ID: 965742964

View in Genome Browser
Species Human (GRCh38)
Location 3:171896008-171896030
Sequence CAGTTCATCTGGAAGCTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 242}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965742964 Original CRISPR CAGTTCATCTGGAAGCTGGG CGG Intronic
900449912 1:2700770-2700792 ATGTTCATCTGGAAGCAGTGGGG - Intronic
900453369 1:2761721-2761743 ATGTTCATCTGGAAGCAGTGGGG - Intronic
901017440 1:6240096-6240118 CTGTCCATATGGAAGCTGAGAGG + Intergenic
901351124 1:8597824-8597846 GAGTTCTTCTGGAAGATGGACGG - Intronic
901556774 1:10037938-10037960 TAGTTCATCTGCAAGATGGTTGG + Intronic
901791071 1:11654026-11654048 CAGACCCTCAGGAAGCTGGGAGG + Intronic
902877396 1:19349204-19349226 AAGTTCTTTTTGAAGCTGGGTGG - Intronic
904113502 1:28145015-28145037 CAGAACATCTTGGAGCTGGGAGG - Intergenic
905675880 1:39824734-39824756 CAGTTCCTCTGGAGGCTCTGGGG - Intergenic
906925017 1:50106232-50106254 CAGTCCATCTGGACTCTGTGTGG + Intronic
907752685 1:57278388-57278410 TATATCATCTGAAAGCTGGGAGG - Intronic
911399017 1:97351245-97351267 CACTGCATCTGGAAGCTGACAGG + Intronic
915014167 1:152717945-152717967 AGGTTCATTTGGAAACTGGGTGG - Intergenic
916491956 1:165309716-165309738 AAGTTCATGGGGAAGGTGGGTGG - Intronic
917482165 1:175421788-175421810 CAGTTTAGCTTGAAGCTGGTGGG - Intronic
917952248 1:180051265-180051287 CAGTTCATCTGGTAGAGCGGAGG - Intronic
919556948 1:199068769-199068791 TAATTCATCTGGGTGCTGGGTGG + Intergenic
920307830 1:205030398-205030420 TAGCTCATGTGGAAGGTGGGGGG - Intergenic
920500358 1:206481424-206481446 CAGTTGATGGGGCAGCTGGGAGG + Intronic
922497901 1:226074729-226074751 AAGTTTATCTGGAGGCTGTGCGG - Intergenic
924954962 1:248917323-248917345 CAGTTCATCCGGATGATGAGAGG - Exonic
1063371654 10:5526186-5526208 CTATTCATCTGGAAGGAGGGAGG + Exonic
1064835295 10:19521088-19521110 CAGTTCATTTGGAATCTTGGAGG + Intronic
1068250964 10:54439573-54439595 AAGTTCATTTGGAAGCAGTGGGG + Intronic
1069230677 10:66005515-66005537 CAATTCATATCGAAGGTGGGTGG + Intronic
1069546701 10:69334357-69334379 CAGTTCCTCTGGTAGCTTGCAGG + Intronic
1072787356 10:98293334-98293356 CTTTTCCTCTGGATGCTGGGGGG + Intergenic
1072816556 10:98515101-98515123 CAGGGAATCTGAAAGCTGGGTGG + Intronic
1072913679 10:99523996-99524018 CAGTTTATGTGGGGGCTGGGTGG + Intergenic
1073493523 10:103871352-103871374 CATTTCATCTGGAAACGGGTTGG - Intergenic
1074751844 10:116594513-116594535 CAATTAATCTGCAAGCTGGAGGG + Intronic
1075842217 10:125514901-125514923 CAGTTCTTTTGTAAGCAGGGAGG + Intergenic
1076077446 10:127546201-127546223 TAGGTCATCTGGAAGCTGGTAGG + Intergenic
1076747055 10:132519779-132519801 CAGTTCCTCAGGAAGCCTGGAGG + Intergenic
1077603043 11:3587071-3587093 CAGGTGTTTTGGAAGCTGGGTGG + Intergenic
