ID: 965742498

View in Genome Browser
Species Human (GRCh38)
Location 3:171890432-171890454
Sequence GTCTGAACTCAGCTGATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965742498_965742500 2 Left 965742498 3:171890432-171890454 CCAGGCATCAGCTGAGTTCAGAC 0: 1
1: 0
2: 1
3: 13
4: 145
Right 965742500 3:171890457-171890479 GTTTTGCTTTCCACTGTGACAGG 0: 11
1: 62
2: 153
3: 269
4: 515

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965742498 Original CRISPR GTCTGAACTCAGCTGATGCC TGG (reversed) Intronic
900932259 1:5744573-5744595 TTCTAAACTCAGCTCAGGCCTGG - Intergenic
903025469 1:20427062-20427084 GTTTGAGCTCAGCTCATTCCAGG + Intergenic
903272920 1:22202868-22202890 GGCTGAGCTCAAGTGATGCCAGG - Intergenic
906163848 1:43671163-43671185 GTCTGAGCTCAGCAGAGACCTGG - Intronic
908249291 1:62252500-62252522 CTCTGAGCTAAGCTGAGGCCTGG + Intronic
909416533 1:75412650-75412672 TTTTAAACTCAGCTGATGACAGG - Intronic
912255051 1:108049767-108049789 GGCTGAACTCCACTGATGCAGGG + Intergenic
917522303 1:175758250-175758272 ATATGAACTGAGCAGATGCCTGG - Intergenic
919835331 1:201569319-201569341 GCATGAACTCCCCTGATGCCAGG + Intergenic
919866396 1:201786334-201786356 GTCTGAACTAGGCTGGAGCCAGG - Intronic
922889783 1:229052819-229052841 GGATGGCCTCAGCTGATGCCAGG + Intergenic
923670403 1:236035688-236035710 ATCAGAACGCAGCTGATCCCCGG - Intronic
924583852 1:245344919-245344941 GAATGAACTCAACTGAAGCCGGG - Intronic
1062896748 10:1109095-1109117 CTCTGAACTGGGGTGATGCCAGG - Intronic
1063109824 10:3025645-3025667 GGCTGAACTCAGGTGAAGCCGGG - Intergenic
1063129635 10:3167135-3167157 GCCTGAAATTAGATGATGCCGGG + Intronic
1064474345 10:15670803-15670825 GTCTGGGCTCAGCTCATGTCCGG - Intronic
1065351497 10:24799699-24799721 GTGTGAACTCATATGATGGCTGG + Intergenic
1065537250 10:26727263-26727285 GTCTCAACTCAGCTACTGTCTGG - Intronic
1065845483 10:29739389-29739411 GTCTTCTCTCAGATGATGCCCGG - Intergenic
1066639980 10:37546206-37546228 GTGTAATCACAGCTGATGCCAGG - Intergenic
1069545351 10:69323993-69324015 GTCTGACCACAACTGATTCCTGG - Intronic
1071290000 10:84181813-84181835 GTCTGACCCCAGCTTAAGCCTGG - Intronic
1076488226 10:130837891-130837913 GTCAGAAGACTGCTGATGCCTGG - Intergenic
1077073251 11:687432-687454 CTGTGAACTGAGCTGAGGCCTGG - Intronic
1077522281 11:3043465-3043487 CTCTGACCCCAGCTGGTGCCTGG + Intronic
1084484266 11:69438826-69438848 GTCTGCACTCAGCGGCTGCCAGG - Intergenic
1085030405 11:73267640-73267662 GTCTGAACTCAGCATAGGCTGGG + Intronic
1087321170 11:96660639-96660661 GTCTCAACGCAGCTTATGGCTGG - Intergenic
1090306699 11:125697587-125697609 GTCTGGACTGAGCTGCTCCCAGG - Intergenic
1091802590 12:3333993-3334015 GTCTGAGCTGAGCTGGTCCCTGG + Intergenic
1093338718 12:17943792-17943814 TCCTGAAATCAGCTGATACCAGG - Intergenic
1096585219 12:52615553-52615575 GTCTGATTTCCTCTGATGCCTGG + Intronic
1096764197 12:53869741-53869763 GACTGAACTTAACTCATGCCAGG + Intergenic
1101806567 12:108069371-108069393 GTATGTTCTCAGCAGATGCCTGG - Intergenic
