ID: 965742701

View in Genome Browser
Species Human (GRCh38)
Location 3:171892595-171892617
Sequence CTGAATTTCCAGATGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 0, 2: 6, 3: 67, 4: 493}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965742701_965742706 23 Left 965742701 3:171892595-171892617 CCTTTCTCCATCTGGAAATTCAG 0: 1
1: 0
2: 6
3: 67
4: 493
Right 965742706 3:171892641-171892663 ATACTGTTTCAAAGACAAACTGG 0: 1
1: 0
2: 0
3: 22
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965742701 Original CRISPR CTGAATTTCCAGATGGAGAA AGG (reversed) Intronic
900682856 1:3926407-3926429 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
901529340 1:9843538-9843560 CTGAGCTTCCAGTTGGGGAAGGG - Intergenic
902292695 1:15445615-15445637 CTGAACTGCCAGTTGGAGAACGG + Exonic
902526772 1:17063979-17064001 CTGCATGTCCAGCTGGAGAAGGG + Intergenic
902560525 1:17274509-17274531 CTGTATTTCCACCTGAAGAATGG + Intronic
902707718 1:18217214-18217236 CTGCACTTCCAGATGCAGAGTGG + Intronic
902738458 1:18417186-18417208 CTGAATTTCAAAAGGGAGAGGGG + Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903010160 1:20324169-20324191 CTGTTTTTCCAGATGGCCAAGGG - Intronic
903126380 1:21251024-21251046 CTGAATTTGCAGATGGGGTAAGG + Intronic
903613436 1:24633862-24633884 ATGAATTTGGAGATGGTGAAGGG + Intronic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904455942 1:30648105-30648127 CCCATTTCCCAGATGGAGAACGG + Intergenic
904626101 1:31803917-31803939 CTAAAGTTCCAGAAGGAGAGAGG + Intronic
905750369 1:40457367-40457389 GTGATTTCCCAGTTGGAGAAAGG + Exonic
906100073 1:43254557-43254579 CTGCATTTCCTGAAGGAGATAGG - Intronic
906580871 1:46934356-46934378 CGGTCTTCCCAGATGGAGAATGG - Exonic
906602852 1:47144538-47144560 CGGTCTTCCCAGATGGAGAATGG + Exonic
908008250 1:59748932-59748954 CTGACCTTCCAGAATGAGAAAGG + Intronic
908048103 1:60194545-60194567 CTCACTTTCCAGATGAAGAATGG + Intergenic
908082436 1:60595689-60595711 CTGACTTTAAAGATGGAGAGAGG - Intergenic
909684136 1:78326992-78327014 CTGATTTTACAAATGGGGAAAGG - Intronic
910205272 1:84743286-84743308 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
910625733 1:89304378-89304400 CTGAATGTCCATATGCACAATGG - Intergenic
911100370 1:94091022-94091044 CAGGAATTCCAGGTGGAGAAAGG + Intronic
912473081 1:109919004-109919026 CTGCATTCCAAGATGGATAAGGG + Intronic
913387639 1:118277238-118277260 CTGGATTTGAAGATGGAGGATGG - Intergenic
915658076 1:157377914-157377936 CTGGATTTCCACATGCAGAAGGG + Intergenic
916213995 1:162380699-162380721 CTGGATTTCCAGATAGGGAGAGG + Intronic
916267045 1:162901009-162901031 CTGGCTTTGGAGATGGAGAAAGG - Intergenic
917078594 1:171233324-171233346 CAGTATTTACAGATGGAAAAAGG + Intergenic
917488862 1:175480155-175480177 CTGACTATGCAGCTGGAGAATGG - Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
919269395 1:195319515-195319537 GAGAATTTCTAGATGGTGAAGGG + Intergenic
919417649 1:197331281-197331303 CTGAGTTTCAGGATGGGGAAGGG - Intronic
919662108 1:200257388-200257410 CTGGCTTTGAAGATGGAGAACGG + Intergenic
919834569 1:201564864-201564886 CTGACTTTGAAGATGGAAAAAGG - Intergenic
920716345 1:208343852-208343874 CTGAATTGCTACTTGGAGAAGGG - Intergenic
920819579 1:209367898-209367920 CTAGATGACCAGATGGAGAATGG + Intergenic
920954732 1:210608074-210608096 CTGAATTTTCAACAGGAGAATGG - Intronic
921600952 1:217105723-217105745 CTGATTGTCCAGGTGCAGAATGG - Intronic
922403104 1:225281282-225281304 CTGGCTTTACAGATGGATAAAGG - Intronic
923195698 1:231664593-231664615 CTGCTTTTGAAGATGGAGAAAGG + Intronic
923488025 1:234455018-234455040 CTGGTTTTGAAGATGGAGAAAGG + Intronic
923561915 1:235047953-235047975 TTGAAATTCCAAATGGAGACTGG + Intergenic
924567994 1:245213808-245213830 CAGAATTTCCTGATTGAGGATGG + Intronic
1062909168 10:1201251-1201273 CTGCATTTGCAGAGGGAGAGAGG - Intronic
1063040211 10:2330028-2330050 TTGAAGGTCCAGAAGGAGAAGGG + Intergenic
1063079468 10:2751774-2751796 CTTGATTTCCAGATGGTGAATGG - Intergenic
1064897983 10:20261016-20261038 CTCAATTTAAAAATGGAGAAAGG - Intronic
1065009264 10:21406854-21406876 CTGACTTTTCAGTAGGAGAAAGG - Intergenic
1065441858 10:25761316-25761338 CTGAAATTACAGATGGAGGCTGG + Intergenic
1066073469 10:31846822-31846844 TTGGAGTTCCAGAAGGAGAAAGG - Intronic
1066808092 10:39284438-39284460 CTAAATGTCCATATGCAGAATGG + Intergenic
1067709548 10:48637178-48637200 CTGAAGCTGCAGATGGAGACAGG + Intronic
1067921599 10:50464315-50464337 CTGACTTTAAAGATGGAAAAGGG + Intronic
1068719915 10:60233239-60233261 CTTTATTTTCAGATAGAGAAAGG + Intronic
1068923543 10:62511253-62511275 CTGAATGTTGAAATGGAGAAAGG + Intronic
1069086573 10:64146843-64146865 CTGACTTTGCAGATGGAGGAAGG + Intergenic
1070853073 10:79583587-79583609 CTGAAGTTCCAGGTTGTGAAGGG - Intergenic
1070888013 10:79921722-79921744 CTGAAGTTCCAGGTTGTGAAGGG + Intergenic
1071422165 10:85511529-85511551 CTGTACTTCTAGGTGGAGAATGG + Intergenic
1072000863 10:91194387-91194409 CTGGATTTGAAGATGGAGGAAGG + Intronic
