ID: 965743580

View in Genome Browser
Species Human (GRCh38)
Location 3:171901949-171901971
Sequence GACACTCTCTTGACTAGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 468}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965743568_965743580 30 Left 965743568 3:171901896-171901918 CCTCCAGCCAGAGCTCAAATAAA 0: 1
1: 0
2: 0
3: 8
4: 184
Right 965743580 3:171901949-171901971 GACACTCTCTTGACTAGGAAGGG 0: 1
1: 0
2: 0
3: 15
4: 468
965743569_965743580 27 Left 965743569 3:171901899-171901921 CCAGCCAGAGCTCAAATAAAGCC 0: 1
1: 0
2: 1
3: 7
4: 105
Right 965743580 3:171901949-171901971 GACACTCTCTTGACTAGGAAGGG 0: 1
1: 0
2: 0
3: 15
4: 468
965743572_965743580 5 Left 965743572 3:171901921-171901943 CCTGAAGCTTCCAGAGCCTCACC 0: 1
1: 0
2: 1
3: 27
4: 268
Right 965743580 3:171901949-171901971 GACACTCTCTTGACTAGGAAGGG 0: 1
1: 0
2: 0
3: 15
4: 468
965743575_965743580 -5 Left 965743575 3:171901931-171901953 CCAGAGCCTCACCAGGAGGACAC 0: 1
1: 0
2: 1
3: 14
4: 180
Right 965743580 3:171901949-171901971 GACACTCTCTTGACTAGGAAGGG 0: 1
1: 0
2: 0
3: 15
4: 468
965743571_965743580 6 Left 965743571 3:171901920-171901942 CCCTGAAGCTTCCAGAGCCTCAC 0: 1
1: 1
2: 2
3: 25
4: 219
Right 965743580 3:171901949-171901971 GACACTCTCTTGACTAGGAAGGG 0: 1
1: 0
2: 0
3: 15
4: 468
965743570_965743580 23 Left 965743570 3:171901903-171901925 CCAGAGCTCAAATAAAGCCCTGA 0: 1
1: 0
2: 1
3: 26
4: 282
Right 965743580 3:171901949-171901971 GACACTCTCTTGACTAGGAAGGG 0: 1
1: 0
2: 0
3: 15
4: 468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965743580 Original CRISPR GACACTCTCTTGACTAGGAA GGG Intronic
901310633 1:8266888-8266910 GACACTCTTTTAAATTGGAAAGG - Intergenic
905020318 1:34806336-34806358 GACGCTCTCCTCAATAGGAAGGG - Intronic
908939745 1:69417335-69417357 AACACTATGTTGAATAGGAATGG + Intergenic
910941003 1:92533892-92533914 AACACTATGTTGACTAGGAGTGG - Intronic
911120285 1:94289520-94289542 AACACTATGTTGAATAGGAATGG + Intergenic
912736826 1:112156826-112156848 AACACTATGTTGACTAGGAGTGG + Intergenic
913071446 1:115302688-115302710 GACACTCTCTAGACCAGACAAGG - Intronic
913362777 1:118000850-118000872 GACACTATGTTGAATAGGAGTGG + Intronic
913573054 1:120140815-120140837 GACAGGCTCTTGAGTAGGCAGGG - Intergenic
914294315 1:146305612-146305634 GACAGGCTCTTGAGTAGGCAGGG - Intergenic
914388181 1:147192540-147192562 AACACTCTGTTGAATAGGAGTGG + Intronic
914460009 1:147875042-147875064 AACACTCTGTTGAATAGGAGTGG + Intergenic
914555359 1:148756395-148756417 GACAGGCTCTTGAGTAGGCAGGG - Intergenic
915057025 1:153142492-153142514 AACACTCTGTTGAATAGGAGTGG + Intergenic
915618882 1:157066384-157066406 AACACTATGTTGAATAGGAATGG + Intergenic
917723230 1:177806188-177806210 AACACTATGTTGAATAGGAATGG - Intergenic
918041828 1:180918330-180918352 CACAACCTCTTGACTGGGAACGG - Intronic
918351662 1:183662173-183662195 AACACTATCTTGAATAGGAGTGG - Intronic
918967862 1:191374821-191374843 GACACTATTTTGAATAGGAGTGG + Intergenic
918973034 1:191444803-191444825 AACACTATGTTGAATAGGAATGG + Intergenic
919255013 1:195109756-195109778 AACACTATTTTGACTAGGAGTGG - Intergenic
919344062 1:196351733-196351755 AACACTATGTTGAATAGGAATGG + Intronic
920085846 1:203416081-203416103 AACACTATGTTGAATAGGAATGG - Intergenic
920311464 1:205051385-205051407 GAGACTGCCTTGCCTAGGAAGGG + Intronic
920853079 1:209642007-209642029 GGCACTCTCTTGACCAGGGAAGG - Intronic
924125505 1:240846505-240846527 GTCACCCTCTTCACTGGGAAGGG + Intronic
924130012 1:240897310-240897332 AACACTATGTTGAATAGGAATGG + Intronic
1064916231 10:20461704-20461726 AACACTATCTTGAATAGGAGTGG + Intergenic
1064970380 10:21060049-21060071 GACACTCTCTTCACTATGCTAGG + Intronic
1065047828 10:21759613-21759635 CACACCCTCTTTCCTAGGAATGG - Exonic
1065074632 10:22064813-22064835 AACACTATGTTGACTAGGAGTGG - Intergenic
1065237496 10:23668447-23668469 AACACTATGTTGAATAGGAATGG + Intergenic
1065254599 10:23853042-23853064 AACACTATGTTGACTAGGAGTGG + Intronic
1065406261 10:25369196-25369218 AACACTATGTTGACTAGGAGTGG + Intronic
1067240713 10:44490273-44490295 AACACTATATTGAATAGGAATGG - Intergenic
1068505611 10:57895912-57895934 AACACTATGTTGAATAGGAATGG + Intergenic
1071244064 10:83743258-83743280 GACACTATGTTGAATAGGAGTGG + Intergenic
1071323391 10:84487769-84487791 AACACTATGTTGAATAGGAATGG + Intronic
1071748350 10:88447125-88447147 AACACTGTGTTGAATAGGAATGG - Intronic
1071922547 10:90367828-90367850 AACACTATGTTGAATAGGAAGGG + Intergenic
1072384521 10:94910758-94910780 AACACTATGTTGAATAGGAATGG - Intergenic