1077881093 11:6350966-6350988 CAGTTGATCAGGAAGCAGGATGG + Intergenic
1078042067 11:7875946-7875968 CTCTCCAACTGGAAGCTGGGAGG - Intergenic
1078085249 11:8229951-8229973 CACCTGATCTGGAATCTGGGAGG - Intronic
1083362055 11:62116603-62116625 CACTCCCTCTGGAGGCTGGGAGG + Intergenic
1083785098 11:64940369-64940391 CACTCCTTCTGGGAGCTGGGGGG + Intronic
1084258923 11:67961609-67961631 CAGGTGTTTTGGAAGCTGGGTGG + Intergenic
1084813825 11:71633569-71633591 CAGGTGTTTTGGAAGCTGGGTGG - Intergenic
1085766507 11:79287852-79287874 CACTGCATCAGGAAGCTGTGGGG + Intronic
1086283058 11:85213381-85213403 CAGGACAACTGGAAGCTGAGTGG + Intronic
1087794342 11:102439337-102439359 TCCTTCCTCTGGAAGCTGGGAGG - Intronic
1089127948 11:116190692-116190714 CAGGGCCTCAGGAAGCTGGGAGG - Intergenic
1089154092 11:116387249-116387271 CAGATCACCTGGAAGCTTGTTGG + Intergenic
1089774836 11:120828873-120828895 CAGTTTATCTGACATCTGGGGGG + Intronic
1092430248 12:8402616-8402638 CAGGTGTTTTGGAAGCTGGGTGG + Intergenic
1094421370 12:30274676-30274698 CAGGACACCTTGAAGCTGGGTGG + Intergenic
1094467680 12:30770994-30771016 CAGGGCATCTTGAAGCAGGGAGG - Intergenic
1101698675 12:107151373-107151395 CAGAACATCTTGAAGCAGGGAGG + Intergenic
1102079644 12:110087416-110087438 CAGCTACTCTGGAAGCTGGGTGG + Intergenic
1102591966 12:113963107-113963129 CAGTCCTTCTGGAAGCTCTGTGG - Intronic
1103350119 12:120278214-120278236 CCCTTCATCTGGGAGGTGGGGGG - Intergenic
1103463327 12:121122535-121122557 CAGCTACTCTGGAAGCTGGGTGG - Intergenic
1103546031 12:121702192-121702214 CAGTTACTCAGGAAGCTGAGGGG + Intergenic
1104464986 12:128983052-128983074 CAGCTCATCAGGAAGCTGGAAGG + Exonic
1107406589 13:40120164-40120186 CAGTTCAGCTGGGAGCTGACGGG + Intergenic
1109466792 13:62745129-62745151 GATTTCATGTGGAAGCAGGGTGG - Intergenic
1110585858 13:77191762-77191784 CTGTTCTCCTGCAAGCTGGGTGG - Exonic
1113440741 13:110326185-110326207 CAGTCCCTGTGGAACCTGGGAGG + Intronic
1113502356 13:110786615-110786637 CAGCTCACCTGGTAACTGGGTGG + Intergenic
1114413924 14:22526308-22526330 CAGTGGATATGGCAGCTGGGAGG + Intergenic
1115629933 14:35234790-35234812 CAGCTACTCTGGGAGCTGGGTGG - Intronic
1115705141 14:35990607-35990629 CAGGTACTCTGGAGGCTGGGAGG + Intergenic
1117989072 14:61416167-61416189 CAGCTACTCAGGAAGCTGGGTGG - Intronic
1120651529 14:87139565-87139587 CAGATGATCTGGAAACTTGGGGG - Intergenic
1121112699 14:91323240-91323262 CAGTTACTCTGGTTGCTGGGGGG - Intronic
1121851658 14:97226856-97226878 CAGGCCATCTGCAAGCTGAGGGG - Intergenic
1121972047 14:98367257-98367279 CAGTACAGTTGGGAGCTGGGGGG + Intergenic
1122518555 14:102326280-102326302 CTGTTCATCTGGAGCCTTGGGGG - Exonic
1123760030 15:23424824-23424846 CAGTTCATCTTGAATTTTGGTGG - Intergenic