1102279452 12:111607493-111607515 GTCTGTACTCACAAGATGCCAGG - Intergenic
1103621984 12:122192680-122192702 GGATGTGCTCAGCTGATGCCGGG - Intronic
1105597093 13:21849101-21849123 GTCTGAATCCATCTGATTCCTGG + Intergenic
1108820606 13:54345303-54345325 CTCTGAACTCAAGTGATGCAGGG + Intergenic
1109442662 13:62395102-62395124 CTCTGAACTCAGCCTATACCTGG - Intergenic
1112567619 13:100564840-100564862 GCCTGAACCCAGCAGAAGCCAGG + Intronic
1113937867 13:114004582-114004604 GCCTGAACCCAGCTCACGCCGGG + Intronic
1120129735 14:80791628-80791650 GTCTGAACTGATCTGATCCCAGG - Intronic
1120835454 14:89035149-89035171 CTCTGACCTCAGCTGTTGCCAGG + Intergenic
1122831249 14:104397278-104397300 GTCTGACCGCAGCTGAGGCCGGG + Intergenic
1128344030 15:66842575-66842597 CTCTGTACTTAGCTGATGACGGG - Intergenic
1128767209 15:70258507-70258529 GTCCTAACTCAGGTGCTGCCAGG + Intergenic
1131222988 15:90600675-90600697 GTGTGAACTCAGCACAGGCCTGG + Intronic
1133118294 16:3590695-3590717 TTCCGCACTCAGATGATGCCGGG - Exonic
1133514040 16:6490068-6490090 GCTTGATCTCAGCTAATGCCAGG + Intronic
1133519012 16:6538912-6538934 GTCTGTTCTTAGCTGGTGCCAGG + Intronic
1133678245 16:8096211-8096233 GTCTTAACTCTGGTGAAGCCAGG + Intergenic
1133812332 16:9170335-9170357 GCCTGGACTCAGCTGCTGCCGGG + Intergenic
1135923587 16:26672892-26672914 ACAGGAACTCAGCTGATGCCAGG + Intergenic
1136236003 16:28914156-28914178 GTCTGAACACAGGTGGTGCGGGG + Intronic
1136694123 16:32061545-32061567 GCCTGAACTCAGCTGACGTTTGG - Intergenic
1136794619 16:33004809-33004831 GCCTGAACTCAGCTGACGTTTGG - Intergenic
1136875291 16:33849583-33849605 GCCTGAACTCAGCTGACGTTTGG + Intergenic
1139453010 16:67047167-67047189 GCATGATCTCAGCTTATGCCTGG - Intronic
1139922064 16:70466844-70466866 GACAGAACACAGCTGGTGCCTGG - Intronic
1203096881 16_KI270728v1_random:1266459-1266481 GCCTGAACTCAGCTGACGTTTGG - Intergenic
1143326286 17:6100548-6100570 CTCTGAGCTCTGCAGATGCCTGG + Intronic
1145188009 17:20813055-20813077 TCCTGAACTCAGATGGTGCCCGG - Intergenic
1146941094 17:36845082-36845104 GTCTGGACTCAGCTGTAGCTGGG + Intergenic
1148029366 17:44608932-44608954 GTTTAAACTAAGCTGCTGCCAGG - Intergenic
1148119624 17:45200716-45200738 GTCTTCACTCTGCTGATGGCTGG + Intergenic
1149518777 17:57302718-57302740 TTGAGAACCCAGCTGATGCCTGG + Intronic
1149658373 17:58322129-58322151 GTCTGAAATCAGCTCACTCCTGG + Intronic
1150439432 17:65179347-65179369 GCCTTAACTCAGCTGTTCCCAGG + Intronic
1151955802 17:77379598-77379620 GTGTGACCTCCCCTGATGCCTGG - Intronic
1152555194 17:81049580-81049602 GTCTGAGCTCAGCTCCTTCCTGG + Intronic
1155172480 18:23277099-23277121 GTCTGCAGTCAGCTGAAGGCTGG + Intronic
1157294393 18:46432278-46432300 GCCTGAACCCAGCTTATACCTGG + Intronic
1157419114 18:47530773-47530795 GTCTGAACTAGGCTGATGAGTGG - Intergenic
1159607584 18:70491321-70491343 GTCTTAACTCTGCAAATGCCAGG - Intergenic
1163100424 19:15092529-15092551 GACTGAACTCTGCTGCTGTCTGG + Intergenic
