ID: 965744321

View in Genome Browser
Species Human (GRCh38)
Location 3:171907944-171907966
Sequence GGGTAAAGATCAAGGGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965744321_965744327 19 Left 965744321 3:171907944-171907966 CCATTCACCCTTGATCTTTACCC 0: 1
1: 0
2: 0
3: 20
4: 197
Right 965744327 3:171907986-171908008 GGCAGACACTTTGAATGTACAGG 0: 1
1: 0
2: 0
3: 14
4: 101
965744321_965744326 -2 Left 965744321 3:171907944-171907966 CCATTCACCCTTGATCTTTACCC 0: 1
1: 0
2: 0
3: 20
4: 197
Right 965744326 3:171907965-171907987 CCTTAACTACACAAAAATACTGG 0: 1
1: 0
2: 2
3: 11
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965744321 Original CRISPR GGGTAAAGATCAAGGGTGAA TGG (reversed) Intronic
902599716 1:17532581-17532603 AAAAAAAGATCAAGGGTGAAGGG - Intergenic
904903878 1:33879301-33879323 GGTTAATGATCAAGGCTGCAGGG - Intronic
906251371 1:44313254-44313276 GGGTAGAAAACCAGGGTGAAGGG + Intronic
906953061 1:50349954-50349976 TGGTAAAGCTCAAGGGAAAAGGG - Intergenic
909857933 1:80563350-80563372 TGGTAAGAAGCAAGGGTGAATGG + Intergenic
910191504 1:84600697-84600719 GGGGACAGAACAAGGCTGAAGGG + Intergenic
914675233 1:149903170-149903192 GGGGAAAGATCAAGGTAGAGAGG + Intergenic
915988867 1:160492980-160493002 GAGTAGAGTTCAAGGGGGAAGGG - Intronic
917159574 1:172042649-172042671 GGGTAAAGATCTGGGGGAAAGGG + Intronic
921591921 1:217014066-217014088 GGGTAAAAAACAAAGGTCAAAGG - Intronic
923035377 1:230281564-230281586 GGGTAAAGGTGAAGGGGCAAAGG - Exonic
924128076 1:240876448-240876470 GGGTCAAGATCAGGTGTAAAGGG - Intronic
1064145984 10:12826790-12826812 TGGAAAAGATTCAGGGTGAAAGG - Intronic
1065244879 10:23746871-23746893 GGGTCAAGGTAAAGGGTTAATGG + Intronic
1066121484 10:32292134-32292156 GGGTAAAGAAAGAGGGAGAAAGG - Intronic
1066358912 10:34711839-34711861 GGGACAGGATAAAGGGTGAATGG - Intronic
1067195531 10:44114720-44114742 GGGTGATGATCATGGGTTAAAGG - Intergenic
1068041240 10:51826724-51826746 AGGTAAAGAACAAAGGAGAAAGG + Intronic
1071397980 10:85241837-85241859 TGGTAAAGATCGAGGGTCAATGG - Intergenic
1071960255 10:90803306-90803328 AGGGAAAGATCAGGGGAGAAGGG - Intronic
1074839905 10:117340455-117340477 GAGGAAACATCAAGGGTAAAGGG - Intronic
1075579397 10:123605673-123605695 GGGCAAAGTGCAAGGGTGAGCGG - Intergenic
1075634721 10:124022740-124022762 GGGGAAACATCAAGGGGGAAGGG - Intronic
1076315043 10:129533951-129533973 GGGATAAGATCAGAGGTGAAGGG + Intronic
1078972952 11:16436322-16436344 GGGGAATGATAAAGGGAGAAGGG - Intronic
1079853888 11:25575252-25575274 GTGGAAAGATAAAGGATGAATGG + Intergenic
1080122820 11:28696891-28696913 GGGAAAGGATCAGAGGTGAAAGG - Intergenic
1081409609 11:42741320-42741342 TGGTGCAGATCAAAGGTGAAAGG - Intergenic