1072869583 10:99103095-99103117 AACACTATGTTGACTAGGAGGGG - Intronic
1073017213 10:100410429-100410451 AACACTATGTTGACTAGGAGTGG - Intergenic
1073022608 10:100458554-100458576 AACACTATGTTGACTAGGAGTGG - Intergenic
1075157080 10:119987131-119987153 AACACTCTGTTGAATAGGAGTGG + Intergenic
1076023258 10:127091689-127091711 GACACGCTCTTCTCTGGGAAGGG - Intronic
1078046905 11:7922288-7922310 AACACTATGTTGAATAGGAATGG + Intergenic
1078115676 11:8447749-8447771 AACACTATGTTGAATAGGAATGG - Intronic
1079175512 11:18136801-18136823 GACACCCTCATGACCAGGACTGG - Intronic
1079179076 11:18172855-18172877 GACACACTCGTGACTAGGACTGG - Exonic
1079181309 11:18196152-18196174 GACACCCCCATGACTAGGAGTGG - Intronic
1079268342 11:18957393-18957415 GACACACTCGTGACTAGGACTGG + Intergenic
1079269771 11:18973082-18973104 GACACCCTCATGACTAGGACTGG + Intergenic
1079539178 11:21551370-21551392 AACACTATGTTGAATAGGAATGG + Intronic
1079675246 11:23218717-23218739 AACACTATGTTGAATAGGAATGG - Intergenic
1080163919 11:29213870-29213892 GTCTCTCTCTGGACTATGAAAGG - Intergenic
1080478979 11:32625942-32625964 AACACTATGTTGAATAGGAACGG - Intronic
1080484759 11:32694027-32694049 AACACTATGTTGAATAGGAATGG - Intronic
1080982910 11:37429923-37429945 AACACTATGTTGAATAGGAATGG + Intergenic
1081309100 11:41548887-41548909 AACACTTTCTTGAATAGGAGTGG - Intergenic
1081313532 11:41603003-41603025 AACACTATGTTGAATAGGAATGG - Intergenic
1081643466 11:44774133-44774155 GAGAGTCTCTTCAGTAGGAAAGG + Intronic
1082122243 11:48391785-48391807 GTCACTCCTTTGACTAGGAAAGG + Intergenic
1082273345 11:50195770-50195792 AACACTCTGTTGAATAGGAGTGG + Intergenic
1082317246 11:50745012-50745034 AACACTATGTTGAATAGGAATGG + Intergenic
1083383669 11:62290788-62290810 GACACTATGTTGAATAGGAGTGG - Intergenic
1083532730 11:63439273-63439295 AACACTATGTTGAATAGGAATGG - Intergenic
1083951139 11:65957020-65957042 GACTCTGTCCTGCCTAGGAAGGG + Intronic
1084173533 11:67411727-67411749 AACAGTCTCCTGAGTAGGAAAGG - Intronic
1085135296 11:74082015-74082037 AACACTATGTTGAATAGGAATGG + Intronic
1086505928 11:87504253-87504275 AACACTATCTTGAATAGGAGTGG + Intergenic
1086505938 11:87504313-87504335 AACACTATCTTGAATAGGAGTGG + Intergenic
1087576656 11:99998117-99998139 AACACTCTGTTGAATAGGAGTGG - Intronic
1087697474 11:101396385-101396407 GATACTATGTTGAATAGGAATGG + Intergenic
1088521190 11:110702498-110702520 AACACTATGTTGAATAGGAATGG - Intronic
1091151116 11:133328795-133328817 GACACTATGTTGAATAGGAGAGG - Intronic
1091213129 11:133881135-133881157 AACACTCTGTTGAATAGGAGTGG + Intergenic
1092170523 12:6371288-6371310 GCCACTCTCCTGAGTAGGAGTGG + Intronic
1092323723 12:7506994-7507016 AACACTATCTTGAATAGGAGTGG + Intergenic
1092649121 12:10613725-10613747 GACTTTCGCTTTACTAGGAATGG + Intergenic
1093085566 12:14863378-14863400 AACACTGTGTTGATTAGGAATGG + Intronic
1093243539 12:16707690-16707712 AACACTCTGTTGAATAGGAGTGG + Intergenic
1093302695 12:17475083-17475105 AACACTCTGTTGAATAGGAGTGG + Intergenic
1093325548 12:17770395-17770417 AACACTCTGTTGAATAGGAGTGG + Intergenic
1093332462 12:17859519-17859541 AACACTCTGTTGAATAGGAGTGG - Intergenic
1093605583 12:21084485-21084507 AACACTCTGTTGAATAGGAGTGG + Intronic
1093614892 12:21211089-21211111 AACACTCTGTTGAATAGGAGTGG + Intronic
1093620709 12:21285971-21285993 GACACTATATTGAATAGGAGTGG - Intronic
1093630199 12:21398987-21399009 AACACTCTGTTGAATAGGAGTGG - Intronic
1093632220 12:21423182-21423204 AACACTCTGTTGAATAGGAGTGG - Intergenic
1093660285 12:21748994-21749016 AACACTCTGTTGAATAGGAGTGG - Intronic
1093694075 12:22140497-22140519 AACACTCTGTTGAATAGGAGTGG - Intronic
1093782220 12:23149947-23149969 AACACTCTGTTGAATAGGAGTGG - Intergenic
1093802725 12:23393089-23393111 AACACTCTGTTGAATAGGAGTGG - Intergenic
1094162333 12:27404842-27404864 GTCACCCCTTTGACTAGGAAAGG - Intronic
1094481977 12:30890998-30891020 AACACTATGTTGACTAGGAGTGG + Intergenic
1094579288 12:31719083-31719105 GAGCTTCCCTTGACTAGGAAAGG + Intronic
1094710803 12:32960281-32960303 AACACTATGTTGAATAGGAATGG - Intergenic
1094745124 12:33335826-33335848 AACACTATGTTGAATAGGAATGG - Intergenic
1095067090 12:37791022-37791044 AACACTCTTTTGAATAGGAGTGG - Intergenic
1098691931 12:73500062-73500084 AACACTATGTTGACTAGGAGTGG + Intergenic
1099313608 12:81058367-81058389 AACACTGTGTTGAATAGGAATGG + Intronic
1099388577 12:82049947-82049969 AACACTATGTTGAATAGGAATGG - Intergenic
1099588839 12:84559195-84559217 GAAACTTTGTTGACTAGAAAGGG - Intergenic