1074242500 10:111652928-111652950 CTTAACTTCCAGGTGGAGGAAGG + Intergenic
1075271872 10:121059462-121059484 CTGAATTACAAGATGGAGGAGGG + Intergenic
1076357047 10:129860861-129860883 CTCAATTTTCAGATGATGAATGG + Intronic
1076496886 10:130903477-130903499 CTGTATTTCCAGCTGGACAGAGG - Intergenic
1077214178 11:1388503-1388525 CTGTATTTCCAGCTGGGGAGGGG - Intergenic
1077921208 11:6643046-6643068 CTGAACTACCAGCTGGATAAAGG + Intronic
1078376637 11:10800142-10800164 CTAAATTACAAGATCGAGAATGG - Exonic
1078558146 11:12347585-12347607 TTCAATTTACAGATGCAGAAGGG - Intronic
1078832692 11:14992346-14992368 CCTAATTTCCAGGGGGAGAAAGG + Intronic
1079087152 11:17454605-17454627 CTGAATTTCCAGGGGAGGAAGGG + Intronic
1079185948 11:18236724-18236746 CTGAAATTTCATCTGGAGAAAGG - Exonic
1079641722 11:22813976-22813998 CTGATTTTGAAGATGGAGGAAGG - Intronic
1080358807 11:31488436-31488458 CTGAATTCTCTGATGGATAAAGG - Intronic
1080881700 11:36327320-36327342 CTGAAATTCCAAAGGGAGGAGGG - Intronic
1081233887 11:40621638-40621660 CTGAATTTCAAGATGCAGGAGGG + Intronic
1081441739 11:43088367-43088389 CTGAATTTTCTCTTGGAGAATGG + Intergenic
1081457227 11:43235865-43235887 GTGATTTTCCAGTTGGAGGATGG + Intergenic
1082297865 11:50465533-50465555 CTAAATTTCCATTTGTAGAATGG - Intergenic
1082305860 11:50573857-50573879 CTAAATTTCCATCCGGAGAATGG + Intergenic
1083049172 11:59761700-59761722 CTCAGTTTCCAGATGGAGACTGG - Intronic
1083402105 11:62430685-62430707 CTGACTTTGAAGATGGGGAAGGG - Intergenic
1084025450 11:66445629-66445651 CTGAATTCCAAAAGGGAGAAGGG - Intronic
1084025850 11:66448879-66448901 CTGAATTCCAAAAGGGAGAAGGG - Intronic
1084563486 11:69916999-69917021 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1085831384 11:79904960-79904982 CTGAATTTAGAGATGGGGAGAGG - Intergenic
1087757525 11:102070499-102070521 CAGGAACTCCAGATGGAGAAAGG - Intronic
1088266976 11:107997241-107997263 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1089460195 11:118648526-118648548 CTGAAGTTCCACATGCAGGAGGG - Intronic
1089820357 11:121220234-121220256 CTGACTTTGAAGATGGAGGAAGG + Intergenic
1091162040 11:133432631-133432653 TTGAAGTTCCAGAAGAAGAAAGG - Intronic
1091576622 12:1742598-1742620 CTCAAGTTCCTGATAGAGAATGG + Intronic
1091949310 12:4580016-4580038 CTCATTTTACAGATGGAGAAAGG - Intronic
1092104949 12:5914689-5914711 CTGAAATTGGAAATGGAGAATGG - Intronic
1092139423 12:6172506-6172528 CTGAAGTTCCAGAGGGAGGAAGG + Intergenic
1092519983 12:9260657-9260679 CTGAATTTGAAGATAGAGAAAGG + Intergenic
1092754854 12:11753665-11753687 CTGAATTACCAGAGAGAGAAAGG - Intronic
1093220539 12:16415279-16415301 CTTAATTTCCATAGGGAGGAGGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093516335 12:19990874-19990896 CTGGTTTTGAAGATGGAGAAAGG + Intergenic
1093826097 12:23690949-23690971 CTGACTTTCCAGACTGGGAAGGG + Intronic
1094732087 12:33188611-33188633 CTGGATTTTAAGATGGAGGAGGG + Intergenic
1094793488 12:33942275-33942297 CTGACTTTAAAGATGTAGAATGG + Intergenic
1095104762 12:38219026-38219048 CTGACTTTAAAGATGTAGAATGG + Intergenic
1095521788 12:43075344-43075366 CTGCCTGTCCTGATGGAGAAGGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1097511973 12:60554435-60554457 CCTAATTTCCAAATGAAGAAAGG - Intergenic
1097596438 12:61638202-61638224 CTGGATTTGAAGATGGAGGAAGG + Intergenic
1098144009 12:67480210-67480232 CTCACTTTCAAGGTGGAGAAAGG - Intergenic
1100357706 12:93847130-93847152 CTGAAAGTGCAGATGTAGAATGG + Intronic
1100506387 12:95224827-95224849 CAGTTTTTCCAGATGGAGGATGG + Intronic
1100819486 12:98418065-98418087 CTGAATTTCCTGCAGGAAAAGGG - Intergenic
1100882221 12:99031617-99031639 CTGCATTCCCAGATGGAGGAAGG - Intronic
1100915126 12:99411697-99411719 CTAAATTTCCAAATAGAGATTGG + Intronic
1101279723 12:103239873-103239895 CTGAACTTCCAGATGGAGACTGG + Intronic
1101713042 12:107286504-107286526 CTGAATTCCAAAAGGGAGAAGGG - Intergenic
1102371091 12:112382571-112382593 CTGAATGGCCAGGGGGAGAAGGG - Intergenic
1102416033 12:112763720-112763742 CTGAATTTCAAGAGGGAGGAGGG + Intronic
1102927229 12:116835614-116835636 CTGGAGTGCTAGATGGAGAAGGG + Intronic
1103015693 12:117492841-117492863 CTGACTTTGAAGATGGAGAAGGG + Intronic
1103137902 12:118523558-118523580 CTAGATTTGAAGATGGAGAAAGG + Intergenic
1103304994 12:119956988-119957010 CTGGCTTTGCAGATGGAGAAGGG + Intergenic
1103629385 12:122247333-122247355 CTGAAGTTCAGGATGGGGAATGG - Intronic
1104067552 12:125317953-125317975 CTAAACTTCCAGCAGGAGAATGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104482634 12:129121562-129121584 CTGGATTTGAAGATGGAGAATGG + Intronic
1104752677 12:131250056-131250078 CTTATTTCCCAGAGGGAGAAGGG - Intergenic
1105617225 13:22029914-22029936 GTGAATTTCCAGAAGGAGCTGGG - Intergenic
1105628171 13:22134241-22134263 CTAAATTTGGGGATGGAGAATGG + Intergenic
1106473301 13:30076947-30076969 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1106500009 13:30319006-30319028 CTTCATTTCTAGTTGGAGAAGGG - Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106882720 13:34149374-34149396 CTTAATTTCTAGAGGGAAAATGG + Intergenic