1085518705 11:77125951-77125973 AGGTAAGGATCAGGGGTGATAGG + Exonic
1086724084 11:90159996-90160018 AGGTAAAGATGAAGAGAGAAGGG + Intronic
1086724358 11:90164699-90164721 GGGTAAAGATGAAGAGAGAAGGG - Intronic
1088056895 11:105593686-105593708 TGGTATAGATGATGGGTGAAAGG - Intergenic
1088810009 11:113385900-113385922 GAGGAAATACCAAGGGTGAATGG - Intergenic
1089038857 11:115426486-115426508 GGGTAAAAATAAAAGGGGAAAGG - Intronic
1089508610 11:118981216-118981238 GGTTAAAGATCAAAGAGGAAGGG - Exonic
1090188514 11:124753315-124753337 GGGTACAGATCAAGGGGGCCTGG + Exonic
1091009133 11:131982365-131982387 GGGGCAAGAACAAGGATGAAAGG + Intronic
1091625691 12:2119266-2119288 GGGTGGAGATCCGGGGTGAAGGG - Intronic
1094339391 12:29393647-29393669 GGGAGAAGAGGAAGGGTGAAGGG + Intergenic
1095331562 12:40971405-40971427 GAGGAAAGATCAAGGCTGAAGGG - Intronic
1099420311 12:82450110-82450132 GGAAAAAGAACAAGAGTGAAAGG - Intronic
1101767450 12:107715055-107715077 GGGCAAAGATCCTGGGAGAAGGG + Intergenic
1104666273 12:130649558-130649580 GGGGAAAAATCCGGGGTGAACGG + Intronic
1105466439 13:20646206-20646228 GGGTAAAGATCAATGGAGTTAGG - Intronic
1107910496 13:45101082-45101104 GAGTAAAGATCCAGACTGAAAGG - Intergenic
1108432968 13:50372622-50372644 GGATAAAGATGAAGGGTAAAGGG + Intronic
1110487610 13:76065571-76065593 GAGTAAAGAGCATGGGAGAAGGG - Intergenic
1111677230 13:91401797-91401819 GGGTAGAGAACAAAGGTGAGGGG - Intronic
1111913748 13:94339581-94339603 ATGAAAAGATCAAGGGTGGAAGG + Intronic
1112753824 13:102608763-102608785 GGGTGAAGAAAAAGGGAGAAAGG - Intronic
1114860601 14:26515670-26515692 TGGTAAAGAAAAAGGATGAAAGG + Intronic
1115142623 14:30190765-30190787 GGGAAAAGAGAAAGAGTGAAAGG + Intronic
1117079603 14:52137590-52137612 GGGAGAAGAGGAAGGGTGAAGGG + Intergenic
1117772715 14:59151041-59151063 GGGTAAATATGAGGAGTGAAGGG + Intergenic
1118608069 14:67517577-67517599 GGGTTAAGATCTAAGGTGCAAGG + Intronic
1120527592 14:85595097-85595119 TGGAAGAGATGAAGGGTGAAGGG + Intronic
1122826651 14:104373979-104374001 GGGTGAAGGTCAAGGGTCACAGG + Intergenic
1122979453 14:105185095-105185117 GGGTGAAGGTCAAGGGTCACAGG + Intergenic
1124862139 15:33452172-33452194 GGGTACAAATCAGGGCTGAAAGG + Intronic
1124880586 15:33639044-33639066 GGGTAAAGTCCAAGGGTGCTTGG - Intronic
1125440613 15:39699081-39699103 GGGAAAAGATGAAGGGCAAAAGG + Intronic
1126712316 15:51472759-51472781 GGGTTACCATCAAGGATGAAAGG - Intronic
1127161503 15:56191860-56191882 GGGTAAGGCTCAAGGCTGCAAGG + Intronic
1128457019 15:67836771-67836793 GGGTAAGGGACAAGAGTGAACGG + Intergenic
1136286648 16:29248153-29248175 GGGGAATGTTCAAGGGTGTAGGG - Intergenic
1136455239 16:30376513-30376535 GGGAGAAGCTCAAGGGTGAGTGG + Exonic