1099740734 12:86630866-86630888 AACACTATGTTGAATAGGAATGG - Intronic
1101174878 12:102139511-102139533 AACACTATGTTGACTAGGAGTGG + Intronic
1104794079 12:131504717-131504739 AACACTATATTGAATAGGAATGG + Intergenic
1106070897 13:26409936-26409958 GACACTCTCTAGCCTTAGAAAGG + Intergenic
1106817231 13:33422058-33422080 AACACTGTGTTGAATAGGAATGG - Intergenic
1109101085 13:58184169-58184191 AACACTATGTTGAATAGGAATGG + Intergenic
1109691598 13:65899490-65899512 AACACTCTATTGAATAGAAATGG + Intergenic
1109694597 13:65937387-65937409 GACACTCTCTTGCTTCTGAAGGG - Intergenic
1110619239 13:77577165-77577187 AATACTCTCTTGACTAGAACTGG + Intronic
1110919881 13:81069990-81070012 GTCACCCCTTTGACTAGGAAAGG + Intergenic
1111786559 13:92794496-92794518 AACACTGTGTTGAATAGGAATGG - Intronic
1112456952 13:99571804-99571826 GTGACTCTGTTGACTGGGAACGG + Intergenic
1113332234 13:109340852-109340874 GACATCCTCTTAACTAGTAAAGG - Intergenic
1113803497 13:113098822-113098844 GACACTCTCCAGACCAGAAAAGG + Intronic
1113990962 14:16027007-16027029 CACACTTTCTTAACAAGGAATGG + Intergenic
1114079322 14:19189367-19189389 AACACTCTGTTGAATAGGAGTGG - Intergenic
1114386245 14:22258388-22258410 AACACTATGTTGAATAGGAATGG + Intergenic
1114684915 14:24519518-24519540 AACACTATGTTGAATAGGAATGG + Intergenic
1114800780 14:25773346-25773368 AACACTCTGTTGAATAGGAATGG + Intergenic
1115950371 14:38714416-38714438 AACACTGTGTTGAATAGGAATGG - Intergenic
1116285739 14:42969536-42969558 AACACTATGTTGACTAGGAGTGG + Intergenic
1116288075 14:42998648-42998670 AACACTATGTTGACTAGGAGTGG - Intergenic
1116306731 14:43266034-43266056 AACACTATGTTGACTAGGAGTGG - Intergenic
1116312646 14:43345365-43345387 AACACTATGTTGACTAGGAATGG - Intergenic
1116314904 14:43374244-43374266 AACACTATGTTGACTAGGACTGG - Intergenic
1116339431 14:43702616-43702638 AACACTGTGTTGACTAGGAGTGG - Intergenic
1116581439 14:46647237-46647259 GACATTCTATTTACTCGGAAAGG - Intergenic
1116583863 14:46677460-46677482 AACACTATGTTGAATAGGAATGG - Intergenic
1116675873 14:47905152-47905174 AACACTATGTTGAATAGGAATGG - Intergenic
1116736762 14:48701249-48701271 AACACTATGTTGACTAGGACTGG - Intergenic
1117082022 14:52161802-52161824 AACACTATGTTGAATAGGAATGG - Intergenic
1120559281 14:85971065-85971087 AACACTATGTTGAATAGGAATGG + Intergenic
1122220357 14:100234997-100235019 CACACTGTCTGGACTAGGCAAGG + Intergenic
1124668909 15:31619796-31619818 AACACTATGTTGAATAGGAATGG + Intronic
1125334162 15:38611366-38611388 GACACTCTCTTTTATAAGAAGGG + Intergenic
1125397184 15:39261890-39261912 AACACTCTGTTGAATAGGAGTGG - Intergenic
1125413006 15:39424536-39424558 AACACTCTGTTGAATAGGAGTGG - Intergenic
1125836813 15:42759241-42759263 GACACACCCTTGAGCAGGAAAGG + Intronic
1126086679 15:45017039-45017061 AACACTATGTTGAATAGGAATGG + Intergenic
1127032145 15:54875798-54875820 AACACTCTGTTGAATAGGAGTGG - Intergenic
1127948283 15:63777723-63777745 GATACTCTTTTGACCAAGAATGG - Intronic
1130024842 15:80262149-80262171 GAAACTCTCTGGAAGAGGAATGG + Intergenic
1130143276 15:81250917-81250939 TAAACTCTCTTTCCTAGGAAGGG + Intronic
1130912979 15:88283710-88283732 GACACTCTCTGGACTCTGGATGG - Intergenic
1131415494 15:92252652-92252674 AACACTATGTTGAATAGGAATGG - Intergenic
1131466462 15:92658905-92658927 GTCACTCTCTTGATTAAAAATGG - Intronic
1131555204 15:93392004-93392026 AACACTCTGTTGAATAGGAGTGG + Intergenic
1131556321 15:93403030-93403052 AACACTCTGTTGAATAGGATTGG + Intergenic
1132277102 15:100577139-100577161 AACACTCTGTTGAATAGGAGTGG - Intronic
1136695515 16:32077254-32077276 GACACTATGTTGAATAGGAGTGG - Intergenic
1136727394 16:32371428-32371450 AACACTATGTTGAATAGGAATGG - Intergenic
1136796011 16:33020499-33020521 GACACTATGTTGAATAGGAGTGG - Intergenic
1136873910 16:33833899-33833921 GACACTATGTTGAATAGGAGTGG + Intergenic
1137234601 16:46605106-46605128 GTCACTCTCTAGATTAGTAATGG - Intronic
1202999039 16_KI270728v1_random:146322-146344 AACACTATGTTGAATAGGAATGG + Intergenic
1203098269 16_KI270728v1_random:1282157-1282179 GACACTATGTTGAATAGGAGTGG - Intergenic
1203130637 16_KI270728v1_random:1682730-1682752 AACACTATGTTGAATAGGAATGG + Intergenic
1142538327 17:636445-636467 AACACTATGTTGAATAGGAATGG + Intronic
1143189690 17:5032484-5032506 GAGACTCACTTGAGTAAGAAAGG + Intergenic
1143737637 17:8924085-8924107 GACCCTGTCTTGAAAAGGAAAGG - Intronic
1146407399 17:32550943-32550965 GACACTCTGTTGCCTAGGGCTGG - Intronic
1147767748 17:42848249-42848271 GACATTCTTTTAACTATGAAAGG - Intronic
