ID: 965728947

View in Genome Browser
Species Human (GRCh38)
Location 3:171749492-171749514
Sequence AAAGCTAGACATTGTGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965728947 Original CRISPR AAAGCTAGACATTGTGATCT TGG (reversed) Intronic
900921726 1:5676463-5676485 ATTGCTAGACATAGAGATCTTGG - Intergenic
903413547 1:23166923-23166945 AAAGCTGGAAATAGTGAGCTGGG - Intronic
905959236 1:42029697-42029719 AAAGTTAGACATTCTGGACTAGG - Intronic
906244960 1:44267054-44267076 AAAGCAAGCCATGGTGCTCTAGG + Intronic
909472546 1:76044567-76044589 AAAGCTAGTCTGTGTGATTTGGG + Intergenic
916983461 1:170165414-170165436 AATGCTAAACATTGTTTTCTGGG - Intronic
917433122 1:174991804-174991826 ATAGCTAGAAAATGTTATCTTGG + Intronic
922181537 1:223238479-223238501 AATGCTAGAAATTTTCATCTAGG + Intronic
922993200 1:229932849-229932871 AAAGGTAGAGATTGTCATATTGG + Intergenic
924482423 1:244449444-244449466 ACAGTAAGACATTGTGAGCTTGG - Intronic
1063242146 10:4181858-4181880 ATAATTAGACAATGTGATCTTGG - Intergenic
1064759051 10:18600119-18600141 AAAGCTTCACATTGTGATGGGGG - Intronic
1069415852 10:68200362-68200384 ACAACAAGACATTGTCATCTGGG + Intronic
1074672687 10:115812219-115812241 AAAGGTAGAGATTGTCATTTTGG - Intronic
1074704732 10:116120726-116120748 AAAGCATGACATTTTGCTCTGGG - Intronic
1075183403 10:120232780-120232802 AAAGCTAGACATAGGCAGCTGGG + Intergenic
1080369643 11:31620083-31620105 AAAGTATGACATTGTCATCTAGG + Intronic
1081097341 11:38954725-38954747 AAAACTAGACCTTGTGTTTTAGG - Intergenic
1081234280 11:40627143-40627165 AAATGTAGACATTTTCATCTAGG + Intronic
1081586454 11:44387871-44387893 AAACCAAGACAATGGGATCTAGG - Intergenic
1083940993 11:65895723-65895745 AAGGCCAGACATTCTGTTCTGGG + Intronic
1086589812 11:88500566-88500588 AAAGCAAGTCATTGTGATTGTGG + Intergenic
1092749957 12:11709523-11709545 AAATCTAGTAATTGTGATATAGG + Intronic
1093337987 12:17933357-17933379 AAAGATAGACATTTAAATCTAGG + Intergenic
1093519325 12:20029766-20029788 GAAGCAAGACATTGAGAACTTGG + Intergenic
1093916852 12:24812788-24812810 AAACCTAGCCATTGTGATAGTGG + Intronic
1094284932 12:28782373-28782395 AAACCTAGACCTTGTAATGTGGG - Intergenic
1095231346 12:39743428-39743450 AAAGCTAGACATACTGTACTGGG - Intronic
1096436871 12:51599191-51599213 AAAGATAGACCTTATGTTCTAGG + Intronic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1103198107 12:119063694-119063716 AATGCTAGACATTGGTCTCTGGG + Intronic
1103226362 12:119291361-119291383 ACAACTAGACAGTCTGATCTGGG - Intergenic
1104269652 12:127271724-127271746 ACAGCCTGACATTGTGATCATGG - Intergenic
1106835218 13:33627123-33627145 AAATCTAGACAGTGTTAGCTTGG + Intergenic
1109131471 13:58591766-58591788 AAAGCAAGACAGTATGGTCTAGG + Intergenic
1109291613 13:60481798-60481820 GATGCTGGACATTGTGATGTTGG + Intronic
1110246288 13:73327887-73327909 AAAGATGTACGTTGTGATCTGGG - Intergenic
1110907250 13:80907204-80907226 ACAGCTAGAGATGATGATCTTGG + Intergenic
1113234968 13:108262473-108262495 AAAGCTTGAAATTGGGATATCGG - Intronic