1106998401 13:35515294-35515316 CTGAAATTCCAGACTGAGGAGGG + Intronic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107749409 13:43548441-43548463 CAGAATTAAGAGATGGAGAAAGG - Intronic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108390969 13:49947335-49947357 CTGAATTCCAAAAAGGAGAAGGG - Intergenic
1109867626 13:68286158-68286180 ATGAATTTCCTGATGAAGATGGG - Intergenic
1110151180 13:72255991-72256013 TTGAATTCCCAGTTGGATAAAGG + Intergenic
1111541000 13:89667199-89667221 CTGGAGTACCTGATGGAGAATGG - Intergenic
1112669609 13:101619424-101619446 CTGCCTTTGAAGATGGAGAAAGG + Intronic
1113144038 13:107187021-107187043 CTGGATTTTAAGATGGAGGAAGG - Intronic
1113343975 13:109455713-109455735 CTGGCTTTCAAGATGGAGAAAGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114889243 14:26896082-26896104 CTGGATATCCAGCTGGAGCAAGG + Intergenic
1115303461 14:31910896-31910918 CTGAATTCCAAAAGGGAGAAGGG + Intergenic
1115469569 14:33754619-33754641 CTGAATTTCCAGAAAGACAGAGG + Intronic
1116112407 14:40603737-40603759 CTAAGTTTCCACAAGGAGAAAGG - Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1117319705 14:54609268-54609290 CTGACTTCAAAGATGGAGAAAGG + Intronic
1117769466 14:59118462-59118484 CTGAATTTACAAATTTAGAAAGG - Intergenic
1117835272 14:59798530-59798552 CTGGCTTTGAAGATGGAGAATGG - Intronic
1118401180 14:65380864-65380886 CTAATTTTCCAGATGGTAAATGG - Intergenic
1119654943 14:76410553-76410575 CCCATTTTACAGATGGAGAATGG + Intronic
1120061496 14:79988719-79988741 CTGAGCTTGAAGATGGAGAAAGG - Intergenic
1120062384 14:79999466-79999488 CTGAGTCTTCAAATGGAGAAGGG + Intergenic
1120139144 14:80908286-80908308 TTGCATTTCCAGAAGGAGAGGGG - Intronic
1121275954 14:92667787-92667809 CTGAATGACCATATGGAGCATGG - Intronic
1121660882 14:95634126-95634148 CTGAATTCCCAGATGGAACCTGG + Intergenic
1122305140 14:100760562-100760584 CTGACTATCCACATGCAGAAAGG + Intergenic
1122871049 14:104639240-104639262 CTGACTTTGCAGCTGGAGACAGG + Intergenic
1125120842 15:36157033-36157055 CTGAGTTGCCAGATGGAGCTTGG + Intergenic
1127866251 15:63035601-63035623 CTGAAGTTCCTGAGGTAGAATGG + Intergenic
1128215464 15:65931252-65931274 CTGACTTTGAAGATGGAGGAAGG + Intronic
1128317148 15:66668139-66668161 CTGACTTTGAAGATGGAGGAAGG + Intronic
1129711840 15:77824362-77824384 CTGGTTTTCCAGCTGTAGAAGGG + Intergenic
1130712094 15:86293416-86293438 CTGGCTTTGAAGATGGAGAAAGG - Intronic
1130799145 15:87243454-87243476 CTGAGTCTCCACATGGATAAGGG - Intergenic
1130815871 15:87432103-87432125 CTGCATTTACAGATGAAGTAAGG + Intergenic
1131001944 15:88946056-88946078 CTGAATCTTCAGAGGGTGAAGGG - Intergenic
1131640726 15:94289983-94290005 CTGGCTTTGAAGATGGAGAAAGG + Intronic
1131830008 15:96348078-96348100 CTGAAGTCCCCGCTGGAGAAGGG - Intergenic
1131917520 15:97286151-97286173 ATTAATTTCTAGGTGGAGAAGGG - Intergenic
1133625798 16:7569395-7569417 CTGATTTTGAAGATGGGGAAAGG - Intronic
1133866143 16:9645277-9645299 CTGAATTTACAGATAGGAAATGG - Intergenic
1134798473 16:17063086-17063108 CAGAAATTCCAGCTGGAGAACGG - Intergenic
1134872775 16:17666824-17666846 CTGGCTTTGAAGATGGAGAAAGG - Intergenic
1135353105 16:21746580-21746602 CTGATTTTGGAGATGGAGGATGG + Intronic
1135451592 16:22562703-22562725 CTGATTTTGGAGATGGAGGATGG + Intergenic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1135912500 16:26574166-26574188 CTGACTTTGAAAATGGAGAAAGG + Intergenic
1138309351 16:56009929-56009951 CTGAAGTTGGAGCTGGAGAAGGG + Intergenic
1138649906 16:58453994-58454016 CTGGATTTGAAGATAGAGAAAGG - Intergenic
1138748240 16:59388677-59388699 CTGAATTTCAAAATGGAGGAGGG + Intergenic
1138823093 16:60285485-60285507 CTGACTTTCAAGATGGAAAGGGG + Intergenic
1139057141 16:63199489-63199511 CTGACTTTGAAGATGGAGAGAGG + Intergenic
1139300480 16:65941493-65941515 CTGAGGTTCCTGATGGAGAGAGG - Intergenic
1140937879 16:79691563-79691585 CTAGTTTTCAAGATGGAGAAAGG + Intergenic
1141263348 16:82473717-82473739 CTGGCTTTCAAGATGGAGGAAGG - Intergenic
1141304366 16:82847427-82847449 CTGACTTTGAAGATGGAGGAAGG - Intronic
1141471933 16:84244671-84244693 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1142678483 17:1530966-1530988 TTGAAAGTCCAAATGGAGAACGG + Intronic
1143840973 17:9731471-9731493 CTGAGCTTCCAGAGGAAGAATGG - Intergenic
1145786472 17:27597175-27597197 CTTCCTTTCCAGATGGGGAAGGG + Intronic
1145876983 17:28326412-28326434 CCGAGTTTCCACTTGGAGAAGGG + Intronic
1146032146 17:29375446-29375468 CTCATTTTACAGATGGGGAAAGG + Intergenic
1146537831 17:33668439-33668461 CTGACTTTGAAGATGGAGGAAGG - Intronic
1146611494 17:34309450-34309472 CTGACTTTGAAAATGGAGAAGGG - Intergenic
1147024512 17:37568602-37568624 CTGAAGTTTAAGATGGACAAAGG + Intronic
1147297344 17:39494673-39494695 CTGGATTTCAAGAAGGACAAAGG + Exonic
1147896020 17:43751899-43751921 GAGATTTTCCAGGTGGAGAAGGG - Intergenic
1148253947 17:46112007-46112029 CTGTATTTCCCAAAGGAGAATGG + Intronic
1148508490 17:48147601-48147623 GAGATTTTCCAGAAGGAGAAAGG + Intronic