1124456474 15:29847214-29847236 CAGCTACTCTGGAAGCTGAGAGG - Intronic
1125753222 15:42044814-42044836 GAGATCATCTGGCTGCTGGGTGG + Intronic
1125880752 15:43192538-43192560 CATTTCACTAGGAAGCTGGGGGG - Intronic
1125932513 15:43610674-43610696 CTTTTCATCTGAAAGCAGGGTGG + Intronic
1125945611 15:43710146-43710168 CTTTTCATCTGAAAGCAGGGTGG + Intergenic
1126572896 15:50170498-50170520 CAGTTCTTGTGGAGGGTGGGGGG - Intronic
1127943060 15:63720366-63720388 CAGTCCCTCTGGGAGCAGGGTGG - Intronic
1128031612 15:64485689-64485711 CAGCTATTCTGGAAGCTGAGAGG + Intronic
1129186632 15:73911271-73911293 CAATTCAGCTGGGATCTGGGAGG - Intergenic
1129311235 15:74710789-74710811 AATTTCATCTGGAAAATGGGGGG - Intergenic
1129425594 15:75460250-75460272 CAGTGCAGCTGGCAGCTGGAGGG - Intergenic
1129655831 15:77525324-77525346 CAGTTCTCCTGGAAGGAGGGAGG + Intergenic
1129803723 15:78437307-78437329 CAGTACATTTAAAAGCTGGGCGG + Intergenic
1130984492 15:88836185-88836207 TAGTTCACCTGGAAGAGGGGAGG - Exonic
1132173566 15:99688929-99688951 AAGTTCATCTGGGGGCTGGAGGG + Intronic
1132402259 15:101519799-101519821 CCATCCACCTGGAAGCTGGGAGG - Intronic
1132483977 16:180856-180878 CCGCTCACCTGGAAGCTGGCCGG - Exonic
1133365939 16:5210256-5210278 CAGGTGTTTTGGAAGCTGGGTGG - Intergenic
1133727340 16:8549893-8549915 CAGTCCATCTGCAAGCTGAGGGG + Intergenic
1134188247 16:12100816-12100838 CAGGTCATCTGGCCCCTGGGTGG + Intronic
1134654442 16:15937424-15937446 CAGCTACTTTGGAAGCTGGGAGG - Intergenic
1135056473 16:19236147-19236169 CAATTCATGAGGAAGCTGTGTGG + Intronic
1135963337 16:27015737-27015759 CAGTTAAGCTGGAAGCTTTGTGG - Intergenic
1136066581 16:27762895-27762917 CAGATAATCTGGCAGGTGGGTGG - Intronic
1136392877 16:29976399-29976421 CAGCCCAACTGGAAGCTGGAGGG - Intronic
1137390610 16:48078345-48078367 CAGTTCACATTGAAGCAGGGAGG - Intergenic
1137620024 16:49869914-49869936 CAGAGCATCTGGAAATTGGGAGG + Intergenic
1138199918 16:55080934-55080956 CACTTCTTCTGCCAGCTGGGAGG + Intergenic
1138294053 16:55871826-55871848 CAGTTCTTCTGACAGCGGGGAGG + Intronic
1140696657 16:77541312-77541334 CAGTTCATCTGGGACCTGACTGG + Intergenic
1145738988 17:27256159-27256181 CCGGTCCTCTGGAAGCTGGAAGG + Intergenic
1146446543 17:32936954-32936976 CAGTTAGCCTGGAATCTGGGAGG - Intronic
1148209278 17:45798594-45798616 CAGTACATCTGGAACCTTGGAGG + Intronic
1148889039 17:50794517-50794539 CAGTTCATCTGGCAGTAGAGGGG - Intergenic
1149895262 17:60424088-60424110 CAGTTCATGTGAGAGCTGGTTGG - Intronic
1153014127 18:568061-568083 AAGTTCACCTGGAAAATGGGTGG + Intergenic
1153137021 18:1928846-1928868 CAGTTCTTCTTGAAACTGTGTGG + Intergenic
1153630736 18:7067495-7067517 CGGTTCCTCTGGCTGCTGGGAGG + Intronic