1141261148 16:82454837-82454859 AGGTGAATGTCAAGGGTGAAGGG - Intergenic
1141673397 16:85504796-85504818 GGGTACAGAGCTAGGGTGGATGG + Intergenic
1141774570 16:86114237-86114259 GGGAAAAGAGGAAGGGTGGAGGG + Intergenic
1142092244 16:88220786-88220808 GGGGAATGTTCAAGGGTGTAGGG - Intergenic
1144270063 17:13606866-13606888 GGATATAGATTAAGGGTAAAAGG + Intergenic
1147580813 17:41626139-41626161 GCGGAAAGATTAAGGGTGGAGGG - Intergenic
1147588859 17:41668325-41668347 GGGCAAATGTCAAGGGTGTACGG - Intergenic
1149595470 17:57862325-57862347 GGCTAAAGAGCAAGGCGGAAAGG - Exonic
1151559880 17:74864472-74864494 AGGACAAGATCAAGGGTGAGGGG - Exonic
1151566153 17:74899608-74899630 GGGGAAGGATGAACGGTGAAAGG - Intergenic
1152803469 17:82343006-82343028 GGGAGATGATCAAGGGTGAGGGG + Intergenic
1156602017 18:38619202-38619224 TGGTAAAAATAAAGGGTGAAGGG + Intergenic
1157107302 18:44786562-44786584 TGGTAAAGATCAAGGGTAACAGG + Intronic
1157911042 18:51617586-51617608 AAGTTAAAATCAAGGGTGAAGGG + Intergenic
1160072648 18:75642221-75642243 GGGTTGAGATCAAAGGAGAAGGG + Intergenic
1161365373 19:3876207-3876229 GGTTAAAGATACAGGGTGACAGG + Intergenic
1164509649 19:28886818-28886840 GGGGAAAGATCAAGTGGGAGGGG + Intergenic
1164716391 19:30393697-30393719 TGGTGAAGATGAAGGCTGAAAGG + Intronic
1165276062 19:34752618-34752640 GGGAAAACATCCAGGGTGATTGG - Intergenic
1165993797 19:39831033-39831055 GAGTAAAGGTGAGGGGTGAAAGG - Intronic
1167079609 19:47270381-47270403 GGGGAAAGATAACGGGTGAGCGG - Intronic
1167345084 19:48940456-48940478 GGTTAAAGGTCAAAGATGAAGGG - Intronic
1168065146 19:53915071-53915093 GGAGAAAGAGCAAGGTTGAAGGG + Intronic
1168715879 19:58527007-58527029 GAGTAAAGCTCTAAGGTGAAGGG + Intronic
925882328 2:8363220-8363242 GGGGAAAGAACAAGGATGAAGGG - Intergenic
927291094 2:21405604-21405626 AGGGAAAGACCAGGGGTGAAGGG + Intergenic
928116627 2:28549787-28549809 GGGTAAAGAGCAAGAGAGACTGG + Intronic
929276364 2:40029627-40029649 ACATAAAGATCAATGGTGAATGG - Intergenic
930399087 2:50860471-50860493 GTGAAAAGATGAAAGGTGAAAGG + Intronic
931052805 2:58432714-58432736 GGGTGAAGATCTGGGTTGAAGGG - Intergenic
933897526 2:86825111-86825133 GGGAAAAGAGCAGGGGTGATGGG + Intronic
935024541 2:99263606-99263628 GGGTTAAATTCAGGGGTGAAGGG + Intronic
936569628 2:113603006-113603028 GGGTAAGGGTTAAGGGTTAAGGG - Intergenic
937513238 2:122622670-122622692 GGGAGAAAATCAAGAGTGAAGGG - Intergenic
939771712 2:146328374-146328396 GGATAAAGACCAAGAATGAAGGG - Intergenic
941833470 2:169989356-169989378 GGGTAAAGATAGAGGGAGAGTGG - Intronic
942449007 2:176097702-176097724 CGGTCAAGATCAACAGTGAAGGG - Intergenic
945303008 2:208231856-208231878 GAGTAAACATCAGGGGTGAGGGG - Intergenic