1149212596 17:54320785-54320807 AACACTATCTTGAATAGGAGTGG - Intergenic
1149240505 17:54643310-54643332 GACACTATGTTGAATAGGAGTGG - Intergenic
1149255774 17:54824777-54824799 AACACTATGTTGAATAGGAATGG - Intergenic
1154184350 18:12169162-12169184 AACACTATGTTGAATAGGAATGG + Intergenic
1162456175 19:10786383-10786405 GACACACTCATGTCTGGGAACGG - Intronic
1163223008 19:15935128-15935150 GCCACACTCTTGCCTTGGAAGGG - Intergenic
1164405884 19:27945721-27945743 AACACTGTGTTGAATAGGAATGG + Intergenic
1165011405 19:32850144-32850166 AACACTATGTTGAATAGGAATGG - Intronic
1165151130 19:33760912-33760934 GACAGTGTCTTAACCAGGAATGG - Intronic
1165182066 19:33979925-33979947 GACCCACTCTGGACTAGGAGAGG - Intergenic
926093136 2:10063334-10063356 GACACTAGTTTGACCAGGAAGGG + Intronic
926454233 2:13044420-13044442 AACACTGTGTTGAATAGGAATGG - Intergenic
926507518 2:13735291-13735313 AACACTATGTTGACTAGGAGTGG + Intergenic
926789792 2:16558784-16558806 GACAATTTCTTGACAAGGACAGG - Intronic
928576594 2:32661796-32661818 AACACTATGTTGAATAGGAATGG + Intronic
928631651 2:33199587-33199609 AACACTATGTTGAATAGGAATGG - Intronic
929276044 2:40025931-40025953 AACACTATGTTGAATAGGAATGG - Intergenic
930434508 2:51323394-51323416 AACTCTATCTTGAATAGGAATGG - Intergenic
930961960 2:57272879-57272901 AACACTATGTTGAATAGGAATGG + Intergenic
931037824 2:58263046-58263068 AACACTATGTTGAATAGGAATGG - Intergenic
931454195 2:62394536-62394558 AATACTATGTTGACTAGGAATGG - Intergenic
934209430 2:89962717-89962739 GACTCTCTCTTGAGGAAGAAGGG + Intergenic
935483471 2:103622725-103622747 GAGACTCACTTTACTAGTAAGGG + Intergenic
935930844 2:108123225-108123247 GACACTTTCTTGCTTAAGAATGG + Intergenic
936576533 2:113661156-113661178 AACACTATGTTGACTAGGAGTGG - Intergenic
936920986 2:117687948-117687970 GACACTACCTTGCCTAGGAGAGG - Intergenic
937606214 2:123804479-123804501 CAGCTTCTCTTGACTAGGAAAGG + Intergenic
938147913 2:128853051-128853073 AACACTATGTTGAATAGGAATGG - Intergenic
938871578 2:135482645-135482667 AACACTATGTTGAATAGGAATGG + Intronic
939942447 2:148366439-148366461 AACACTATGTTGAATAGGAATGG - Intronic
940470338 2:154089591-154089613 CCACCTCTCTTGACTAGGAATGG + Intronic
941095385 2:161235355-161235377 GTCACTGTCTTGATTAGGAAAGG - Exonic
941679636 2:168383479-168383501 GACACTCTCTTCAATAGTATTGG + Intergenic
941776912 2:169403247-169403269 AACACTATGTTGAATAGGAATGG - Intergenic
941981029 2:171457008-171457030 AACACACTGTTGAATAGGAATGG + Intronic
942004658 2:171686019-171686041 GACACTCGCTCAACTAAGAATGG - Intergenic
942410248 2:175702065-175702087 GACACTATGTTGAATAGGAGTGG + Intergenic
942467133 2:176220187-176220209 AACACTCTGTTGAATAGGAGTGG + Intergenic
942539554 2:177001463-177001485 GACACTCACTTGACCAGGCTGGG - Intergenic
943256030 2:185593847-185593869 AACACTATATTGAATAGGAATGG + Intergenic
943999115 2:194809990-194810012 AACACTATGTTGAATAGGAATGG - Intergenic
944030237 2:195226751-195226773 GACACTCTGTGGAGTAGGCATGG - Intergenic
944163298 2:196689774-196689796 AACACTATGTTGAATAGGAATGG + Intronic
947483552 2:230525648-230525670 TATACTCCCTTGTCTAGGAAAGG - Intronic
1170227500 20:14008084-14008106 AACACTATCTTGAATAGGAGTGG - Intronic
1171569771 20:26237656-26237678 AACACTATCTTGAATAGGAGTGG - Intergenic
1171770922 20:29322702-29322724 CACACTTTCTTAACAAGGAATGG - Intergenic
1173195894 20:40912523-40912545 GACACTGTCTTGAATATGGATGG - Intergenic
1174245000 20:49172501-49172523 GATATTTTCTTGACTATGAAGGG + Intronic
1174694910 20:52547359-52547381 AACACTATGTTGAATAGGAATGG - Intergenic
1176317208 21:5257452-5257474 ACCACTTTCTTTACTAGGAAAGG + Intergenic
1178960582 21:37061076-37061098 CAAACTCTCCTGACTAGAAAAGG + Intronic
1178967968 21:37142213-37142235 GACACTATGTTGAATAGGAGTGG - Intronic
1180316308 22:11280518-11280540 CACACTTTCTTAACAAGGAATGG - Intergenic
1180397367 22:12365524-12365546 AACACTCTGTTGAATAGGAGTGG + Intergenic
1180402353 22:12498612-12498634 AACACTCTGTTGAATAGGAGTGG - Intergenic
1180501446 22:15933331-15933353 AACACTCTGTTGAATAGGAGTGG + Intergenic
1180682826 22:17640269-17640291 GAAAATCTTTTTACTAGGAATGG + Intronic
1182167953 22:28195398-28195420 AACACTATGTTGAATAGGAATGG - Intronic
1182169558 22:28213241-28213263 AACACTATGTTGAATAGGAATGG - Intronic
1182184593 22:28388870-28388892 AACACTATGTTGACTAGGAGTGG + Intronic
950835227 3:15913130-15913152 GCCACCCCTTTGACTAGGAAAGG + Intergenic
951376492 3:21924611-21924633 GACACTATCTTGAAGAGTAAAGG - Intronic