1165761772 19:38325883-38325905 GACTGAACTCAGGTGTTGGCAGG + Intronic
1166025392 19:40078722-40078744 GTCTGCCCTCAGCTTTTGCCTGG - Intronic
1166650952 19:44574800-44574822 GTCTGAACCCACCTGATGCGTGG - Intergenic
1167209245 19:48122778-48122800 GTCTGAACTCAGTTGCAGCAGGG + Intronic
931051931 2:58425589-58425611 ATCTGCACTCAGCTGGTGGCTGG + Intergenic
936066929 2:109339553-109339575 GCCTGAATCCAGCTGATGCCTGG - Intronic
936259856 2:110949357-110949379 GTCAGAAACCAGTTGATGCCCGG - Intronic
938009966 2:127821053-127821075 CTCTGAACTTATCTGCTGCCTGG - Intergenic
938173974 2:129107461-129107483 GTCTGAACCCAGGTGAAGCGCGG + Intergenic
938213020 2:129484493-129484515 GTGTGGGTTCAGCTGATGCCTGG + Intergenic
947352502 2:229261203-229261225 GTCTGAAATCAGATGCTGGCAGG - Intronic
948310017 2:236978216-236978238 GGCTGCATTCAGCTGGTGCCTGG - Intergenic
949048244 2:241882066-241882088 GTTTCAACACAGCTGAGGCCTGG + Intergenic
1171138816 20:22723155-22723177 GTCTGTACTCAGCTGCTGGGGGG - Intergenic
1171269996 20:23808341-23808363 GTTTGAACTCATCTGATCCTAGG + Intergenic
1174755439 20:53153829-53153851 GGCTAGACTCAGCTGATGACTGG + Intronic
1178666749 21:34554490-34554512 GACTGAACACACCTGAAGCCAGG + Intronic
1179580120 21:42338291-42338313 CTCTGATCTCAGCTCCTGCCAGG - Intergenic
1179807469 21:43848929-43848951 GTCTGAAGTCAGCTGGAGGCCGG + Intergenic
1183565343 22:38610477-38610499 AGCTGACCTCAGCTGATGTCAGG - Intronic
1184091898 22:42297299-42297321 GTCTGACCTCTGCTCAGGCCTGG - Intronic
949945821 3:9189235-9189257 GTCTGAACACATCTCATCCCCGG - Intronic
952902068 3:38117172-38117194 GTCTGATCACAGCTGATCCCTGG - Intronic
953923243 3:46966618-46966640 GTCTGAACTCACCTGGTGTTTGG - Intronic
954301003 3:49700752-49700774 CTCTGGACTCAGCAGAGGCCAGG + Intronic
960972419 3:123149373-123149395 GGCTGCACTCAGCTGGTGCAGGG + Intronic
965015620 3:163153464-163153486 GTCTGAGCTCAGGTGCTCCCTGG + Intergenic
965742498 3:171890432-171890454 GTCTGAACTCAGCTGATGCCTGG - Intronic
968503734 4:962654-962676 GTCTGCACCCAGCTGATGGGCGG - Intronic
968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG + Intronic
969279954 4:6163076-6163098 GTCTGAACTCTGCAGAACCCTGG - Intronic
970510803 4:16779778-16779800 GTGGGCACCCAGCTGATGCCTGG - Intronic
972271194 4:37511968-37511990 GGCTGTACTCAGCTGATGCCCGG - Intronic
972696183 4:41449125-41449147 GTCTGGGCTCAGCTGACCCCTGG + Intronic
974469723 4:62302816-62302838 CTCTGAACCCAGCTGGAGCCTGG + Intergenic
977779126 4:100959585-100959607 GACTGAAATCAGATGATCCCTGG - Intergenic
981674844 4:147330398-147330420 GTATGAACTCATGTGTTGCCTGG - Intergenic
982350410 4:154409098-154409120 GTCTGAGCTCAGCCAATGCTCGG - Intronic
982373317 4:154658249-154658271 GACTAAATTCAGATGATGCCTGG + Intronic
982674065 4:158355637-158355659 TTCTGACCTCAGCTGATCTCAGG + Intronic
992655695 5:78907486-78907508 GTCGGAACTCAGCTGGTTGCTGG + Intronic
999289010 5:150411479-150411501 GTGTGATGTCAGCTGTTGCCAGG - Intronic