1114069274 14:19095106-19095128 AAAGCTTGACATGGTGATCCAGG + Intergenic
1114092987 14:19304896-19304918 AAAGCTTGACATGGTGATCCAGG - Intergenic
1114352141 14:21864493-21864515 AAAGCCAAACATTGTGGTTTTGG + Intergenic
1114875545 14:26713141-26713163 AAAACTGGACTTTGTCATCTGGG + Intergenic
1116909527 14:50444983-50445005 ATGGCTAGATATTGTTATCTGGG - Intronic
1117581971 14:57160541-57160563 AAAGCTAGACAGTGGTATCCAGG - Intergenic
1124242812 15:28044984-28045006 AAAGGTAGACATTGTCATATTGG - Intronic
1125135798 15:36341521-36341543 AAAGCTAGACATGATGTACTAGG + Intergenic
1126576171 15:50199011-50199033 AAAGATAGACATTATGTTTTGGG - Intronic
1130066442 15:80608825-80608847 AAAGCTTGAAATCGAGATCTTGG + Intergenic
1131460374 15:92613668-92613690 AAAGAAAAACAATGTGATCTTGG + Intergenic
1134656462 16:15951163-15951185 AAAGATTCACATGGTGATCTGGG + Intronic
1137832596 16:51558198-51558220 AAAACTAGACATGGTCCTCTTGG - Intergenic
1138417307 16:56878802-56878824 TAAGGAGGACATTGTGATCTTGG + Intronic
1138789214 16:59882759-59882781 AAAGCTATACATTGTAATTATGG - Intergenic
1139202326 16:64990801-64990823 AATTCTAGCCATTGTTATCTGGG - Intronic
1139886629 16:70212948-70212970 GATGCCAGACAGTGTGATCTTGG - Intergenic
1140954314 16:79848068-79848090 ATATCTTGACTTTGTGATCTTGG - Intergenic
1142368789 16:89666185-89666207 AAAGCCAGATATGGTGATGTGGG + Intronic
1147449048 17:40492340-40492362 AAAGCCAGACACTGGGATCATGG + Intronic
1148526077 17:48336952-48336974 AAAGATATACATTGTTGTCTTGG - Intronic
1149952751 17:61008277-61008299 GAAGCTTGACATTCTCATCTAGG + Intronic
1150514861 17:65797540-65797562 AAAGCAAGACATTTTGATGAAGG - Intronic
1151978521 17:77495859-77495881 AAAACTAGACATTTTTAACTTGG + Intronic
1152272680 17:79334177-79334199 CAAGCTAAAGATTGTGATTTAGG - Intronic
1153478946 18:5528031-5528053 AATGCTAGAAATAGTGATGTGGG + Intronic
1154210298 18:12374209-12374231 AATGCTAGACATGCAGATCTTGG - Intronic
1155236622 18:23826259-23826281 AAAGCAATGCCTTGTGATCTTGG - Intronic
1157930028 18:51811647-51811669 TAAGCTAGACAGTTTGTTCTTGG + Intergenic
1164457323 19:28419699-28419721 GAAGCTAGAATTTGTGTTCTAGG - Intergenic
1165811360 19:38613961-38613983 AGAGGGAGACATAGTGATCTGGG + Intronic
929091889 2:38225481-38225503 AAAGCTAGACATGATGTGCTAGG - Intergenic
930366488 2:50446269-50446291 AAAGCCAGACATAGTGACCAAGG - Intronic
930523415 2:52496930-52496952 AAAGGTAGAGATTGTGTCCTGGG - Intergenic
933128313 2:78639607-78639629 ATAGCTATACATTCTGATTTGGG - Intergenic
933128840 2:78647168-78647190 AAAGCTGGACAATGTAATTTGGG + Intergenic
935533957 2:104271084-104271106 ACAGCCTGACACTGTGATCTGGG - Intergenic
940261193 2:151781220-151781242 ACATCTAGACTCTGTGATCTTGG - Intergenic
941843632 2:170112784-170112806 TATGCTAGACATAGTGCTCTGGG + Intergenic
942308909 2:174635477-174635499 AAAGCTAGATATGGTGCCCTTGG - Intronic
1169595015 20:7188596-7188618 AAAGCTAGAAGATTTGATCTTGG + Intergenic
1172051018 20:32118197-32118219 AAAGCTACAGATACTGATCTCGG - Intronic
1172312102 20:33926702-33926724 AAAGCTAGGGATTGAGAACTGGG + Intergenic