951442937 3:22743510-22743532 GTCACCCCATTGACTAGGAAAGG + Intergenic
951452569 3:22855642-22855664 AACACTATGTTGAATAGGAATGG + Intergenic
951986085 3:28622695-28622717 GACACTATATTGAATAGGAGTGG - Intergenic
952074074 3:29674366-29674388 GACACTATGTTGAATAGGAGTGG - Intronic
953080936 3:39617023-39617045 AACACTATGTTGAATAGGAATGG + Intergenic
953214404 3:40904435-40904457 AACACTCTGTTGAATAGGAGTGG + Intergenic
953219459 3:40955897-40955919 AACACTCTGTTGAATAGGAGTGG + Intergenic
954390519 3:50265894-50265916 TACCCTCCCTTGAGTAGGAATGG - Intergenic
956569452 3:70677702-70677724 AACACTATGTTGAATAGGAATGG + Intergenic
956862097 3:73334877-73334899 AACACTATGTTGAATAGGAATGG + Intergenic
957644735 3:82906469-82906491 AACACTATGTTGAATAGGAATGG + Intergenic
959522666 3:107337816-107337838 AACACTATGTTGAATAGGAATGG - Intergenic
959556493 3:107725437-107725459 AACACTATGTTGAATAGGAATGG + Intronic
959910606 3:111759370-111759392 GAAACTCTCATGAATAGGATTGG - Intronic
959953166 3:112205014-112205036 AACACTATGTTGAATAGGAATGG - Intronic
959954087 3:112215321-112215343 AACACTATGTTGAATAGGAATGG - Intronic
961063325 3:123851773-123851795 AACACTATCTTGAATAGGAGTGG + Intronic
961321282 3:126078155-126078177 GCCACTCTCCTGGCTAGGCAAGG + Intronic
961433448 3:126899695-126899717 GGCACTCTCAAGACCAGGAAAGG - Intronic
963303528 3:143624728-143624750 AACACTCTGTTGAATAGGAGTGG - Intronic
964228562 3:154435609-154435631 AACACTATGTTGAATAGGAATGG + Intergenic
964564819 3:158038242-158038264 AACACTATGTTGAATAGGAATGG - Intergenic
964783118 3:160362980-160363002 AACACTATGTTGAATAGGAATGG - Intronic
965743580 3:171901949-171901971 GACACTCTCTTGACTAGGAAGGG + Intronic
970175420 4:13334607-13334629 AACACTATGTTGAATAGGAATGG + Intergenic
970910281 4:21267377-21267399 GACACTATGTTGAATAGGAGTGG + Intronic
972743574 4:41911544-41911566 CCCACTCTATTGACTAGGAATGG + Intergenic
972859679 4:43152129-43152151 GACACTATGTTGAATAGGAGTGG - Intergenic
974119463 4:57621364-57621386 AACACTATGTTGAATAGGAATGG + Intergenic
974221243 4:58974418-58974440 AACACTATGTTGACTAGGAGAGG + Intergenic
974378360 4:61106185-61106207 AACACTCTGTTGAATAGGAGTGG + Intergenic
974536386 4:63180861-63180883 AACACTCTGTTGAATAGGAGTGG + Intergenic
974541750 4:63247004-63247026 AACACTCTGTTGAATAGGAGTGG + Intergenic
974689244 4:65273639-65273661 AACACTATGTTGAATAGGAATGG + Intergenic
974690312 4:65290264-65290286 AACACTCTGTTGAATAGGAGTGG + Intergenic
975007071 4:69303470-69303492 AACACTCTGTTGAGTAGGAGTGG - Intronic
975274349 4:72478655-72478677 AACACTCTGTTGAATAGGAGTGG - Intronic
975277279 4:72516865-72516887 AACACTCTGTTGAATAGGAGTGG + Intronic
975284180 4:72597812-72597834 AACACTCTGTTGAATAGGAGTGG - Intergenic
976388442 4:84484843-84484865 GACACTCTGCTGTCTAGGAGAGG - Intergenic
976682537 4:87773183-87773205 AACACTATGTTGAATAGGAATGG - Intergenic
977815308 4:101407694-101407716 AACACTATGTTGAATAGGAATGG + Intergenic
977925835 4:102699386-102699408 AACACTATGTTGAATAGGAATGG + Intronic
978494377 4:109343666-109343688 AACACTCTGTTGAATAGGAGTGG - Intergenic
978600369 4:110420912-110420934 AACACTATATTGAATAGGAATGG - Intronic
978929284 4:114291146-114291168 AACACTATATTGAATAGGAATGG - Intergenic
979176353 4:117668678-117668700 AACACTATGTTGAATAGGAATGG + Intergenic
982690878 4:158546479-158546501 AACACTATGTTGAATAGGAATGG + Intronic
982826857 4:160013194-160013216 GCCACTCTCTTGACCATGATTGG + Intergenic
983411892 4:167409775-167409797 TACAATCAATTGACTAGGAATGG + Intergenic
984482575 4:180324839-180324861 AATACTCTGTTGAATAGGAATGG + Intergenic
984592212 4:181629365-181629387 GACACTGTGTTGAATAGGAGTGG + Intergenic
984854351 4:184180972-184180994 AATACTATGTTGACTAGGAATGG - Intronic
985065038 4:186112425-186112447 AACACTATGTTGACTAGGAGTGG + Intronic
985222203 4:187719303-187719325 AATAATCTCTTGACTAGGAAAGG + Intergenic
986056236 5:4139666-4139688 AAAACTATGTTGACTAGGAATGG - Intergenic
986498909 5:8377533-8377555 GACACTATGTTGAATAGGAGTGG - Intergenic
986665108 5:10095419-10095441 GATACTATGTTGAATAGGAATGG - Intergenic
987980604 5:25079685-25079707 AACACTCTGTTGAATAGGAGTGG + Intergenic
988036324 5:25832010-25832032 AACACTCTGTTGAATAGGAGTGG - Intergenic
989044442 5:37260812-37260834 GACACTATGTTGAATAGGAGTGG + Intergenic
989064485 5:37445902-37445924 GACACTATGTTGAATAGGAGTGG - Intronic
989248206 5:39277764-39277786 AACACTATGTTGAATAGGAATGG + Intergenic
989683864 5:44061918-44061940 AACACTATGTTGAATAGGAATGG + Intergenic