1003429099 6:6022641-6022663 TTCTCAACACAGCTGATGCAGGG - Intergenic
1003935813 6:10974063-10974085 ATCTGAACTCAGCAGTTCCCAGG - Exonic
1007743275 6:44025924-44025946 GTGTTAACTCACCTGATGGCGGG - Intergenic
1008154778 6:48000601-48000623 GTTTGTTCTCAGCTGATGACTGG + Intronic
1011788787 6:90875704-90875726 GTCTGTAGTCAGCTCATACCTGG + Intergenic
1014840895 6:126218934-126218956 GGCAGAACTCAGCTGGTGCCTGG - Intergenic
1014941573 6:127446648-127446670 GTCCGAGGTCAGCTGATCCCAGG - Exonic
1015816282 6:137214405-137214427 GTCTGTACTCAGCTTAAACCTGG - Intronic
1021584379 7:22192396-22192418 GTCTGAACATAGGTGATGTCTGG - Intronic
1022562083 7:31359884-31359906 GTCAGAACTCAGAGGATGCACGG - Intergenic
1023296058 7:38716077-38716099 TCCTGAACTCTGGTGATGCCAGG - Intergenic
1026149636 7:67776998-67777020 CACTGAACCCGGCTGATGCCTGG - Intergenic
1029589239 7:101496221-101496243 GTCTAAAGGCAGCTGATTCCTGG + Intronic
1032668849 7:134065385-134065407 GTCTGAGCTCAGCTGAATGCAGG + Exonic
1032903524 7:136338081-136338103 GACTGAATTCAGGTGAGGCCAGG - Intergenic
1036643749 8:10599739-10599761 GTCAGACCCCAGCTGATCCCAGG + Intergenic
1041343986 8:56876576-56876598 GTCTCAACTCAGCTTCTGACTGG + Intergenic
1043557417 8:81448084-81448106 GTCTGAACTAAGCAGGTTCCTGG + Intergenic
1048203722 8:132398934-132398956 GTCAGAAGTCATGTGATGCCTGG - Intronic
1048203822 8:132399877-132399899 TTCTTAACTCCTCTGATGCCTGG - Intronic
1048312531 8:133336605-133336627 ATCTGAACTCATCTGACACCAGG - Intergenic
1050283752 9:4079519-4079541 CTCTGACCTCCGCTGATGACAGG - Intronic
1050741417 9:8824651-8824673 GTTGGAACTAAGCTGATACCGGG + Intronic
1053533502 9:38904461-38904483 GTCTGCTCTCAGCTGATGACTGG - Intergenic
1054205727 9:62128890-62128912 GTCTGCTCTCAGCTGATGACTGG - Intergenic
1054632634 9:67459480-67459502 GTCTGCTCTCAGCTGATGACTGG + Intergenic
1054813766 9:69455410-69455432 GCCTGAACTAAGCTGCTCCCAGG - Intronic
1055689744 9:78816648-78816670 GGCTGAAGTCATCTGAAGCCTGG - Intergenic
1055835316 9:80433266-80433288 GTAGGAACTGAGCTGATGTCAGG - Intergenic
1057522812 9:95773239-95773261 GTTTGAATTCAGCTGAGGCTGGG - Intergenic
1062290103 9:135790563-135790585 GTGTGAGCACAGCTGCTGCCAGG - Intronic
1062573152 9:137194680-137194702 GTCTGCCCTCAGCTGGGGCCCGG + Intronic
1188388268 X:29588811-29588833 GTTTTAAATCAGCTGGTGCCTGG - Intronic
1188388359 X:29590000-29590022 GTTTTCACTCAGCTGGTGCCTGG + Intronic
1189050218 X:37637188-37637210 GTCTGAACACAGATGATGGAAGG - Intronic
1189247639 X:39576056-39576078 CTCTGAGCTCAGCGGATGCTGGG + Intergenic
1193416970 X:81237502-81237524 GACCAAACTCAGCTGATGTCTGG + Intronic
1194358764 X:92920501-92920523 GACCAAACTCAGATGATGCCTGG - Intergenic
1198286806 X:135199169-135199191 GGCTCAACTCAGCTGTTTCCTGG + Intergenic
1198694943 X:139325506-139325528 TTCCGAACCCAGCTGAGGCCTGG + Intergenic
1200666932 Y:6036195-6036217 GACCAAACTCAGATGATGCCTGG - Intergenic
1201405120 Y:13642324-13642346 GGCCCAACTCAGCTGATGCTTGG + Intergenic