1148666597 17:49379561-49379583 CTCAATTTCTAAAGGGAGAAAGG - Intronic
1148712434 17:49691619-49691641 ATGAATTTCCATTTGGAGATGGG - Intergenic
1148868331 17:50640928-50640950 CTGAAGTCCCAGATAGGGAAGGG - Intronic
1149518966 17:57303958-57303980 CTGAATTACTAGAGGGAGGAGGG + Intronic
1149933693 17:60781980-60782002 CTGAATTTCTAGGTGGAGGATGG - Intronic
1150025479 17:61669907-61669929 CTGAATTCCCAACTGGAGATGGG + Intergenic
1150690022 17:67357528-67357550 CTGCTTTTCCAGAGAGAGAAGGG + Exonic
1150800505 17:68278252-68278274 CTGAAGTGCCTGATGGAGGATGG - Exonic
1150941249 17:69696934-69696956 CTCAATATCCAGAGGCAGAAAGG - Intergenic
1153056585 18:951582-951604 CTAGAATTCCAGATGTAGAAAGG + Intergenic
1153169633 18:2301166-2301188 CTGCCTTTCAAGATGGAGGAAGG + Intergenic
1153304591 18:3620281-3620303 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1154335119 18:13458836-13458858 CTGGCTTTCCAGATGATGAAGGG + Intronic
1155509962 18:26566607-26566629 CTGAATTTGCAGTTTGAGGAGGG + Intronic
1155514058 18:26606266-26606288 CTGAATTTCAAAAGGGAGGAGGG + Intronic
1156366699 18:36435059-36435081 CTTAATTTACTGATGGTGAAGGG + Intronic
1156695582 18:39762241-39762263 CTGACTTTGAAGATGGAGAAGGG - Intergenic
1156842686 18:41628058-41628080 CTGAGTATCCAGTTGAAGAAGGG - Intergenic
1157015416 18:43706608-43706630 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158010107 18:52718984-52719006 CTGAGTTTTCAGAGGGAAAATGG - Intronic
1158155435 18:54420680-54420702 CTTTCTTTCAAGATGGAGAAAGG - Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159099188 18:63939394-63939416 GTGACTTTACAGATGGAGAGTGG - Intergenic
1159583948 18:70265074-70265096 CTGAATTCTAAGAAGGAGAAAGG - Intergenic
1164334723 19:24303222-24303244 CTGAATGTCCATTTGCAGAATGG - Intergenic
1164613616 19:29650907-29650929 CTGAATTCCAAGAGGGAGGAGGG + Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1165507304 19:36242079-36242101 CTGAAGTTCAACATGCAGAATGG + Intronic
1166130600 19:40743600-40743622 CCCAATTTCCAGATGGGGAAAGG + Intronic
1166237829 19:41469290-41469312 TTTAATATCCAGATGGAGAGAGG - Intergenic
1166244291 19:41514891-41514913 CCGAATATCCAGAGGGGGAAAGG - Intergenic
1168217878 19:54939680-54939702 CTGAAGCTGCAGATGGAGAAGGG - Exonic
1168224240 19:54982920-54982942 CTGAAGCTGCAGATGGAGAAGGG + Exonic
1168476094 19:56676406-56676428 CTGTACTTGGAGATGGAGAAAGG - Intergenic
1168680201 19:58309669-58309691 CTAAAAGTCCTGATGGAGAATGG - Intronic
925616561 2:5749261-5749283 CTGAACTCCCAGCAGGAGAAAGG + Intergenic
925679087 2:6398223-6398245 CTGCATTTCCACAAGGAGAAGGG - Intergenic
926888404 2:17618355-17618377 CAGAATTTAAAGATGGAGGAGGG - Intronic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
927283353 2:21331086-21331108 CTGATTTTACAAATAGAGAATGG + Intergenic
927670585 2:25065708-25065730 GTGAATTTCCAGAAGAAAAATGG - Intronic
928261870 2:29775285-29775307 CTGACTTTCCAGTTAAAGAATGG - Intronic
928735534 2:34284074-34284096 GTGATTTTCCTGATGGAAAATGG + Intergenic
928883290 2:36121753-36121775 CTGTCTTTGCAGATGGAAAAGGG - Intergenic
929793973 2:45044332-45044354 AAGAATTACCAGAAGGAGAATGG - Intergenic
930592700 2:53348182-53348204 CTGGATGTCCATATGCAGAAGGG - Intergenic
931052922 2:58434205-58434227 CTGACTTTGAAGATGGAGGAAGG - Intergenic
931217182 2:60257047-60257069 CTGATTTTCCAGGTGGGGAAAGG + Intergenic
931410041 2:62020649-62020671 CGGAATTTCAAGAACGAGAATGG - Intronic
931668951 2:64629674-64629696 CAGAATTTCCACAAGCAGAAGGG + Intergenic
931998207 2:67859099-67859121 CTGAATCACCATATGGAGGATGG + Intergenic
932200873 2:69827564-69827586 CTGAATTTACATCTGAAGAAGGG - Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
933153723 2:78947320-78947342 CTGACTTTCCAGATCGAGACAGG - Intergenic
933209288 2:79548542-79548564 GTGATTCTCTAGATGGAGAAAGG - Intronic
935035203 2:99364481-99364503 CTTAATGTTCAGAAGGAGAATGG + Intronic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
936481198 2:112886375-112886397 CTGAATTCCAAAAGGGAGAAGGG - Intergenic
936888270 2:117338782-117338804 ATGTATTTCCACTTGGAGAAAGG + Intergenic
937053145 2:118908496-118908518 CTGAAGATCCAGCTGGGGAAAGG + Intergenic
937098005 2:119248222-119248244 CTGAGTTGCCAGAGGGAGGAAGG - Intronic
937342025 2:121097185-121097207 CTGGATTTGAAGATGGAGGAAGG + Intergenic
937659586 2:124415175-124415197 CTCTTTATCCAGATGGAGAATGG - Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938365980 2:130734665-130734687 CTGGCTTTGAAGATGGAGAAGGG + Intergenic
938747961 2:134298623-134298645 GTGAATTTCCAGATGTTGGAAGG + Intronic
938998474 2:136705950-136705972 CTGACTTTGAAGATGGAGGAAGG + Intergenic
939642164 2:144653824-144653846 CTTAATTTCCACTTGCAGAATGG - Intergenic
939718446 2:145615774-145615796 CTCACTTTGAAGATGGAGAAAGG + Intergenic
941614842 2:167707559-167707581 CTGGTTTTCAAGATGGAGAAAGG - Intergenic
941932239 2:170953736-170953758 CTGAAGAACCAGATGTAGAAAGG + Intronic
942413192 2:175732981-175733003 CTGACTTTACAAATGAAGAAAGG + Intergenic