990060486 5:51640722-51640744 AACACTCTGTTGAATAGGAGTGG - Intergenic
990071387 5:51787174-51787196 GACACTATGTTGAATAGGAGTGG + Intergenic
990655015 5:57945379-57945401 AACACTATGTTGAATAGGAATGG + Intergenic
990843300 5:60107971-60107993 AACACTATGTTGACTAGGAGTGG - Intronic
990884062 5:60571985-60572007 AACACTATGTTGACTAGGAGTGG + Intergenic
990912276 5:60864391-60864413 AACACTATGTTGACTAGGAGTGG - Intergenic
991108267 5:62867250-62867272 AACACTATGTTGACTAGGAGTGG - Intergenic
991244975 5:64501004-64501026 GGCAGTCTGTTGACTATGAATGG + Intergenic
992032081 5:72731702-72731724 AACACTATGTTGAATAGGAATGG - Intergenic
992054316 5:72972730-72972752 AACACTATGTTGACTAGGAGTGG + Intronic
992340738 5:75820758-75820780 AACACTATGTTGAATAGGAATGG - Intergenic
993093847 5:83459831-83459853 AACACTATGTTGAATAGGAATGG + Intergenic
993122701 5:83795641-83795663 AACACTATGTTGAATAGGAATGG + Intergenic
993857619 5:93095823-93095845 AACACTATCTTGAATAGGAGTGG + Intergenic
994545993 5:101166956-101166978 AACACTATGTTGAATAGGAATGG - Intergenic
994599888 5:101889265-101889287 AACACTATGTTGACTAGGAGTGG + Intergenic
995178796 5:109210523-109210545 AACACTATGTTGAATAGGAATGG + Intergenic
995692366 5:114841902-114841924 AACACTATGTTGAATAGGAATGG - Intergenic
995784905 5:115817107-115817129 GGCACTCTCTGGCCTAGGAGTGG - Intergenic
996616636 5:125449756-125449778 GACACTCTCTTGGTTAGGTTTGG + Intergenic
998774464 5:145583403-145583425 AACACTATGTTGAATAGGAATGG - Intronic
999867409 5:155715967-155715989 AACACTATGTTGAATAGGAATGG + Intergenic
1000273908 5:159715524-159715546 AACACTATGTTGAATAGGAATGG + Intergenic
1001386565 5:171344229-171344251 GACACTCTTTGGACTGGGCATGG + Intergenic
1001942473 5:175750519-175750541 CACAGTCGCTTGGCTAGGAAGGG + Intergenic
1003341800 6:5228566-5228588 GACACTTTCTTGGCTGGGCATGG - Intronic
1004288641 6:14346450-14346472 GTCACTGTCTAGACTAGCAAAGG - Intergenic
1006426653 6:33967515-33967537 GCCACTCTCTTGGCTGGCAAGGG + Intergenic
1008312919 6:49999735-49999757 CACACTATCTTGATTATGAAAGG - Intergenic
1008529618 6:52444317-52444339 AACACTCTGTTGAATAGGAGTGG + Intronic
1008716781 6:54298060-54298082 AACACTCTTTTGAGTAGGAGTGG - Intergenic
1009188706 6:60603928-60603950 AACACTATGTTGAATAGGAATGG - Intergenic
1009206282 6:60805513-60805535 AACACTATGTTGACTAGGAGTGG + Intergenic
1009361267 6:62817690-62817712 AACACTATGTTGAATAGGAATGG + Intergenic
1010446581 6:75955628-75955650 AACACTATGTTGAATAGGAATGG + Intronic
1010491899 6:76486794-76486816 AACACTATGTTGAATAGGAATGG + Intergenic
1010553871 6:77255619-77255641 AACACTCTGTTGAATAGGAGTGG - Intergenic
1010604787 6:77874634-77874656 AACACTATGTTGAATAGGAATGG + Intronic
1010934753 6:81848031-81848053 GTCACTCTCCTGATTGGGAAGGG + Intergenic
1011418111 6:87143729-87143751 AACACTATGTTGACTAGGAGTGG - Intergenic
1012204216 6:96440714-96440736 AACACTATGTTGAATAGGAATGG - Intergenic
1012480457 6:99661439-99661461 GACAATCTCTAGACTTTGAAGGG + Intergenic
1013860518 6:114630030-114630052 AACACTATGTTGAATAGGAATGG + Intergenic
1014461969 6:121707043-121707065 AACACTCTGTTGAATAGGAGTGG - Intergenic
1015368216 6:132421572-132421594 GATACTATGTTGAATAGGAATGG + Intergenic
1016265766 6:142231396-142231418 GACACTATGTTGAATAGGAGTGG + Intergenic
1016600441 6:145852725-145852747 AACACTCTGTTGAATAGGAGTGG + Intergenic
1016656271 6:146521815-146521837 AACACTATGTTGAATAGGAATGG + Intergenic
1016766210 6:147797096-147797118 AACACTCTGTTGAATAGGAGTGG + Intergenic
1017363244 6:153602118-153602140 GACACTTTATGAACTAGGAAAGG - Intergenic
1018607099 6:165609470-165609492 AACACTATGTTGAATAGGAATGG - Intronic
1018749679 6:166792967-166792989 AACACTATGTTGACTAGGAGTGG - Intronic
1018760324 6:166888922-166888944 AACACTATGTTGACTAGGAGTGG - Intronic
1019645593 7:2127193-2127215 GGCACTCCCATGACTAGCAAAGG - Intronic
1019853173 7:3579636-3579658 AACACTATCTTGAATAGGATTGG - Intronic
1019940479 7:4285240-4285262 GAAGCTCTCTAGACCAGGAAAGG - Intergenic
1020609435 7:10376656-10376678 AACACTATCTTGAATAGGAGTGG - Intergenic
1020640770 7:10751184-10751206 GACACTATGTTGAATAGGAGTGG - Intergenic
1020745860 7:12076943-12076965 GACATACTCTTCACTAGGGATGG - Intergenic
1021425978 7:20499951-20499973 AACACTATGTTGAATAGGAAAGG - Intergenic
1022098209 7:27153926-27153948 GGCAGTGTCTTGACTTGGAAAGG - Exonic
1022453950 7:30541582-30541604 AACACTATGTTGAATAGGAATGG - Intronic
1022880324 7:34579887-34579909 GACACTATGTTGAATAGGAGTGG - Intergenic
1022899086 7:34784212-34784234 AACACTCTGTTGAATAGGAGTGG + Intronic