1156582168 18:38390468-38390490 AAGTTCATCTGGAAAATGAGAGG + Intergenic
1157736454 18:50054079-50054101 CAGTGCATCTGGGAGCTGTCGGG - Intronic
1159029536 18:63217012-63217034 CAGAGAATCTTGAAGCTGGGAGG - Intronic
1162555478 19:11383464-11383486 CAGCTCAGCTGGCCGCTGGGTGG - Intronic
1162894800 19:13758860-13758882 CATTTCATCCGGAACCTGGGAGG - Exonic
1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG + Intronic
1164694666 19:30234321-30234343 CTCTTCAGCTGGATGCTGGGAGG + Intronic
1164878495 19:31711011-31711033 CAGCTACTCAGGAAGCTGGGAGG - Intergenic
1166814907 19:45538305-45538327 CAGCTCATCAGGAGGCTGAGGGG + Intronic
1167056688 19:47115500-47115522 CAGTTACTCGGGAAGCTGAGGGG + Intronic
1167120055 19:47511422-47511444 CAGCTCCTCTGGGAGCTGGAAGG + Intronic
928374816 2:30765584-30765606 CCTTTCATCTGGAAGCTGCAGGG + Intronic
934167356 2:89306429-89306451 CAGGGCAACTGGAAGCAGGGAGG - Intergenic
934199919 2:89876015-89876037 CAGGGCAACTGGAAGCAGGGAGG + Intergenic
937204530 2:120226976-120226998 CAGAGCAGCTGGAAGCTGGTGGG + Intergenic
938036557 2:128039614-128039636 AAGTTCGGCTGCAAGCTGGGCGG + Intergenic
940733085 2:157416926-157416948 CAGTTAGTGTGGAAGCAGGGAGG - Intronic
942104749 2:172621460-172621482 CAGGCCATCTGCAAGCTGAGGGG - Intergenic
942152244 2:173088337-173088359 CAGTACGGTTGGAAGCTGGGAGG + Intronic
942204224 2:173603362-173603384 CAGAGCATTTGAAAGCTGGGCGG + Intergenic
943241949 2:185396665-185396687 CAGTTCAGCTGCAGGCTGTGTGG - Intergenic
945168155 2:206967835-206967857 AATTTCATCTGGAAGCCAGGTGG + Intronic
946556224 2:220860632-220860654 CAGGCCATCTGCAAGCTGAGGGG - Intergenic
946572825 2:221043149-221043171 CAGACCATGTGGAAGCTTGGTGG - Intergenic
948047606 2:234955642-234955664 CTGTTCACCTGGAAGATGGGAGG - Intronic
1168893078 20:1306946-1306968 CATCTCATCTGCAGGCTGGGAGG + Exonic
1169056514 20:2626303-2626325 CAGCTCAGCTGGAGGCTGGAGGG + Intronic
1169290186 20:4343088-4343110 AAACTCATGTGGAAGCTGGGTGG - Intergenic
1169389457 20:5177789-5177811 AATTCCATCTGGAGGCTGGGAGG - Intronic
1169885919 20:10397693-10397715 CAGTTCAAATGGGACCTGGGTGG + Intergenic
1170576298 20:17664205-17664227 CAGTGGATCTGAAAGCTGAGAGG + Intronic
1172221851 20:33279642-33279664 TACTTCATCTGGAAAATGGGAGG + Intronic
1172385327 20:34530120-34530142 GAGTTCATGTGGAAGCCTGGGGG - Intronic
1174570713 20:51499187-51499209 CAGATCCTCTGGCAGCTGTGTGG + Intronic
1174616895 20:51842519-51842541 CAGTTGGTCTGAAAGCTGGGAGG + Intergenic
1175984287 20:62756205-62756227 GACTACATCTGGCAGCTGGGAGG + Intronic
1177899164 21:26892297-26892319 CAGCACATCTGGAAACTGGGTGG + Intergenic
1178480223 21:32973990-32974012 CAGCTCCTCAGGAGGCTGGGAGG + Intergenic
1179024621 21:37669215-37669237 CAGGACAACTGGAAGGTGGGGGG - Intronic