942507552 2:176659466-176659488 GTGAACTTACATATGGAGAAAGG + Intergenic
943312928 2:186349704-186349726 TTAAGTTTCCAGATGCAGAAAGG - Intergenic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
943356368 2:186861087-186861109 CTAAATTTTCAGACTGAGAAAGG - Intergenic
943398143 2:187368436-187368458 CAGAATTTCCATATGATGAAGGG + Intronic
943538706 2:189184569-189184591 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
944604335 2:201337342-201337364 CTGAATAACCATATGCAGAAGGG - Intronic
945256822 2:207810144-207810166 CAGAATTTCAAGATGGAGACAGG + Intergenic
945619300 2:212113194-212113216 ATGATTTTCCAAATAGAGAAGGG + Intronic
946028291 2:216685721-216685743 GTGCATTTGCAGAAGGAGAAAGG + Intronic
946336965 2:219044228-219044250 CAGAATCTCAGGATGGAGAAAGG - Intergenic
947282386 2:228469769-228469791 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
947337438 2:229102051-229102073 CTGGCTTTGAAGATGGAGAATGG + Intronic
948275890 2:236708391-236708413 CTGACATTTCAGATGAAGAAGGG - Intergenic
948373245 2:237504002-237504024 CTGGTTTTGAAGATGGAGAAAGG + Intronic
948539785 2:238682434-238682456 TTGAATTTCTAGAAGTAGAATGG + Intergenic
1169689852 20:8318304-8318326 CTGATTTTCTAGTGGGAGAAGGG + Intronic
1170507236 20:17039849-17039871 CTGAAAGTCCTGATGTAGAAAGG - Intergenic
1170823772 20:19776206-19776228 CTGAATTCCCAAAGGGAGGAGGG - Intergenic
1172322901 20:34010655-34010677 CTGATTTTCCAGATAAAGAGAGG + Intronic
1173010684 20:39179027-39179049 CTGCATTCCCACATGGCGAAAGG + Intergenic
1173143475 20:40505067-40505089 CTAAATTTACAGATGCAGATAGG - Intergenic
1173190743 20:40873855-40873877 CTGACTTTGAAGATGGAGGAGGG + Intergenic
1173495079 20:43513047-43513069 CTGAATCCCCAGAGGGAGGAGGG + Intronic
1173858910 20:46269309-46269331 CTCATTTTCCTGATGGAGAGAGG + Intronic
1174888591 20:54364034-54364056 CTGAATTTCAAAAGGGAGGAGGG - Intergenic
1175663161 20:60835004-60835026 CTGAATTTGCTCATGGAGATGGG - Intergenic
1177682385 21:24389333-24389355 CTGAAATGGAAGATGGAGAAAGG - Intergenic
1177766683 21:25466326-25466348 CTGAATTTCCATAGGGATAATGG - Intergenic
1178585413 21:33867043-33867065 CACACTTTCCAGATGGAGAATGG - Intronic
1178804101 21:35824162-35824184 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1178903415 21:36615861-36615883 CTTTATGTCCAGATGGAGAAAGG - Intergenic
1179147281 21:38779193-38779215 TTGAGATTTCAGATGGAGAAAGG - Intergenic
1182000984 22:26919619-26919641 CTGGCTTTGAAGATGGAGAAGGG + Intergenic
1182398672 22:30057023-30057045 GGGAAGTTCCAGAAGGAGAAGGG + Intergenic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1183788699 22:40047215-40047237 TTGAATTATCAGAGGGAGAAAGG + Intronic
1185214689 22:49591703-49591725 CTGACTTTCCAAAGGGAGGAGGG - Intronic
949135149 3:555336-555358 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
949187099 3:1205119-1205141 CTGATTTTAAAGATAGAGAAAGG + Intronic
951737290 3:25882024-25882046 CTGGCTTTCAAGATGGAAAAGGG - Intergenic
952121208 3:30246442-30246464 CTCAATTTCCACATGCAGCACGG + Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953168031 3:40482614-40482636 CTGATATTCCAGCTGGAGCAAGG + Exonic
953534699 3:43768874-43768896 ATGAATTTGGATATGGAGAATGG + Intergenic
955265663 3:57441449-57441471 CTGAAGTTCCGGAAGGAGAGAGG + Intronic
955694304 3:61620388-61620410 TTGAATTTGCAGAGGGAAAATGG + Intronic
955716828 3:61838119-61838141 CTGAGATTTCAGATGGTGAATGG + Intronic
956760349 3:72437648-72437670 CTAAATTGACAGAGGGAGAAAGG + Intronic
956878874 3:73490576-73490598 TTGAATTTATAGGTGGAGAATGG - Intronic
956993872 3:74800940-74800962 CTGTATTTACATTTGGAGAAAGG - Intergenic
957903168 3:86523728-86523750 CTGAATTCGAAGATGGAGGATGG - Intergenic
958579320 3:95997152-95997174 CTGGATTCCCAGATATAGAAAGG - Intergenic
958596455 3:96231617-96231639 CTAGATTTAAAGATGGAGAATGG - Intergenic
959585762 3:108023691-108023713 CTGAGTATCCAGATTGAGGAGGG - Intergenic
959817925 3:110697881-110697903 CTGAGTTTCCAGAGGGAGCATGG - Intergenic
959872583 3:111345429-111345451 CTGACTTTGAAAATGGAGAAAGG + Intronic
960717651 3:120593592-120593614 TTGAATCTCCAGGTGGAGAACGG + Intergenic
961780578 3:129317986-129318008 GTGAATTTCCTGACAGAGAACGG + Intergenic
961957441 3:130818564-130818586 CTGAATTCCAAAAGGGAGAAGGG - Intergenic
963308621 3:143682763-143682785 CTGACTTTGAAGATGGAGGAAGG - Intronic
963372533 3:144419484-144419506 CTGGCTTTGAAGATGGAGAATGG - Intergenic
964035133 3:152186726-152186748 ATGATTTTCCAAATGAAGAAAGG + Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964654912 3:159055599-159055621 CTGGCTTTGAAGATGGAGAAGGG - Intronic
964702015 3:159578686-159578708 CTGACTTTGAAGATGGAAAAAGG - Intronic
964829141 3:160863855-160863877 CTGCATTTTCAGATGCATAAGGG - Intronic
964849906 3:161084454-161084476 CTGAATTACAGGATGGAAAAAGG - Exonic
965221003 3:165925348-165925370 CTGATTTTGAAGATGGGGAAAGG + Intergenic
965636580 3:170788243-170788265 CTGGCTTTGAAGATGGAGAAAGG + Intronic
965742701 3:171892595-171892617 CTGAATTTCCAGATGGAGAAAGG - Intronic