947181647 2:227416594-227416616 GGGTGAAGGGCAGGGGTGAAGGG + Intergenic
1169333895 20:4739318-4739340 GGGTAAGGGCCAAGTGTGAATGG - Intronic
1171471856 20:25378464-25378486 TGGCAAAGGTCAAGGATGAAGGG + Intronic
1172580827 20:36046548-36046570 GGGAGAAGAGGAAGGGTGAAGGG - Intergenic
1172755561 20:37281456-37281478 GTGTAAATAACAAAGGTGAAAGG - Intergenic
1173241883 20:41304107-41304129 GGGGGAAGATCAAGAGAGAATGG - Intronic
1173254202 20:41381912-41381934 GGGTGAAGATGAAGTGTGCAGGG + Intergenic
1173675554 20:44832090-44832112 GTGTAATGATCAAGGTTGGAGGG + Intergenic
1173738399 20:45378068-45378090 AGGAAAAGGTGAAGGGTGAAGGG - Intronic
1174164591 20:48575776-48575798 GGGGCAAGAGCAAGGGTCAAGGG - Intergenic
1174572448 20:51511709-51511731 GGGGAAAGATCAAGGTGGTAAGG - Intronic
1174823593 20:53748431-53748453 GGGTATAGGTGAAGGGTAAAGGG + Intergenic
1176956820 21:15115270-15115292 GGAAAAAGATCAAGGGAGGAAGG + Intergenic
1179459199 21:41522284-41522306 GGGGAAACATCAGGGGTGAGGGG + Intronic
1180673881 22:17573785-17573807 GGGTAGAGAACAAGGGTTACTGG - Intronic
1184799536 22:46751341-46751363 TTCTAAAGATCAAGGGAGAAGGG - Intergenic
1185362306 22:50415649-50415671 GGGTAAAGCTCAAGGGCAACGGG - Intronic
949324841 3:2851793-2851815 AGGTAAAAATCCAGGGTGATGGG + Intronic
949445935 3:4133635-4133657 GGAGAAAGATGTAGGGTGAAAGG - Intronic
950357851 3:12426563-12426585 GGGAAAAGAAAAAGGCTGAAGGG + Intronic
951864139 3:27288442-27288464 GGTTAGATATCAAGGGTGAGTGG - Intronic
954911987 3:54118316-54118338 GGGTAAATATCTACTGTGAAAGG - Intergenic
955310009 3:57876772-57876794 GTGGAAAGATGAAGGGTGAAAGG + Intronic
956944451 3:74203682-74203704 GGGTCAAATTCAAGTGTGAAGGG + Intergenic
957719584 3:83977018-83977040 TGGTAAACATTAAAGGTGAAGGG - Intergenic
959480245 3:106864107-106864129 GAGAAAACATCAAGGGTAAAGGG + Intergenic
960367078 3:116785691-116785713 GGGAAAAGATCAAGGGTGCGAGG - Intronic
962371103 3:134821505-134821527 GGGTAAAGATAAAAGGTGGATGG + Intronic
962744118 3:138384808-138384830 GGATAAAGACCAAGGGAGAGTGG + Intronic
965744321 3:171907944-171907966 GGGTAAAGATCAAGGGTGAATGG - Intronic
966109228 3:176377684-176377706 GGGTCAAGGTTAAAGGTGAAAGG - Intergenic
968364246 3:198173054-198173076 GGTTAAGGATTAAGGGTTAAGGG + Intergenic
969861658 4:10040619-10040641 GGGGAAAGATCAAGGGTATGGGG - Intronic
971374911 4:26048880-26048902 GAGTAAAAAACAAGTGTGAAAGG - Intergenic
975607678 4:76171784-76171806 AGATAAAGACCAAGGGTGAATGG - Intronic
975938566 4:79612254-79612276 GGGTAAAGAAGGAGAGTGAAAGG - Intergenic
977540752 4:98315960-98315982 GGGAAATGACTAAGGGTGAAAGG + Intronic
978526016 4:109665973-109665995 GGGGAAAGAAGAAGGGGGAAAGG + Intronic