1023146592 7:37157278-37157300 AACACTATGTTGAATAGGAATGG - Intronic
1023374323 7:39540674-39540696 GACACTCTCCTGTAGAGGAATGG + Intergenic
1023509042 7:40930950-40930972 AACACTCTGTTGAATAGGAGTGG + Intergenic
1023510719 7:40950485-40950507 AACACTCTGTTGAATAGGAGTGG + Intergenic
1024179788 7:46880415-46880437 CAAACTCTCTTCACTAGAAATGG - Intergenic
1024990148 7:55227816-55227838 AATACTATCTTGAATAGGAATGG + Intronic
1025520540 7:61724178-61724200 AACACTCTGTTGAATAGGAGTGG - Intergenic
1025521050 7:61730327-61730349 AACACTCTGTTGAATAGGAGTGG - Intergenic
1025544862 7:62152833-62152855 AACACTCTGTTGAATAGGAGTGG - Intergenic
1025545404 7:62159888-62159910 AACACTCTGTTGAATAGGAGTGG - Intergenic
1027765741 7:82339231-82339253 GACATTCTCTTTCCTAGGAGAGG - Intronic
1028055136 7:86231619-86231641 AACACTATGTTGAATAGGAATGG - Intergenic
1028300648 7:89195301-89195323 AACACTATGTTGAATAGGAATGG - Intronic
1028513248 7:91648338-91648360 AACACTATCTTGAATAGGAGTGG - Intergenic
1029322304 7:99774804-99774826 GACACTATGTTGAATAGGAGTGG - Intronic
1030426421 7:109384620-109384642 AACACTCTGTTGAATAGGAGTGG - Intergenic
1030997406 7:116375350-116375372 AACACTATGTTGAATAGGAATGG - Intronic
1031527426 7:122838391-122838413 AACACTATGTTGAATAGGAATGG - Intronic
1031738192 7:125394137-125394159 AATACTATGTTGACTAGGAATGG - Intergenic
1033389317 7:140911187-140911209 CACACACTCTTGACTTTGAAGGG + Intronic
1034518951 7:151604050-151604072 GAAACTGTCTTAACTAGGAGAGG - Intronic
1035228954 7:157450452-157450474 GACACTGTGTTGAGTAGGAGTGG + Intergenic
1035711433 8:1718948-1718970 AACACTCTGTTGAATAGGAGTGG - Intergenic
1035858779 8:3005884-3005906 GACACTATGTTGAATAGGAGTGG - Intronic
1036286863 8:7450485-7450507 GATATTCCCTTGACTAGGAAAGG + Intronic
1036334615 8:7861039-7861061 GATATTCCCTTGACTAGGAAAGG - Intronic
1037053248 8:14403318-14403340 AACACTATCTTGAATAGGAGTGG + Intronic
1039145983 8:34447760-34447782 AACACTGTGTTGAATAGGAATGG + Intergenic
1039205427 8:35147706-35147728 GACACTTGCTTACCTAGGAAAGG - Intergenic
1039261781 8:35779744-35779766 AACACTCTCCTGGCTAGGCATGG - Intronic
1039718827 8:40140249-40140271 GACACTATGTTGAATAGGAATGG + Intergenic
1040553612 8:48459241-48459263 AACACTCTGTTGAATAGGAGTGG + Intergenic
1040712521 8:50206595-50206617 AACACTATTTTGACTAGGAGTGG + Intronic
1040844169 8:51819007-51819029 TACACTTTCTTAACAAGGAATGG + Exonic
1041655208 8:60342515-60342537 AATACTCTCTTGAATAGGAATGG - Intergenic
1042115831 8:65430450-65430472 CACACTATGTTGAATAGGAATGG - Intergenic
1042116486 8:65437407-65437429 CACACTATGTTGAATAGGAATGG - Intergenic
1042487028 8:69357169-69357191 GTCACCCCTTTGACTAGGAAAGG + Intergenic
1042487301 8:69360916-69360938 TTCTCTCTCTTGACTAGTAATGG + Intergenic
1043244066 8:77975770-77975792 AACACTATGTTGAATAGGAATGG + Intergenic
1043279779 8:78448953-78448975 AACACTGTGTTGAATAGGAATGG - Intergenic
1044053576 8:87540273-87540295 AACACTATGTTGAATAGGAATGG + Intronic
1044410162 8:91873487-91873509 AACACTATGTTGAATAGGAATGG - Intergenic
1044412115 8:91895312-91895334 AACACTATGTTGAATAGGAATGG - Intergenic
1044455020 8:92383451-92383473 GACACTGTGTTGAATAGGAGTGG + Intergenic
1044455825 8:92392128-92392150 AACACTGTGTTGAATAGGAATGG + Intergenic
1044596662 8:93965845-93965867 AACACTATGTTGAATAGGAATGG + Intergenic
1046329375 8:112695694-112695716 AACACTATGTTGAATAGGAATGG - Intronic
1046722596 8:117637530-117637552 AACACTATGTTGACTAGGAGTGG - Intergenic
1046810871 8:118531956-118531978 AACACTATGTTGAATAGGAATGG + Intronic
1046828642 8:118719745-118719767 AACACTGTGTTGAATAGGAATGG + Intergenic
1046866935 8:119161425-119161447 AACACTATGTTGAATAGGAATGG + Intergenic
1046874410 8:119237901-119237923 AACACTATGTTGAATAGGAATGG - Intronic
1047052089 8:121123991-121124013 AACACTCTGTTGAATAGGAGTGG + Intergenic
1050517229 9:6457535-6457557 AACACTCTGTTGAACAGGAATGG + Intronic
1051300784 9:15648360-15648382 AACACTATGTTGAATAGGAATGG - Intronic
1052645263 9:31226536-31226558 AACACTATGTTGAATAGGAATGG + Intergenic
1052705951 9:31993918-31993940 GACACTATGTTGAATAGGATTGG - Intergenic
1053583281 9:39429407-39429429 AACACTATGTTGAATAGGAATGG - Intergenic
1054104861 9:60988150-60988172 AACACTATGTTGAATAGGAATGG - Intergenic
1054890349 9:70244408-70244430 AACACTATGTTGAATAGGAATGG - Intergenic
1055545884 9:77372597-77372619 GACACTATGTTGAATAGGAGTGG - Intronic
1055750153 9:79496580-79496602 AACACTATGTTGACTAGGAGTGG + Intergenic
1055767542 9:79680655-79680677 AACACTATGTTGACTAGGAGTGG + Intronic