966276309 3:178174634-178174656 ATGAATTTGCAGATCTAGAAAGG + Intergenic
968052663 3:195666108-195666130 TTGGATCTCCTGATGGAGAATGG + Intergenic
968103148 3:195982246-195982268 TTGGATCTCCTGATGGAGAATGG - Intergenic
969170494 4:5358783-5358805 CTCACTTTCAAGATGGGGAAAGG - Intronic
969598909 4:8164177-8164199 CTGTATTTAGAGATGAAGAAAGG - Intergenic
970267678 4:14306915-14306937 CTGGACTGCCATATGGAGAAGGG + Intergenic
970341516 4:15112268-15112290 TTGATTTTACAGATGAAGAAAGG + Intergenic
970936546 4:21577769-21577791 CAGAATTTCCAAATAGAGGAAGG - Intronic
971215777 4:24661181-24661203 CTGCATTCCCAGATGGTTAAGGG - Intergenic
971234970 4:24832971-24832993 CAGAAGTTGCAGATGTAGAATGG - Intronic
971596477 4:28535570-28535592 ATGAATTGCCAGAAGAAGAAAGG - Intergenic
971725808 4:30310319-30310341 CTGCATTTCCAGGTGGAGTATGG - Intergenic
971842700 4:31874662-31874684 CTGATTTTGAAGATGGAAAAAGG - Intergenic
973264838 4:48200774-48200796 CTGAATTGCAAGCTGGAGGAAGG - Intronic
973628771 4:52798777-52798799 CTGACTTTGAAGATGGAGGATGG + Intergenic
974160642 4:58133658-58133680 CTTATTTTGAAGATGGAGAAAGG + Intergenic
974374402 4:61057947-61057969 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
974784892 4:66607516-66607538 GTGAATTTTCAGATAGAGAAAGG + Intergenic
975968716 4:80007698-80007720 CTGGCTTTGCAGATAGAGAAAGG + Intronic
977361933 4:96016294-96016316 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
978057540 4:104291044-104291066 CTGGATTTCAAGGTGGAGAAAGG - Intergenic
978341285 4:107723322-107723344 CTGCATTTCCAGTTGTACAAAGG - Intergenic
978661039 4:111126619-111126641 CTGACTTTGAAGATGGAGGAAGG + Intergenic
978694156 4:111556118-111556140 GTGATTTTCCAGTTTGAGAAGGG - Intergenic
978842314 4:113229332-113229354 CTGGCTTTGGAGATGGAGAACGG - Intronic
979666886 4:123321560-123321582 CTGGATTTGAGGATGGAGAAAGG + Intergenic
979845849 4:125510637-125510659 CTGACTTTGAAGATGGAGTAAGG - Intergenic
980492023 4:133540737-133540759 CTGAATTCCAAAAGGGAGAAGGG + Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981872661 4:149505766-149505788 TTGATTTTCTAGATAGAGAATGG - Intergenic
982418439 4:155164778-155164800 CTGCATTTCCAGGAGCAGAATGG + Intergenic
982553337 4:156830448-156830470 CTGTAGGTCCACATGGAGAATGG - Intronic
983399316 4:167243729-167243751 CAGAATATCCAAATTGAGAAAGG - Intergenic
983615439 4:169699235-169699257 CTTAATTTCTTGATGGAAAAAGG - Intronic
985498913 5:228227-228249 TTGGATCTCCTGATGGAGAATGG + Exonic
986105765 5:4658061-4658083 CTGACTTTGCGGATGGAGGAAGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
987654689 5:20791573-20791595 CTGAATAACCACGTGGAGAAGGG - Intergenic
987743613 5:21942144-21942166 CAGGATTTCAAGTTGGAGAAAGG + Intronic
988123122 5:26993181-26993203 GTGAACTTCCAGATGGAAATGGG + Intronic
988371680 5:30377372-30377394 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
988740949 5:34070268-34070290 CTGAATAACCACGTGGAGAAGGG + Intronic
988882534 5:35518802-35518824 CTGAAGTTCCAGATGGAGGGAGG - Intergenic
988915432 5:35889280-35889302 TTGAGTTTGCAGATGGAGATAGG - Intergenic
989299819 5:39877616-39877638 GTGAATTACCATGTGGAGAAAGG + Intergenic
989344296 5:40411865-40411887 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
989461271 5:41701416-41701438 CTGAATGTGAAGCTGGAGAAAGG - Intergenic
989821702 5:45800712-45800734 CAGAAGTTCCAGCTGCAGAAAGG + Intergenic
989986567 5:50705895-50705917 CTGACCCTCCATATGGAGAATGG - Intronic
990592591 5:57281509-57281531 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
991706078 5:69360112-69360134 CTATATTTCCTGAAGGAGAATGG + Intronic
991763810 5:69952316-69952338 CAGAATTTCAAGATGGAGAAAGG + Intergenic
991783515 5:70165823-70165845 CAGAATTTCAAGATGGAGAAAGG - Intergenic
991843041 5:70827384-70827406 CAGAATTTCAAGATGGAGAAAGG + Intergenic
991875960 5:71166153-71166175 CAGAATTTCAAGATGGAGAAAGG - Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992157444 5:73969211-73969233 TTGAATTTCAAGATAGGGAAAGG + Intergenic
992508387 5:77409868-77409890 CTCAAGTTCCAGGTGGAGAATGG - Intronic
993878358 5:93335709-93335731 CTGGCTTTGAAGATGGAGAAGGG - Intergenic
994780839 5:104088062-104088084 CTGAATTTAAAGATGGAAGAAGG - Intergenic
994780866 5:104088417-104088439 TTGAATCTGCAGATGAAGAATGG - Intergenic
994835419 5:104845904-104845926 CTGGATTCCCTGATGCAGAAAGG + Intergenic
994852765 5:105076932-105076954 CTAAATTTCAGGAAGGAGAACGG + Intergenic
995664307 5:114523965-114523987 CTGACTTTTTAGATGGAGCATGG - Intergenic
997700992 5:135899334-135899356 CTAAATAACCAGATGGGGAAAGG - Intergenic
998674512 5:144391996-144392018 GTGAATTTACAGAGGAAGAAAGG + Intronic
999378535 5:151103914-151103936 CTGAGTTTCCAGGTGGACATGGG - Intronic
1000339878 5:160268864-160268886 CTTGATTTCCTGAGGGAGAAAGG - Intronic
1000526354 5:162363355-162363377 CTGAATTACCAAATGGAGACTGG - Intergenic
1000600278 5:163265613-163265635 ATGCATTTCCAGAAGGAGCAGGG + Intergenic
1000755064 5:165147915-165147937 CTGGCTTTGGAGATGGAGAAAGG + Intergenic