1181150983 22:20883375-20883397 AATTTCATCTGGAAAATGGGTGG - Intronic
1181808927 22:25391841-25391863 GTGTTCCTCTGGAGGCTGGGTGG + Intronic
1181899565 22:26142046-26142068 CAGTCCCTCTGGAGGCTGGCTGG - Intergenic
1182042238 22:27247285-27247307 CAGTTCACCTGGAAGCCGTTAGG + Intergenic
1182341362 22:29623849-29623871 CAGTTCTTCTGAAAGATGAGGGG + Intronic
1184199347 22:42955345-42955367 CAGTTCACCTGGATGCTGGCTGG - Intronic
1184268706 22:43364968-43364990 AACCTCATCTGGAAGGTGGGAGG + Intergenic
1185406197 22:50652905-50652927 CAGGACAACTGGAAGCGGGGAGG - Intergenic
950228489 3:11255689-11255711 CAGGACAACTGGAAGCCGGGAGG + Intronic
950586508 3:13895922-13895944 CAGTTCACCTGGGAGCGGGTGGG + Intergenic
951269593 3:20608204-20608226 CAGTTTGTGTGGGAGCTGGGTGG + Intergenic
952192863 3:31042518-31042540 CGGGTCATTTGGAAGGTGGGGGG + Intergenic
957037986 3:75312660-75312682 CAGTACATCAGGAAGCAGGTGGG - Intergenic
957073876 3:75586129-75586151 CAGGTGTTTTGGAAGCTGGGTGG + Intergenic
958985625 3:100776761-100776783 CAGTTCTTCTTCAGGCTGGGTGG + Intronic
961280209 3:125760591-125760613 CAGGTGTTTTGGAAGCTGGGTGG - Intergenic
961874195 3:130008956-130008978 CAGGTGTTTTGGAAGCTGGGTGG + Intergenic
965742964 3:171896008-171896030 CAGTTCATCTGGAAGCTGGGCGG + Intronic
968726641 4:2250958-2250980 CAGTGCAGCAGGGAGCTGGGAGG + Intronic
968821176 4:2852811-2852833 CAGCTGCTCAGGAAGCTGGGTGG - Intronic
969198740 4:5584836-5584858 CAATTCACCTCGAACCTGGGAGG + Exonic
969736484 4:8994866-8994888 CAGGTGTTTTGGAAGCTGGGTGG - Intergenic
969795677 4:9526429-9526451 CAGGTGTTTTGGAAGCTGGGTGG - Intergenic
971630880 4:28992451-28992473 CAGTTCAGCTGTAATCTGGTTGG - Intergenic
971730053 4:30366967-30366989 CATTTTATCTGCAAGCTGGGTGG + Intergenic
974508653 4:62808544-62808566 CAGGCCATCTGCAAGCTGAGGGG + Intergenic
974794301 4:66729052-66729074 CAGTTCATCTGGTAGCTTGCAGG + Intergenic
974935414 4:68404950-68404972 CAGGACAACTGGAAGCTTGGAGG - Intergenic
974935976 4:68410310-68410332 CAGGACAACTGGAAGCTTGGAGG - Intergenic
976716579 4:88129105-88129127 AAGTCCACCTGGAGGCTGGGAGG - Intronic
977968598 4:103186367-103186389 CAGTTCATCTGAAATCTGGCGGG - Intronic
978768656 4:112431314-112431336 TAGTTCCTCTGCAAGCTGGGAGG + Exonic
980988266 4:139716422-139716444 TAGTTCATCTGGAGGTAGGGAGG - Intronic
981391150 4:144193259-144193281 CAAGTCATATGGAAGCTGGCTGG + Intergenic
981857670 4:149313564-149313586 CAGTTAGACTGGAAGCTGGCTGG + Intergenic
985854151 5:2412023-2412045 CACTTCATCTCCAAGCTGAGAGG + Intergenic
988295945 5:29362258-29362280 TGGTTCATCTGGCATCTGGGTGG + Intergenic
990633541 5:57697134-57697156 CAGTTCAGCCCGAAGCTGGCTGG + Intergenic
992190219 5:74284679-74284701 CAGAGCATCAGGAAGCAGGGTGG - Intergenic