1057768725 9:97947370-97947392 GACACTATGTTGAATAGGAGTGG + Intergenic
1203364609 Un_KI270442v1:246469-246491 CACACTTTCTTAACAAGGAATGG - Intergenic
1186749414 X:12606329-12606351 GCCACTCTCTTGCCTAGAGAAGG - Intronic
1187303003 X:18069559-18069581 AACACTATCTTGACTAGGAGTGG + Intergenic
1187602691 X:20849576-20849598 AACACTATGTTGACTAGGAGTGG - Intergenic
1187603589 X:20859879-20859901 AACACTATGTTGACTAGGAGTGG - Intergenic
1187763492 X:22613268-22613290 AACACTATGTTGACTAGGAGTGG - Intergenic
1187769631 X:22680924-22680946 AACACTATGTTGAATAGGAATGG - Intergenic
1188044485 X:25410026-25410048 AACACTCTGTTGAATAGGAGTGG + Intergenic
1190606351 X:52147357-52147379 AACACTATGTTGAATAGGAATGG + Intergenic
1190687078 X:52884602-52884624 GACACTATGTTGAATAGGAGTGG + Intergenic
1190698904 X:52971190-52971212 GACACTATGTTGAATAGGAGTGG - Intronic
1190836465 X:54105521-54105543 AACACTATGTTGAATAGGAATGG - Intronic
1191173211 X:57471208-57471230 AACACTATGTTGAATAGGAATGG - Intronic
1191196336 X:57727506-57727528 AACACTATGTTGAATAGGAATGG + Intergenic
1191203239 X:57807061-57807083 AACACTATGTTGAATAGGAATGG + Intergenic
1191209203 X:57867256-57867278 AACACTATGTTGAATAGGAATGG - Intergenic
1191238640 X:58159753-58159775 AACACTATGTTGAATAGGAATGG - Intergenic
1191606520 X:63068453-63068475 AATACTCTGTTGAATAGGAATGG - Intergenic
1191660743 X:63647259-63647281 AACACTATGTTGAATAGGAATGG + Intronic
1191827907 X:65385673-65385695 AACACTGTGTTGAATAGGAATGG + Intronic
1192008025 X:67238193-67238215 AACACTATGTTGAATAGGAATGG - Intergenic
1192048944 X:67705674-67705696 AACACTATGTTGAATAGGAATGG + Intronic
1192564389 X:72151533-72151555 GACACTCTATTGAAGAGTAATGG - Intergenic
1192662478 X:73056462-73056484 AACACTATGTCGACTAGGAATGG - Intergenic
1192931081 X:75806834-75806856 AACACTCTGTTGAATAGGAGTGG + Intergenic
1193621209 X:83754598-83754620 AACACTCTGTTGAATAGGAGTGG - Intergenic
1193766353 X:85533177-85533199 AACACTATGTTGAATAGGAATGG - Intergenic
1194625154 X:96218633-96218655 GATACTATGTTGAATAGGAATGG - Intergenic
1194907504 X:99596016-99596038 AACACTCTGTTGAATAGGAGTGG + Intergenic
1194927314 X:99841002-99841024 AACACTATGTTGAATAGGAATGG - Intergenic
1195886944 X:109648637-109648659 AACACTCTGTTGAATAGGAGTGG - Intronic
1196511415 X:116516637-116516659 GACACTGTGTTGAATAGGAGTGG + Intergenic
1196529324 X:116765957-116765979 GACACCCTCTGGTCTAGGGAAGG - Intergenic
1197447088 X:126563705-126563727 AACACTATGTTGAATAGGAATGG + Intergenic
1197448337 X:126580200-126580222 AACACTATGTTGAATAGGAATGG + Intergenic
1197908160 X:131449331-131449353 AACACTATTTTGAATAGGAATGG - Intergenic
1197987880 X:132286501-132286523 AACACTATGTTGAATAGGAAAGG + Intergenic
1198474125 X:136979154-136979176 AACACTATGTTGAATAGGAATGG + Intergenic
1198725460 X:139672343-139672365 AACACTATCTTGAATAGGAGTGG + Intronic
1199386002 X:147223951-147223973 AACACTATCTTGAATAGGAGTGG - Intergenic
1199939168 X:152607857-152607879 AACACTATCTTGAATAGGAGTGG + Intergenic
1200298094 X:154943130-154943152 AACACTATGTTGAATAGGAAAGG - Intronic
1200583407 Y:4977345-4977367 AACACTATGTTGAATAGGAATGG - Intergenic
1200774304 Y:7156134-7156156 AACACTATGTTGAATAGGAACGG + Intergenic
1200887984 Y:8290742-8290764 GATACTATGTTGAATAGGAATGG + Intergenic
1200920608 Y:8609719-8609741 GAGACTCTCTGGAATAGAAAAGG - Intergenic
1201308611 Y:12573650-12573672 GACACTATGTTGAATAGGAGTGG - Intergenic
1201392794 Y:13516466-13516488 GACACTATGTTGAATAGGAGTGG + Intergenic
1201529191 Y:14973174-14973196 AACACTCTGTTGAATAGGAGTGG + Intergenic
1201679105 Y:16622729-16622751 AACACTATGTTGACTAGGCATGG - Intergenic
1201887170 Y:18897867-18897889 AACACTCTGTTGAATAGGAGTGG - Intergenic
1201971775 Y:19805560-19805582 AACACTCTGTTGAATAGGAGTGG - Intergenic
1201974699 Y:19836131-19836153 AACACTCTGTTGAATAGGAGTGG + Intergenic
1201976408 Y:19854077-19854099 AACACTATGTTGATTAGGAATGG - Intergenic
1202175012 Y:22090161-22090183 AACACTATGTTGAATAGGAATGG - Intronic
1202216350 Y:22496222-22496244 AACACTATGTTGAATAGGAATGG + Intronic
1202326836 Y:23699842-23699864 AACACTATGTTGAATAGGAATGG - Intergenic
1202357037 Y:24062746-24062768 AACACTATGTTGAATAGGAATGG - Intergenic
1202361155 Y:24111705-24111727 AACACTATGTTGAATAGGAATGG + Intergenic
1202509623 Y:25558413-25558435 AACACTATGTTGAATAGGAATGG - Intergenic
1202513740 Y:25607368-25607390 AACACTATGTTGAATAGGAATGG + Intergenic
1202543933 Y:25970210-25970232 AACACTATGTTGAATAGGAATGG + Intergenic