAGGCTGGGAAGGACAGGGAGGG + Intergenic
1021626894 7:22602417-22602439 CAGACAGGGAAGTGGGGGGATGG + Intronic
1021710228 7:23408965-23408987 GAGAGTGGGGATGGGGGGGATGG + Intronic
1022345680 7:29512126-29512148 GAGAGTGGGAAGGGAAGGGCAGG - Intronic
1022621386 7:31988125-31988147 CACAGTGGGACGGGCAGGGCTGG - Intronic
1022673418 7:32476881-32476903 CAGAGTGGGATGAGCTGGAAGGG - Intergenic
1022715238 7:32892176-32892198 AAGAGCAGGAAGGGCGGGGGCGG + Intronic
1023018329 7:35987326-35987348 CCCAGTGGGGAGGGCGGGGGTGG + Intergenic
1023425372 7:40030389-40030411 CAGAGTTGCAGGGGTGGGGAAGG - Intronic
1023652757 7:42388791-42388813 CAGAGTGGAAAGGGCGTGTGAGG - Intergenic
1023935095 7:44734192-44734214 AAGGATGGGAAGGGAGGGGAGGG - Intergenic
1024049453 7:45609582-45609604 CAGAGTGGGAGGGGCATGGGAGG + Intronic
1024329927 7:48145481-48145503 CAGAATTGGAAGGGCCTGGAAGG - Intergenic
1024483986 7:49895197-49895219 CACAGTGGGCAGGGGAGGGATGG + Intronic
1024493683 7:50017029-50017051 CAGACTGGGAGGGTGGGGGATGG + Intronic
1024494592 7:50030228-50030250 GAGAGAGGGAAGGACAGGGAAGG + Intronic
1024568932 7:50708626-50708648 CATTGTGGGAAGGACTGGGAAGG + Intronic
1024660171 7:51485761-51485783 CACGGTGGGAAGGGCAGGGAGGG - Intergenic
1026308767 7:69166144-69166166 AAGAGGGGAAAGGGGGGGGAAGG + Intergenic
1026364352 7:69632601-69632623 CAGAGAGGGAAGAGGGGAGAGGG - Intronic
1026666552 7:72345466-72345488 AAGAGAGGGAAGGGAAGGGAAGG + Intronic
1026902272 7:74043804-74043826 CTGGGTGGGAAGGGCTGGGGAGG + Intronic
1026989008 7:74572682-74572704 CAGAGTTGGAAGGGTAGAGAGGG - Intronic
1027174178 7:75892891-75892913 CGGGGTGGGAAGGGCTTGGAAGG + Intergenic
1028977978 7:96935077-96935099 AAGAGGGGTAAGGGCGGGGGTGG - Intergenic
1029147756 7:98458763-98458785 CAGAGAGGCAAAGGCGAGGAGGG - Intergenic
1029584776 7:101463512-101463534 AAGAGGGGGAAGAGGGGGGAAGG - Intronic
1029588778 7:101493242-101493264 TAGAGTGGGCGGGGTGGGGAGGG - Intronic
1029694385 7:102203376-102203398 CGGGGTGGGGAGTGCGGGGACGG - Intronic
1030028646 7:105349158-105349180 AAGAGGGGGAGGGGAGGGGAGGG + Intronic
1030139910 7:106293740-106293762 CACAGTGGGCAGGGTGGGGCGGG - Intergenic
1031959134 7:127973087-127973109 CAGAGTGGGAATGAAGAGGAAGG + Intronic
1032012653 7:128356954-128356976 CAGAGTGGTCAGGGAGTGGAGGG + Intronic
1032584985 7:133138137-133138159 GAGAGGGGGAAGGGAAGGGAAGG - Intergenic
1032619308 7:133511738-133511760 AGGAATGGGAAGGGAGGGGAGGG - Intronic
1032697053 7:134346234-134346256 CAGAGTGGGAAGGATGGGTGCGG + Intergenic
1032834737 7:135662434-135662456 CTGAGTGGGAGGAGCGGGGCGGG + Intergenic
1032991878 7:137403012-137403034 CAGAGTGTGCAGGGTGGCGAAGG + Intronic