979174294 4:117643172-117643194 AGGTAAGAATCAAGGCTGAATGG - Intergenic
979871587 4:125829424-125829446 GGAAAAAGAAGAAGGGTGAAGGG + Intergenic
980106680 4:128594843-128594865 GTGGAAGGATCAAGGGTCAAGGG - Intergenic
981324219 4:143427798-143427820 GGGTACAGACTAAAGGTGAATGG + Intronic
982141962 4:152331891-152331913 AGGTAAAGATCCAGGGTGCTTGG - Intronic
985025407 4:185734852-185734874 GTGTAATGATCAAGGATGAGGGG - Intronic
986213738 5:5698732-5698754 GGGTATAGATTAAAGATGAATGG - Intergenic
988049141 5:26001183-26001205 TGGTGAAGTTCAAGGGTGTAAGG - Intergenic
988181725 5:27803638-27803660 GGGTAAAGATTAATGGGGCAAGG - Intergenic
989677865 5:43993494-43993516 AGGTCAAGGACAAGGGTGAAGGG - Intergenic
990394710 5:55365331-55365353 GGGTAAAGATCAAGGTTTTAGGG + Intronic
990894460 5:60683104-60683126 GGATATAGCTCAAGGATGAAAGG + Intronic
991095718 5:62737757-62737779 GGGAAAAGATCTAGAGAGAAGGG + Intergenic
991109325 5:62880461-62880483 AGGTAAAAGTCAAGGCTGAATGG + Intergenic
992904109 5:81328261-81328283 GGGTAAAGATGAAGAGTGCTGGG - Intergenic
995010672 5:107254326-107254348 GGGTAAGGATAAAGGGTAATAGG - Intergenic
995018456 5:107340455-107340477 TTGTATAGATCAAGGGAGAAAGG - Intergenic
996418313 5:123233993-123234015 GGGGAAAGAGAAAGGGGGAAAGG - Intergenic
997018891 5:129972932-129972954 GGCTAAAGATCAAGTAAGAAGGG - Intronic
997671115 5:135672867-135672889 GGGTAAAGATGGAGGGAGGAAGG - Intergenic
997786273 5:136716909-136716931 AGTCAAAGATCAAGGGAGAAAGG - Intergenic
998054587 5:139063435-139063457 GGGTAGAGATCAAAGGGGAGTGG - Intronic
998083857 5:139299944-139299966 GGTTAAGGATGCAGGGTGAAGGG + Intronic
999653873 5:153794224-153794246 GGTTAATGTTCAAGGGTCAAAGG - Intronic
1001424997 5:171617175-171617197 GAGGAAACATCAGGGGTGAAGGG - Intergenic
1001927348 5:175648102-175648124 GGGTACAGAGCAGGGGTAAAGGG + Intergenic
1002558532 5:180063390-180063412 GTGTAAATAACAAGGGTGGATGG + Intronic
1003698389 6:8435695-8435717 GGGTAGAGGTAAAGGCTGAAAGG - Intergenic
1005008067 6:21309932-21309954 GGGAAAAGTGCAAAGGTGAAAGG - Intergenic
1005518949 6:26581492-26581514 GGTTCAGGATCAAGTGTGAATGG + Intergenic
1009310732 6:62149309-62149331 AGGAAAAGAGAAAGGGTGAAGGG - Intronic
1009547619 6:65041451-65041473 AGGTCAAGATCAAGGGTGCATGG - Intronic
1010143587 6:72639763-72639785 GGGTAAAGAGAGAGGGAGAATGG + Intronic
1011746398 6:90411667-90411689 GAGGAAAGACCAAGGCTGAAAGG - Intergenic
1017143074 6:151209386-151209408 GGGTAAAAATCAAGGATAAAGGG + Intergenic
1023733139 7:43210844-43210866 CGGTAAATATCAATGGTGGACGG + Intronic
1024549164 7:50546425-50546447 GGGTAAGTATCAAGGGTGGAGGG + Intronic
1029746109 7:102516644-102516666 GGGGAAAGCTCAAAGGTCAAGGG - Intronic