1172797932 20:37555911-37555933 AAAGAGAGACATTGTGTTCATGG + Intergenic
1174441323 20:50557394-50557416 AAAGATAAACATTTTGAGCTGGG - Intronic
1180487745 22:15817669-15817691 AAAGCTTGACATGGTGATCCAGG + Intergenic
1183271740 22:36866581-36866603 AGAGCTAGACATTGGGAGTTAGG - Intronic
949880075 3:8654700-8654722 AAGGCCACACACTGTGATCTTGG - Intronic
955407665 3:58635731-58635753 TAAGCTAGAAAATGTGGTCTTGG - Intronic
955951255 3:64244516-64244538 TATGCTAGACATTCTGATGTTGG + Intronic
959901589 3:111667602-111667624 AAAGCTTGAGATTGTGTTTTGGG - Intergenic
962375824 3:134857898-134857920 AAAGCAACACATTGGCATCTTGG + Intronic
963155477 3:142091586-142091608 TAAGCTAGACATTTTTATATTGG + Intronic
965728947 3:171749492-171749514 AAAGCTAGACATTGTGATCTTGG - Intronic
965770035 3:172172297-172172319 AAATCTAGAAATTAAGATCTAGG - Intronic
971583758 4:28377786-28377808 AAAGATAGACAGTGAGATCAAGG - Intronic
974197646 4:58597026-58597048 AAAGCTAAAGAATGTGTTCTTGG - Intergenic
974619305 4:64335382-64335404 AAAACTAGACAGTGTCCTCTTGG - Intronic
977362728 4:96026571-96026593 GAAACTAGACATTGTAACCTAGG - Intergenic
978258006 4:106715830-106715852 AAATCTATACATTCTGATTTGGG + Intergenic
978819530 4:112949707-112949729 AAAACAAGATATTGTCATCTTGG + Intronic
980272907 4:130610150-130610172 AAAGCTGGACATGGTCATCCGGG + Intergenic
980655349 4:135775819-135775841 AATGCTAGAGATTTTGGTCTAGG + Intergenic
981871300 4:149489367-149489389 AAAGCAACACATTGTGAGCTTGG + Intergenic
983999380 4:174222217-174222239 AAAGATAGACAATATGATGTTGG - Intergenic
990145255 5:52752311-52752333 AAAGATAGAAATTGTGCTTTGGG - Intergenic
991440036 5:66637585-66637607 AAAGTTAGAAATTGTTATATTGG + Intronic
993157797 5:84248875-84248897 GAGGCTAGACATGATGATCTTGG - Intronic
993479406 5:88405223-88405245 AAAGCTAAATGTTGTGATCTGGG - Intergenic
993492364 5:88567896-88567918 AAACCTAGACCTGGTGATCTGGG - Intergenic
994049537 5:95346985-95347007 AGTGCCAGGCATTGTGATCTAGG + Intergenic
994268809 5:97752425-97752447 TAAGTTAGACATTGACATCTTGG + Intergenic
994416255 5:99475754-99475776 AAAGCCTGAAAATGTGATCTGGG + Intergenic
994463713 5:100099418-100099440 AAAGCCTGAAAATGTGATCTGGG - Intergenic
994992520 5:107015415-107015437 AAAGGCAGACATTGTCACCTGGG + Intergenic
996235108 5:121118527-121118549 AAATAAAGACATTCTGATCTAGG - Intergenic
997215448 5:132106046-132106068 AAAGACAGACATGGTGCTCTCGG + Intergenic
998219839 5:140268119-140268141 AAAGCAAGACAAAGTGAGCTGGG + Intronic
998342545 5:141431071-141431093 AAATCTAGACATTCTGATGGAGG + Exonic
1000035187 5:157441755-157441777 AAAGAATGAAATTGTGATCTTGG + Intronic
1001355172 5:171014270-171014292 AAAGGTAGAGATTTTCATCTAGG - Intronic
1003289615 6:4768492-4768514 AAAGCTAGAGAATCTGATCAAGG + Intronic
1003515100 6:6811292-6811314 AAATCACGTCATTGTGATCTCGG + Intergenic
1003620909 6:7699056-7699078 ATAGATTGAGATTGTGATCTGGG + Intergenic
1004173439 6:13317396-13317418 AAAGCTTTACATTTTCATCTAGG + Intronic
1004206187 6:13593500-13593522 TAAGATAGGCATTGTCATCTCGG - Intronic