1033621952 7:143069777-143069799 CAGAAAGGGAAGGAAGGGGAGGG + Intergenic
1033647738 7:143318166-143318188 TAGAGTGGTGAGGGTGGGGAAGG - Intronic
1034254066 7:149714911-149714933 CCGAGGGGGAGGGGCGGGGGTGG - Intronic
1034263820 7:149772297-149772319 CAGAGGGGGAAGGGAGGCGGGGG - Intronic
1034277125 7:149828871-149828893 CTGAGTGGGGAGGGCGGGCCGGG + Intergenic
1034437567 7:151070409-151070431 CAGAGTGGGAGGGGCCTGGCTGG + Intronic
1034840518 7:154391329-154391351 CAGACTGGGAAGACTGGGGATGG - Intronic
1035235802 7:157497070-157497092 CAGGGTGGGCAGGGAGGGGCAGG - Intergenic
1035282673 7:157787470-157787492 CCCAGTGGGCAGGGCGGGCAGGG + Intronic
1035605728 8:928966-928988 TAGAGTGGGAATGGCGGGGGGGG - Intergenic
1035693387 8:1574342-1574364 CAGAGCGGCGAGGGCTGGGATGG - Intronic
1035744609 8:1952639-1952661 CAGAGTTGGTGGGGCGGTGACGG - Intronic
1035769137 8:2132956-2132978 TACAGTGGGAAGGGCTGGGGCGG + Intronic
1035776391 8:2191486-2191508 GGGAGGGGGAAGGGGGGGGAAGG - Intergenic
1035776460 8:2191622-2191644 GGGAGGGGGAAGGGGGGGGAAGG - Intergenic
1035776511 8:2191717-2191739 GGGAGGGGGAAGGGGGGGGAAGG - Intergenic
1035960829 8:4135408-4135430 AAGAGGGGGAAGGAAGGGGAAGG + Intronic
1035965857 8:4190948-4190970 GAGAGTGGGGGGGGCGGGGAAGG + Intronic
1036406682 8:8461496-8461518 CAGGGAGGGAGGGGCTGGGAAGG + Intergenic
1036826499 8:11980355-11980377 CACAGTGGGAAGGGTTGAGATGG + Intergenic
1037292526 8:17366448-17366470 CAGAATGGGAAGGGTGGGAAAGG + Intronic
1037292655 8:17367827-17367849 CAGAATGCGAAGGGTGGGGAAGG - Intronic
1037624955 8:20598571-20598593 CAGAGTGAGGAGGGAGGGCATGG - Intergenic
1037928655 8:22864890-22864912 CTGTGTGGGAAGGTCGGGGCAGG + Intronic
1038152676 8:24956578-24956600 GAGAGAGGGAAGGGGGAGGATGG + Exonic
1038268200 8:26052053-26052075 CTGAGGGCGCAGGGCGGGGAGGG - Intergenic
1038479280 8:27890677-27890699 CAGGGTGGGAGGGGTGGGAAAGG + Intronic
1038618250 8:29115777-29115799 GAGAGTGGGGAGGGCAGGGCAGG - Intronic
1038848852 8:31254867-31254889 CAGAGTGGGACTGCCAGGGAAGG - Intergenic
1039057482 8:33548326-33548348 AGGAGTGGGAAGGGGAGGGAAGG + Exonic
1039227692 8:35406622-35406644 AAGTGTGGGAAGGCCAGGGAGGG + Intronic
1039537303 8:38328675-38328697 CACAGTGGGATGGGATGGGATGG + Intronic
1039564669 8:38542502-38542524 GAGAGGGGGAGGGGAGGGGAGGG - Intergenic
1039615968 8:38955206-38955228 CAGGGTGGGAAGGGCAGGAGGGG - Intronic
1039658793 8:39439540-39439562 GAGAGGGGGAGGGGAGGGGAGGG - Intergenic
1040055822 8:43056288-43056310 GAGAGGGGGAAGGGAGGGGCGGG + Exonic
1040640825 8:49333018-49333040 GAGAGAGGGAGGGGAGGGGAGGG - Intergenic
1040874991 8:52141781-52141803 CAGAGTGGGAGGCTGGGGGATGG + Intronic