992617309 5:78557295-78557317 CTATTCATCTGGAAACTGGCAGG - Intronic
995405304 5:111787982-111788004 CAGCTACTTTGGAAGCTGGGAGG + Intronic
995730658 5:115237857-115237879 CCCTTCAGCTGGAAGATGGGAGG - Exonic
997788361 5:136734259-136734281 CAATTCAGCTGGCAGATGGGTGG - Intergenic
998673424 5:144379533-144379555 GAGTTCATTTGGGAGCTTGGGGG + Intronic
999339135 5:150753570-150753592 TGGGTCATCTGGAAGCTGTGTGG + Exonic
1001006481 5:168055515-168055537 CAGTACATCTGCAGACTGGGAGG - Intronic
1001443557 5:171764538-171764560 CAGTGCACCTGGTAGGTGGGAGG - Intergenic
1002939492 6:1703656-1703678 CAGTACACCTGGCAGCTGTGGGG - Intronic
1004758366 6:18638552-18638574 CAGATACTTTGGAAGCTGGGAGG + Intergenic
1006591881 6:35164268-35164290 CAGTCCATCTGGAGGCTTTGGGG - Intergenic
1007392578 6:41558623-41558645 CAGTTCATCTGGCAAATGAGTGG + Intronic
1009049127 6:58257985-58258007 CACCTCATCTGGGAGGTGGGGGG + Intergenic
1012556346 6:100517260-100517282 CTGTTCATCTGGATGAGGGGTGG - Intronic
1012788013 6:103657211-103657233 CAGTGGATCTGGAAGTTGGCTGG - Intergenic
1012952198 6:105530178-105530200 CAGTTCATCTGGAAGCCAGAGGG + Intergenic
1014550730 6:122787335-122787357 CAGGACAACTTGAAGCTGGGCGG + Intergenic
1015009710 6:128330743-128330765 CAGATCATGTTGAAGCTGAGGGG - Intronic
1015619737 6:135118512-135118534 CAGTGCAGTTGGAAGCTGGTTGG - Intergenic
1016804091 6:148195625-148195647 CAGTTCCCCTGGCAGGTGGGTGG + Intergenic
1016956851 6:149635162-149635184 CAGCTACTCTGGAGGCTGGGTGG + Intronic
1017630841 6:156395185-156395207 CAGTACTTTTGGAAGCTGAGAGG - Intergenic
1017708249 6:157144567-157144589 CAGATCATCTGGAAGCGAAGGGG + Intronic
1018698857 6:166411752-166411774 CAGTCCAGCTGGAGGCTGGAGGG - Exonic
1018871149 6:167783339-167783361 GAGTTCATCTGGAACCTGAAGGG + Intergenic
1019188481 6:170235881-170235903 CAGTTTATCTGGAAAGTGAGTGG - Intergenic
1021757486 7:23867844-23867866 TAGTTACTCTGGAAGCTAGGAGG + Intergenic
1021806680 7:24364148-24364170 CTGTTATTCTGGAGGCTGGGTGG - Intergenic
1023576138 7:41629243-41629265 CATTTCATCTGAAAGTTGAGGGG + Intergenic
1023788835 7:43735965-43735987 TAGTGCATCTGGAAAGTGGGGGG + Intergenic
1024328984 7:48137950-48137972 CAGGACAACTAGAAGCTGGGAGG + Intergenic
1024648414 7:51386892-51386914 CAGGGCCGCTGGAAGCTGGGCGG + Intergenic
1024648946 7:51388965-51388987 CAGGGCCGCTGGAAGCTGGGCGG + Intergenic
1026798695 7:73383227-73383249 CAGGTCAGCTGGGAGCTGGCTGG - Intergenic
1029075953 7:97934269-97934291 CAGGTGTTTTGGAAGCTGGGTGG + Intergenic
1029926803 7:104327870-104327892 CAGTTCAGCTGGCTGCTTGGGGG + Intergenic
1030079607 7:105765971-105765993 TAGTTAATCTGGCAGCTGTGGGG + Intronic
1031475939 7:122221802-122221824 CATTTCATCTGGATGTTTGGGGG + Intergenic