1001899416 5:175412862-175412884 CTGGCTTTGAAGATGGAGAAAGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004743306 6:18484937-18484959 GTGAAATTCCAGATGCAAAAAGG - Intergenic
1004875309 6:19945432-19945454 CTGAAGTTCTAGAAGGAGATAGG + Intergenic
1005347429 6:24904347-24904369 CTGACTTTGAAGATGGAGGAAGG - Intronic
1005485073 6:26291944-26291966 CTAAAAATCCTGATGGAGAATGG + Intergenic
1005835525 6:29705869-29705891 CTGACTTTCCGGTTGGAGGAGGG - Intergenic
1006773250 6:36571523-36571545 CTGACTTTTAAGATGGAGGAAGG - Intergenic
1007103931 6:39270415-39270437 TTGAATATTCAGAGGGAGAAAGG + Intergenic
1007807369 6:44460384-44460406 CTGAATTCCTAGAAGGAGACAGG + Intergenic
1007821364 6:44562800-44562822 CTGCAAGTCCAGGTGGAGAATGG - Intergenic
1007825352 6:44595750-44595772 CTGGACTGCAAGATGGAGAAAGG + Intergenic
1008133424 6:47744223-47744245 CTGACTTTGCAGATGAAGGAAGG - Intergenic
1008749462 6:54714872-54714894 CTGAACTACCTAATGGAGAAGGG - Intergenic
1008852184 6:56035733-56035755 CTGCATTTCAAGATACAGAAAGG - Intergenic
1008957913 6:57235859-57235881 CTGGCTTTCAAGATGGAGAAGGG + Intergenic
1009356707 6:62756938-62756960 CTGAATTTTAAAATTGAGAAAGG - Intergenic
1009376204 6:62973156-62973178 ATGAATTACCAGGGGGAGAATGG + Intergenic
1009478995 6:64131656-64131678 CTGAATATGCAGATGAAAAATGG + Intronic
1009785501 6:68333138-68333160 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1009868761 6:69430687-69430709 CTGAAATTTCGGATGGAAAAGGG + Intergenic
1009883215 6:69595371-69595393 TTGAACTGCTAGATGGAGAATGG - Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011927764 6:92669169-92669191 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1012774002 6:103479949-103479971 CTCAATATCCACAGGGAGAAAGG + Intergenic
1012775091 6:103487261-103487283 CTGAATATCCAAATGGGGAGAGG + Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1013859117 6:114612749-114612771 ATGAATTTCCAAAAGGAGATGGG - Intergenic
1014168079 6:118248552-118248574 CTGGCTTTGAAGATGGAGAAAGG + Intronic
1014286363 6:119503442-119503464 CTCAATTCCCACATGGGGAAAGG - Intergenic
1014512571 6:122342212-122342234 CTGGCTTCACAGATGGAGAATGG + Intergenic
1015022177 6:128489859-128489881 CTGAAAATGCAGATGCAGAATGG - Intronic
1015734144 6:136379717-136379739 CTGAACTTCTTAATGGAGAAAGG - Intronic
1015842047 6:137487605-137487627 CTGAATAACCAGGAGGAGAAAGG + Intergenic
1015868093 6:137748073-137748095 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1019909081 7:4087821-4087843 CTGAATTTCCATCTGGAGAATGG + Intronic
1020201526 7:6083808-6083830 CTGAATATGCAGATTGAGTAAGG - Intergenic
1020811114 7:12851188-12851210 CTAAATTTGCACATGCAGAAAGG + Intergenic
1021149681 7:17134414-17134436 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1021769275 7:23982685-23982707 CTGAATCTAAAGATTGAGAAAGG + Intergenic
1022464884 7:30646957-30646979 CTGAATGGCCAGAGGGAGTACGG + Intergenic
1022636814 7:32144006-32144028 CTGAATTGAGAGATGGAGATGGG + Intronic
1024224856 7:47318712-47318734 CTGATTATCATGATGGAGAATGG + Intronic
1025527456 7:61833725-61833747 CTAAATTTCCATTTGTAGAATGG + Intergenic
1026263999 7:68780537-68780559 GTGAATTTCCATATGGAGATGGG - Intergenic
1026406931 7:70075689-70075711 CTGATTTTCATAATGGAGAAGGG + Intronic
1027724053 7:81780867-81780889 CTGATTTTGAAGATGGAGAAAGG + Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029301098 7:99582908-99582930 CCAAATATCCAGATGGGGAAAGG - Intronic
1030321531 7:108173449-108173471 GTTAAATTCCATATGGAGAAGGG + Intronic
1030384340 7:108849331-108849353 ATGGATTGCCAGATGTAGAAAGG - Intergenic
1030608933 7:111668134-111668156 CAGATTTTGAAGATGGAGAAAGG + Intergenic
1030629100 7:111875658-111875680 CTGACTTTGAAGATGGAGGAAGG + Intronic
1030931004 7:115523443-115523465 GTGAATTTCCAGTTGTAAAAAGG - Intergenic
1030984435 7:116224340-116224362 CTGAATTTCTAGATTCATAATGG - Intronic
1031910412 7:127511160-127511182 CTGGCTTTACACATGGAGAAAGG + Intergenic
1031915440 7:127558756-127558778 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1031974423 7:128084826-128084848 CCAAATTTGTAGATGGAGAATGG + Exonic
1032295040 7:130629366-130629388 ATAAAATTCCAGAAGGAGAAAGG - Intronic
1032597851 7:133259932-133259954 CTGTATTTCCAGCTGGACAGTGG - Intronic
1035070166 7:156138615-156138637 CTGAATGTGCTGATGGAGGAGGG + Intergenic
1037358112 8:18044299-18044321 CTGACTTTGAAGATGGAAAAAGG - Intergenic
1038032360 8:23653622-23653644 TTGAGTTTCCAGATGGAGGTGGG + Intergenic
1039351982 8:36773024-36773046 CTTATTTTCTAGCTGGAGAAGGG + Intergenic
1039665918 8:39527959-39527981 CTGAAGTTCCTGTTGGAGGAAGG - Intergenic
1039741202 8:40384522-40384544 CTGATTTTGAAGATGGTGAATGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1039997925 8:42550530-42550552 CTGGCTTTGCAGATGGAGGAAGG - Intronic
1040101988 8:43513670-43513692 CTTTATGTCCAGATGCAGAAAGG + Intergenic
1041800537 8:61793007-61793029 CTGGAATTTGAGATGGAGAAAGG + Intergenic
1041957362 8:63570745-63570767 CTGACTTTGAAGATGGAGAAGGG + Intergenic