1041136299 8:54762795-54762817 AGAAGTGGGAAGGGCGAGGAAGG - Intergenic
1042397407 8:68307998-68308020 CAGAGTGGGGAGGGTGGGTGAGG + Intronic
1043739850 8:83797338-83797360 AAGAGTGGGAAGGACTGGGAAGG - Intergenic
1043979471 8:86621625-86621647 AAGGGTGGGAAGGGGGGTGAAGG - Intronic
1044252689 8:90022532-90022554 AAGAGTGGGAAGGGGGGACAGGG + Intronic
1044828725 8:96224245-96224267 CAGAGTGGGGAGGGATGGAAGGG + Intergenic
1045641830 8:104259884-104259906 CAGGCAGGGCAGGGCGGGGAGGG + Intergenic
1046108475 8:109693171-109693193 CAAAGAGGGAAGGGAAGGGAAGG - Intergenic
1046225084 8:111267703-111267725 CAGAGAGGGAAGGGGAGGGGAGG - Intergenic
1047615414 8:126558532-126558554 CCGAGTGGGCGGGGCGGGGGCGG - Intergenic
1047731987 8:127735928-127735950 GAGGGTGGGGAGGGTGGGGAAGG - Intronic
1047779394 8:128099127-128099149 CAGAGTGAGAAGGCCTGGGTGGG - Intergenic
1048258430 8:132923956-132923978 CAGAGGTGGCAGGGTGGGGATGG + Intronic
1048325383 8:133435033-133435055 CATGGTGGGCAGGCCGGGGAAGG + Intergenic
1048959875 8:139567674-139567696 CAGAGTGGGGATGGGGGGGTGGG - Intergenic
1049007786 8:139866533-139866555 GAGTGTGGGAAGGGCTGGGATGG + Intronic
1049292561 8:141812391-141812413 CAGGGCGGGGAGGGCGGGGAGGG + Intergenic
1049292566 8:141812400-141812422 GAGGGCGGGGAGGGCGGGGAGGG + Intergenic
1049436163 8:142587209-142587231 CAGAAAGGGAAGGAAGGGGATGG + Intergenic
1049439543 8:142602846-142602868 GAGAGTGGGAAGGGGGCAGAGGG + Intergenic
1049456457 8:142693463-142693485 CAGAGCGGGAAGGGAAGGGAAGG + Intergenic
1049481315 8:142825020-142825042 CGGAGCGGGAAGGGATGGGAAGG - Intergenic
1049610511 8:143552892-143552914 CAGAGTGGGAAAGGCGGGGAGGG + Intergenic
1049795790 8:144496775-144496797 CTGAGGGGGAAGGGAGGGCAGGG - Exonic
1049944224 9:579190-579212 CAGGGTGGGTGGGTCGGGGAAGG - Intronic
1050010521 9:1181490-1181512 CAGAGTGGGTAGAGCGGAGATGG - Intergenic
1050046285 9:1549600-1549622 GAGAGTGGGAAGGAGGGAGAGGG + Intergenic
1050106567 9:2172336-2172358 CAGGGTGGGATGGGAAGGGATGG + Intronic
1050728115 9:8675746-8675768 CAGAGTGGGGACGGCAGGGGTGG - Intronic
1051214149 9:14778641-14778663 AAGGGAGGGAAGGGAGGGGAGGG + Intronic
1051350157 9:16191423-16191445 CAGAGGGAGGAAGGCGGGGAGGG + Intergenic
1052242543 9:26291872-26291894 CAGAGTGGCAGGGGCCGGGGGGG - Intergenic
1052552660 9:29970324-29970346 AAGGGTGGGGGGGGCGGGGAGGG + Intergenic
1052740000 9:32384205-32384227 GAGGGTGGGTAGGGTGGGGACGG + Intergenic
1052988865 9:34506884-34506906 CAGGCTGGGAGGGGTGGGGATGG + Intronic
1053157560 9:35791555-35791577 CAGCGGGGGAGGGGCGGGGGCGG + Intergenic
1053170077 9:35872092-35872114 GAGAGTGGGAAGGGTGGGTGAGG - Intergenic