1029764047 7:102615623-102615645 GGGGAAAGCTCAAAGGTCAAGGG - Intronic
1029863279 7:103598512-103598534 GGATAAAGATCTAAGGTGAGGGG + Intronic
1030059073 7:105608747-105608769 GGGTAAAGATTATGGGGAAATGG - Intronic
1031055127 7:116984833-116984855 GGGTAAATATTAAGTCTGAATGG - Intronic
1032492591 7:132334683-132334705 GGTTAAACAACAAGGGGGAATGG + Intronic
1032495142 7:132355732-132355754 GGGTAGAGGGCAAGGGGGAAGGG + Intronic
1033930798 7:146518073-146518095 GTTTAAAAAGCAAGGGTGAATGG - Intronic
1037941305 8:22953047-22953069 GGGGAAAAATCAGGGGAGAAGGG - Intronic
1038053338 8:23833909-23833931 GGGCAGAGATCAGGTGTGAATGG + Intergenic
1038522447 8:28244740-28244762 GGGGAAAGGTCAGGGGTCAAAGG + Intergenic
1040055108 8:43051076-43051098 TGATAAAGGTGAAGGGTGAAAGG + Intronic
1042874696 8:73430264-73430286 GAATAAAAATCAAGGGTGAAGGG + Intronic
1047452841 8:124981768-124981790 GGCAGAAGGTCAAGGGTGAAGGG + Intergenic
1048549038 8:135416577-135416599 CGGTAATGGTCAATGGTGAATGG + Intergenic
1050410921 9:5363744-5363766 GGGAAAAGATGAACGGAGAAGGG + Intronic
1052840784 9:33289605-33289627 GGGGAAAGGTGGAGGGTGAACGG - Intergenic
1057107686 9:92435570-92435592 GTTTAAAGATGAAGGGGGAAGGG - Intronic
1057588366 9:96349447-96349469 GGGTAGAGATCACGGGAGAGCGG - Intronic
1058168964 9:101656120-101656142 GGGGAAAGAACAAGGGTAAAAGG + Intronic
1058228337 9:102394481-102394503 GGGTAATGATCAAGGTAAAAAGG - Intergenic
1058349402 9:104003429-104003451 GGGAGAAGAGGAAGGGTGAAGGG + Intergenic
1058526045 9:105858651-105858673 GGCTAAAGCTCAAAGCTGAAAGG - Intergenic
1058743394 9:107966506-107966528 AGGTGAAGATGAAGGGTGAAGGG - Intergenic
1059827902 9:118052914-118052936 GCATAAAAATCAAGAGTGAAGGG - Intergenic
1060190323 9:121588536-121588558 GGGGAAAGGGGAAGGGTGAAGGG + Intronic
1186776309 X:12868196-12868218 GAGGAAACATCAAGGGTAAAAGG + Intronic
1193481720 X:82035624-82035646 GGGTACAGAACAAAGATGAATGG - Intergenic
1193668138 X:84349652-84349674 GGGTTAAGGTCAAGGGTTAAGGG - Intronic
1195079095 X:101354404-101354426 AGGTAGAGATAAAGGGAGAAAGG + Intronic
1195123967 X:101786637-101786659 GGAGAAAGATGAAGGCTGAAAGG + Intergenic
1195652348 X:107298410-107298432 GAGGAAACATCAGGGGTGAAGGG + Intergenic
1196097607 X:111816694-111816716 GGGTAATGGTGAAGGGAGAAGGG + Intronic
1196504453 X:116424925-116424947 GGGTAAAGAGTAAAGGTAAAAGG + Intergenic
1197690437 X:129494883-129494905 GGGTAAAGATCATGGTTTTATGG - Intronic
1197753129 X:129979480-129979502 GGGTAAAGGGTAAGGGTCAAGGG + Intergenic
1198421237 X:136472388-136472410 GGGTGAGGAGTAAGGGTGAAGGG - Intergenic
1200060159 X:153480487-153480509 GGGTAAAGAGGAAGGGCGATGGG + Intronic
1201513533 Y:14791672-14791694 GGTTAAAGATCAAAGATCAAGGG - Intronic