1042153719 8:65818828-65818850 ATGAATTTCCAGAGGTACAAGGG - Intronic
1042366924 8:67947814-67947836 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1042708713 8:71691050-71691072 CTGACTTTGAAGATGGAGAAAGG - Intergenic
1042791603 8:72613796-72613818 CTGAATTTACAGCAGAAGAAAGG - Intronic
1043446682 8:80326004-80326026 CTGACTTTGGAGATTGAGAAAGG - Intergenic
1043716040 8:83488109-83488131 CTGAATTTCAAAAGGGAAAAGGG + Intergenic
1044009122 8:86970259-86970281 GTGAAATTCCAGAAGGAGTAGGG - Intronic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044715648 8:95097199-95097221 TCAAATTTCCAAATGGAGAATGG + Intronic
1045206577 8:100048182-100048204 CTAAATGTCCAAATGGAGAATGG + Intronic
1045628462 8:104085905-104085927 CTGTATTTCCAGATGCTGACAGG - Intronic
1046501620 8:115085088-115085110 CTGACTTTGAAGAAGGAGAAAGG + Intergenic
1046704258 8:117433392-117433414 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1047241830 8:123097389-123097411 AAGAAATTCCAGATGGCGAATGG - Exonic
1047451310 8:124967363-124967385 CAGAACTTCCAGCTGGAGGATGG - Intergenic
1048316619 8:133367833-133367855 CTGGATTTCAAGAGGGAGGAAGG + Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048937927 8:139372373-139372395 CTGGATTTGCAGATGGGGGAAGG - Intergenic
1049398345 8:142412339-142412361 CTCATTTTCCAGATGGGAAAAGG - Intergenic
1049582491 8:143418952-143418974 CTGCATTTGAAGATGAAGAAAGG - Intergenic
1049667732 8:143854455-143854477 TTGAAGTTCCAGAAGGGGAATGG + Intergenic
1050127893 9:2378442-2378464 CTGGCTTTAAAGATGGAGAAAGG + Intergenic
1051368272 9:16336614-16336636 CTGAATTTCAAGATGGCGACAGG - Intergenic
1051975080 9:22939308-22939330 CTGACTCTGAAGATGGAGAAAGG + Intergenic
1051983570 9:23054848-23054870 CTGGATATCCAGATGCAAAAAGG + Intergenic
1052380779 9:27768478-27768500 CAGAATTTACAGATGGAAAGTGG - Intergenic
1052410979 9:28120668-28120690 CAGAATTTCTAGATGTAAAATGG + Intronic
1055205438 9:73723774-73723796 ATGAATTTCCAGTTGTACAAAGG + Intergenic
1056160562 9:83887497-83887519 TAAAATTTCCAGATGGAGAGAGG + Intronic
1056488508 9:87082885-87082907 CAGAATTTCCAGAAGGTGAATGG - Intergenic
1058554561 9:106153058-106153080 CTTCATTTCCTCATGGAGAAAGG + Intergenic
1058769074 9:108212758-108212780 CCACATTTCCAAATGGAGAAAGG + Intergenic
1058816126 9:108684342-108684364 CTCATTCTCCATATGGAGAAGGG - Intergenic
1059150535 9:111945826-111945848 ATAAATTTCCAGAAGGAAAAAGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059443492 9:114324049-114324071 CTGAATGTCCAGCGGGAAAATGG + Exonic
1059444682 9:114330823-114330845 CTGAATGTCCAGCGGGAGAATGG + Exonic
1060033407 9:120234783-120234805 CTGATTTTGTAGATGGGGAATGG - Intergenic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1062333975 9:136056862-136056884 CTTTCTTCCCAGATGGAGAAGGG + Intronic
1185839661 X:3376826-3376848 CTGGCTTTGCAGATGGAGAAAGG - Intergenic
1185944724 X:4362386-4362408 CTGAATTTCCAGAGGTATACTGG - Intergenic
1186880152 X:13857008-13857030 CTGACTTTGAAGATGGAGAAAGG - Intronic
1188638510 X:32466731-32466753 CTGACTTTGAAGATGGAGGATGG + Intronic
1188675024 X:32929015-32929037 ATGGATTTCGGGATGGAGAAAGG + Intronic
1189188081 X:39071140-39071162 CTGAATTCCAAAAGGGAGAAGGG + Intergenic
1189380238 X:40497562-40497584 CTGCATTTCCAGAATGGGAAGGG - Intergenic
1189730139 X:44011613-44011635 CTGGCTTTGAAGATGGAGAAAGG - Intergenic
1189917275 X:45868261-45868283 CTGACTGTGAAGATGGAGAAAGG + Intergenic
1190791630 X:53706064-53706086 CTGACTTTGAAGATGGAGGAGGG + Intergenic
1191724885 X:64268895-64268917 CTGAATACCCTGATGGAGAATGG - Exonic
1191785668 X:64915001-64915023 GTGAAATGCCAAATGGAGAAAGG + Intergenic
1192035090 X:67554371-67554393 GTGCATTTCTAGATGGGGAAAGG + Intronic
1192860873 X:75069137-75069159 CTGAAATTGGAGATGAAGAAAGG + Intronic
1193424000 X:81318643-81318665 CTGAATTTCCATATACAGAAGGG - Intergenic
1194026025 X:88752062-88752084 CTGAATTCCATGGTGGAGAAAGG - Intronic
1194129230 X:90059611-90059633 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1194567941 X:95517026-95517048 CTTTGTTTCCAGATGGAGAAGGG + Intergenic
1194829274 X:98600673-98600695 CTGAGGTTCCAGATAAAGAAAGG - Intergenic
1194960878 X:100234286-100234308 CTGACTTTGAAGATGGAGAAAGG + Intergenic
1195026513 X:100882990-100883012 CTGACTTTGAAGATAGAGAAAGG + Intergenic
1195788833 X:108559107-108559129 CTGGATTTCCAGGTCCAGAAGGG + Exonic
1196398555 X:115290688-115290710 CTGACTTTAGAAATGGAGAAGGG + Intronic
1196963769 X:121032750-121032772 CTGAATTTGAAGATGAAGGACGG - Intergenic
1198025375 X:132700715-132700737 TTCAATCTTCAGATGGAGAATGG + Intronic
1198301357 X:135336688-135336710 CTGAACTTCCTTATGGAGAGAGG + Intronic
1199763815 X:150926035-150926057 CTGGCTTTGCAGATGGAGGAAGG + Intergenic
1199941554 X:152632699-152632721 CAGCCTTTCCAGATGGAGAAAGG + Intergenic
1201236155 Y:11914039-11914061 CTGGCTTTGCAGATGGAGAAAGG + Intergenic
1201290130 Y:12414667-12414689 CTGAATTCCAAAATGGAGGAGGG - Intergenic
1201690097 Y:16753488-16753510 CTTAATTTCCATATAGAGCATGG + Intergenic