1004468946 6:15911124-15911146 AATGATAGACATTGTAAACTTGG + Intergenic
1005484402 6:26285890-26285912 AAAGCCAGTCACTGTGACCTTGG - Intergenic
1007008788 6:38394630-38394652 AAAGTCAGACATTGTCATTTTGG - Intronic
1008395931 6:51006641-51006663 AAAGAAAGACATTGGGAGCTAGG + Intergenic
1010986187 6:82427117-82427139 AAAGCTAAACATTGTGTGCAAGG + Intergenic
1012002891 6:93676281-93676303 AAAGCTAAATCTTGTGTTCTGGG - Intergenic
1013334611 6:109142788-109142810 AATCCTAGAGATTGTGATTTAGG + Intronic
1015142419 6:129950054-129950076 AAAGCTTGACATTATGTACTAGG + Intergenic
1016361215 6:143269091-143269113 AAAGTAAGAAAGTGTGATCTAGG - Intronic
1016689390 6:146918913-146918935 AAAGGTAGATATTGTTATATAGG - Intergenic
1016793932 6:148097100-148097122 AAAGCTAGCGGTTGTGCTCTTGG - Intergenic
1017626849 6:156357806-156357828 AAACCTAGGCATTCTGACCTTGG - Intergenic
1018165082 6:161086018-161086040 AAATCTATACAGTGTGATCTGGG - Intronic
1020020728 7:4866543-4866565 AAATCTATACGTTGTGACCTTGG + Intronic
1022017554 7:26364741-26364763 AAAGCTACATATTGTAATCAAGG - Intronic
1023230057 7:38018326-38018348 AGAGCTGATCATTGTGATCTGGG + Intronic
1024178823 7:46868166-46868188 TAACCTAGACAGTGTGATATTGG - Intergenic
1025754610 7:64325342-64325364 AAAGCTAGAAATAGTCATCCAGG - Intronic
1030838964 7:114324036-114324058 AAAGCAAGAGATTGTGATTCTGG + Intronic
1031981805 7:128132252-128132274 TAAGCAAAACATTGTGATCTTGG + Intergenic
1033497874 7:141917775-141917797 AGAGCTAGAAATTGTTAACTGGG + Intronic
1036163490 8:6409754-6409776 AAGGCTAGAGATGATGATCTAGG + Intronic
1037140601 8:15515091-15515113 AAATCAAGACAGTGTGGTCTTGG - Intronic
1039190586 8:34969656-34969678 AAAGCTTGACATGGTAAGCTTGG - Intergenic
1041372652 8:57179119-57179141 AAAGCTAGTCATTGTGAACGTGG + Intergenic
1042967235 8:74367645-74367667 AAATCAAGACATTCTGATATGGG - Intronic
1045233998 8:100333837-100333859 AAAGATAGACAATGTGTTTTCGG - Intronic
1045334807 8:101190557-101190579 AAAGCAAGCCATTGTGATACTGG + Intronic
1052424594 9:28288239-28288261 AAAGCTTGAAATTGTGATATTGG - Intronic
1056231199 9:84546423-84546445 ATAGCCATACATTGTGATCCAGG - Intergenic
1057323472 9:94036543-94036565 AAACCTAACCATTGTGTTCTTGG + Intronic
1059188944 9:112305334-112305356 AAAGATCGACAATGTGATTTAGG + Intronic
1188327295 X:28821546-28821568 AAAGCAGTACATTGTGATGTGGG + Intronic
1191923564 X:66284099-66284121 TAATCAAGACAGTGTGATCTTGG + Intergenic
1192389404 X:70709990-70710012 AAACCTAGAGATAGTGATCTAGG - Intronic
1192686026 X:73305990-73306012 ATAACTAGACATTTTGATATTGG - Intergenic
1195902404 X:109812799-109812821 AAAAGTAGAAATTGTGTTCTGGG + Intergenic
1196068034 X:111487539-111487561 GAAATTAGACATTGTGATATTGG + Intergenic
1196130176 X:112147067-112147089 AAAGTCACACAGTGTGATCTGGG + Intergenic
1197024424 X:121730938-121730960 AAAGCTATAGTTTGTGATATTGG + Intergenic
1197232302 X:124018231-124018253 AGAGCTCCACCTTGTGATCTTGG + Intronic
1201454883 Y:14159059-14159081 CAAGCAAGCCATTGAGATCTGGG + Intergenic
1201897785 Y:19011855-19011877 AAAGCTACACTGTGTGATCCAGG + Intergenic