1053170099 9:35872156-35872178 GAGAGTGGGAAGGGTGGGTGAGG - Intergenic
1053170118 9:35872220-35872242 GAGAGTGGGAAGGGTGGGTGAGG - Intergenic
1053364282 9:37511683-37511705 CAGAGTGGGGAGGCTTGGGAGGG + Exonic
1053533481 9:38904383-38904405 CATATGGGGAGGGGCGGGGAGGG - Intergenic
1054205706 9:62128812-62128834 CATATGGGGAGGGGCGGGGAGGG - Intergenic
1054460333 9:65458932-65458954 CAGAGTGAGAAGGGCTATGAGGG - Intergenic
1054632655 9:67459558-67459580 CATATGGGGAGGGGCGGGGAGGG + Intergenic
1056058215 9:82851844-82851866 CAAAGTGGGAAAGGTGGTGAGGG - Intergenic
1056143705 9:83708378-83708400 CAGAGAGGCAAGGGAGGGCAAGG - Intergenic
1056349716 9:85737860-85737882 CAGGGTGGGGAGGCCGGGGAGGG - Intronic
1056549041 9:87636154-87636176 CAGGGTGGGGAGTGCAGGGAAGG + Intronic
1056767844 9:89455632-89455654 CAGAGTGGGTGGGGCAGGGGAGG - Intronic
1057227431 9:93299819-93299841 CAGGGTGGGGTGGGCGGGGCGGG - Intronic
1057367555 9:94437339-94437361 CAGGGTGGGGAGAGCAGGGATGG - Intronic
1057502086 9:95603984-95604006 CAAAGAGGGGAGGGTGGGGAGGG - Intergenic
1057655773 9:96950714-96950736 CAGGGTGGGGAGAGCAGGGATGG + Intronic
1057873925 9:98739112-98739134 CAGAGGGGGAAAGGATGGGAAGG + Intronic
1057960755 9:99454491-99454513 CAGAGTAGGAGAGGAGGGGAGGG - Intergenic
1058680766 9:107438494-107438516 CAGATGGAGAAGGGCTGGGAAGG - Intergenic
1058797888 9:108516112-108516134 CAGAAAGGGAAGGGAGGAGAAGG - Intergenic
1058805551 9:108587671-108587693 CATAGTGGGAAAGGAGGGAAAGG - Intergenic
1059048052 9:110892675-110892697 GAGAGGGGGAAGGGAGGGGAGGG + Intronic
1059156507 9:111993840-111993862 CGGAGTGGGTTGGGTGGGGAGGG + Intergenic
1059353533 9:113682938-113682960 CACACTGGGAAGGGAGGGAAGGG + Intergenic
1059499305 9:114737498-114737520 CAGAAGGGGAGGGGAGGGGAGGG - Intergenic
1059598353 9:115747539-115747561 TAGGGTGGGAAGGGCTGGGGAGG + Intergenic
1060108706 9:120891289-120891311 CAGAGAGGGGAGGGGAGGGAAGG - Intronic
1060497875 9:124131194-124131216 CAGAGAGGGAGGGAAGGGGAGGG + Intergenic
1060813619 9:126623691-126623713 CAGCCTGGGAGGGGTGGGGAGGG + Intronic
1060967555 9:127720397-127720419 TACAGTGGGGAGGGCGGGCAGGG + Intronic
1061004351 9:127920157-127920179 CTGAGGGGGAAGGGGGAGGAAGG - Intergenic
1061390600 9:130315306-130315328 CAGAGGGAGGAGGGAGGGGAGGG - Intronic
1061390611 9:130315330-130315352 GGGAGTGGGAAGGGAGGGGGAGG - Intronic
1061679006 9:132233453-132233475 CAGAGTGGGAAATGCAGGGGAGG + Intronic
1061927265 9:133812066-133812088 CTGCGAGGGAAGGGAGGGGAAGG + Intronic
1061945497 9:133906422-133906444 GCGAGTGGGCAGGGCGGGGGCGG - Intronic
1062026439 9:134342791-134342813 CAGAGCAGGAAGGGCCAGGAAGG - Intronic