1036241566 8:7086070-7086092 CAGGTGTTTTGGAAGCTGGGTGG - Intergenic
1036260272 8:7234047-7234069 CAGGTGATTTGGAAGCTGGGTGG + Intergenic
1036306345 8:7605476-7605498 CAGGTGATTTGGAAGCTGGGTGG - Intergenic
1036312309 8:7692603-7692625 CAGGTGATTTGGAAGCTGGGTGG + Intergenic
1036357191 8:8053461-8053483 CAGGTGATTTGGAAGCTGGGTGG - Intergenic
1036901378 8:12671792-12671814 CAGGTGTTTTGGAAGCTGGGTGG + Intergenic
1038187246 8:25286315-25286337 CAGTTAATCAGGAAGCTGCCTGG + Intronic
1039946791 8:42136686-42136708 CAGGTCAGCTGTTAGCTGGGTGG + Intergenic
1040442033 8:47453371-47453393 CAGTTCATATGGAACCAGAGGGG + Intronic
1041151458 8:54939658-54939680 CAAAGCATCTGGAAGCTGGTCGG - Intergenic
1044151128 8:88775796-88775818 TAGGTCATCTTGAAGCTGAGGGG - Intergenic
1045662937 8:104456837-104456859 CATTTCTTCTGGAAGCAGTGTGG - Intronic
1047617812 8:126577547-126577569 CAGCTACTCTGGAAGCTGAGGGG - Intergenic
1048040220 8:130720364-130720386 CAGTTCATTTTGCAGATGGGAGG + Intergenic
1048153030 8:131912210-131912232 CAGCTCATCTGAATCCTGGGTGG + Intronic
1049396801 8:142404711-142404733 CCCTTCAAGTGGAAGCTGGGGGG - Intergenic
1049563410 8:143324834-143324856 CAGTGCACCAGGAGGCTGGGCGG + Intronic
1049833967 8:144721159-144721181 CAGTTCATCTGGGGGTTGGTGGG + Exonic
1049982077 9:913558-913580 CAGTTCAGCTGGAAACTGGATGG + Intronic
1050531668 9:6595678-6595700 CACTTCAGCTGGGAGCGGGGTGG + Intronic
1052698625 9:31910848-31910870 CTGATCTTCTGGGAGCTGGGTGG + Intergenic
1053245790 9:36533669-36533691 CAGTTCCTCGGGAGGCTGAGGGG - Intergenic
1060876640 9:127088830-127088852 CAGTTCATCCTGAGGCTGGGAGG - Exonic
1061135747 9:128732310-128732332 CAGTACATCCGGGAGGTGGGAGG - Intronic
1061486661 9:130923775-130923797 CAGTACACCTGGAAGCCGGCCGG + Exonic
1061753028 9:132793881-132793903 CAGTTTCTCTGGAAGCTGCCTGG + Intronic
1186495322 X:10008341-10008363 CAGCTACTCTGGAAGCTGAGCGG + Intergenic
1187912590 X:24124622-24124644 CAGGAGATCTGGAAGGTGGGAGG + Intergenic
1190143758 X:47871844-47871866 CAGTTCTTCTGGATGCTGTTGGG - Intronic
1190580358 X:51887654-51887676 AAGTTCATTTGGCAGCGGGGAGG - Intronic
1192115046 X:68402050-68402072 CAGTTCATCTGGAATCAGTATGG + Intronic
1192500114 X:71645086-71645108 CAGTCCATCCGGGAGGTGGGGGG - Intergenic
1192925143 X:75748050-75748072 CATTTCATCTGTAAAATGGGGGG + Intergenic
1193372602 X:80714517-80714539 CAGGACAACTGGAAGGTGGGTGG - Intronic
1195213204 X:102670131-102670153 CAGTTCACCTGGGAGCTGCATGG - Intergenic
1195381486 X:104275137-104275159 GATTTCTTCTGGAAGCTGTGGGG + Intergenic
1195945984 X:110212245-110212267 CTGATCATCTGAAAACTGGGTGG + Intronic
1198414179 X:136403196-136403218 CATTTCATCAGGTAGCAGGGAGG - Intronic
1201453496 Y:14142426-14142448 CAGATTATCTTGAATCTGGGAGG - Intergenic