1062179041 9:135180799-135180821 CACAGTGGGAAGGGCAGAGTGGG - Intergenic
1062237982 9:135521775-135521797 CAGAGTGGGCAGGGCTGGGAGGG + Intronic
1062427036 9:136510849-136510871 CAGCCTGGGAAGGGCCTGGAGGG - Intronic
1062460285 9:136660060-136660082 CAGAGCGGCCAGGGCAGGGAAGG + Intronic
1062548880 9:137077112-137077134 CGGAGTGGACAGGGCGGGCATGG + Intergenic
1185586350 X:1244556-1244578 AAGAGAGGGAGGGGAGGGGAGGG + Intergenic
1186456905 X:9716902-9716924 CAGAGTGGAAAGGCAGGGGGAGG - Exonic
1186478509 X:9877848-9877870 CAGGGTTGGGAGGGTGGGGAAGG + Intronic
1188185953 X:27114941-27114963 AAGAGAGGGAAGGGAGGGAAGGG + Intergenic
1189463683 X:41262321-41262343 CAGAAAGGGAAGGGAGGGGAGGG - Intergenic
1189865590 X:45323805-45323827 AAGAGTGGGAAGGGTGGGGATGG - Intergenic
1189988857 X:46576136-46576158 GAGAGAGGGAAGGAGGGGGAGGG - Intronic
1190071337 X:47282241-47282263 CAGACAGGGAAGGGAAGGGAAGG - Intergenic
1192609604 X:72554496-72554518 GGGAGCGGGGAGGGCGGGGAGGG + Intronic
1192796917 X:74431467-74431489 CAGATGGGGAAGGGTGGGAAGGG + Intronic
1192989493 X:76433512-76433534 AAGAGTAGGAGGGGAGGGGAAGG - Intergenic
1193087590 X:77461014-77461036 AAGAGTGTGTAGGGAGGGGAAGG - Intergenic
1194837793 X:98702588-98702610 TAGACTGGGAAGGGTGGGGAGGG - Intergenic
1195331584 X:103807517-103807539 GACAGTGGGAAAGGCAGGGAGGG - Intergenic
1195469944 X:105219834-105219856 CCAGGTGGGAAGGGCGGGGCAGG + Intronic
1195728035 X:107937175-107937197 CGGAGGGCGGAGGGCGGGGACGG - Intergenic
1196212776 X:113013707-113013729 GAGGGAGGGAAGGGAGGGGAGGG + Intergenic
1196683952 X:118495459-118495481 TTGAGTGGGGAGGGCGGGGTGGG - Intergenic
1198681902 X:139191958-139191980 CAGAGAGGGCGGGGCTGGGAGGG - Intronic
1198750519 X:139932840-139932862 CAGCGCGGGAGGGGCGGGGCGGG + Intronic
1199497805 X:148472589-148472611 CAGAGTGGGAAGATCAGGCATGG - Intergenic
1199885131 X:152012934-152012956 GAGACTGGGAAGGGTGGGTAGGG + Intergenic
1200063665 X:153494897-153494919 CAGCGGGGAGAGGGCGGGGAGGG - Intronic
1200132018 X:153855000-153855022 CAAAGGGGCAGGGGCGGGGAAGG - Intergenic
1200144444 X:153919357-153919379 CACAGTGGGAGGGGAGGCGATGG - Intronic
1200222394 X:154397607-154397629 TGGAGTGGGAAGGGCGAGGTGGG + Intronic
1200256611 X:154585882-154585904 CACAGGGGGCAGGGTGGGGAGGG + Intronic
1200261158 X:154618521-154618543 CACAGGGGGCAGGGTGGGGAGGG - Intronic
1200399918 X:156013412-156013434 GAGAGTGGGAGGGGTGTGGACGG + Intergenic
1201068355 Y:10121154-10121176 GAGACTGGGAAGGGCAGGGAGGG + Intergenic
1201109876 Y:10791365-10791387 TAGAGTGGAAAGGGATGGGAGGG - Intergenic
1201472235 Y:14346304-14346326 CAGGGTGGGGTGGGAGGGGATGG - Intergenic