ID: 965746840

View in Genome Browser
Species Human (GRCh38)
Location 3:171935176-171935198
Sequence TAGCAGAGACCCACCCTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965746840 Original CRISPR TAGCAGAGACCCACCCTGAA GGG Intronic
900590410 1:3456925-3456947 AAGCAGAGAGCCACCCTGCGCGG - Intronic
900829575 1:4956358-4956380 TAGCTGAGATTCAGCCTGAAAGG - Intergenic
901681701 1:10916525-10916547 CACCAGAGACCAACCCTGATGGG + Intergenic
904448693 1:30597211-30597233 TTGCAGTCACCCTCCCTGAAAGG - Intergenic
906232012 1:44172085-44172107 AAGCAGAGACCAAACCTTAATGG + Intergenic
906483115 1:46213969-46213991 TTGTAGAGATCCACTCTGAAGGG + Intronic
924907308 1:248469773-248469795 CAGCTGACACCCACCATGAAGGG - Intergenic
924916804 1:248578340-248578362 CAGCTGACACCCACCATGAAGGG + Intergenic
1062805024 10:412667-412689 TCCCAGAGCCCCACCCTGAAAGG + Intronic
1063889234 10:10612508-10612530 TAGCAGAGACACATTCTGTATGG + Intergenic
1069124701 10:64615840-64615862 TGGGAGAGTCCCACCCTGCAGGG - Intergenic
1070956629 10:80468113-80468135 GGGCAGAAACCCAGCCTGAAAGG - Intronic
1071132865 10:82416247-82416269 TAACTGAGAGCCACCCTGTAGGG + Intronic
1071776754 10:88797771-88797793 TAGCACAGCCCCACACTAAACGG + Intergenic
1074190158 10:111128599-111128621 TAGCAGAGGCTCACCCAGGATGG + Intergenic
1075515826 10:123107450-123107472 CAGCAGAGACCCAGCCAAAATGG + Intergenic
1077429951 11:2511418-2511440 ATGCAGAGACTGACCCTGAAGGG - Intronic
1080886439 11:36372385-36372407 AAGCAGAGGCCCTCCCTGAGAGG - Intronic
1083018896 11:59485918-59485940 TCCCAGAGAACCACACTGAATGG - Intergenic
1083822986 11:65182979-65183001 TAGCCGAGTCCCACCCAGGATGG - Intronic
1086802580 11:91195596-91195618 TAGCAAAGAACTACCCTGCAAGG + Intergenic
1088555957 11:111060933-111060955 AATAAGAGACCCACACTGAAAGG - Intergenic
1088796012 11:113267493-113267515 CAACAGAGAGCCACCCTGGAGGG + Intronic
1092680478 12:10974430-10974452 TAGCAGATTCCCAACCTTAAGGG + Intronic
1103260390 12:119583305-119583327 TAGCAGAGATCCAGCCCAAAAGG + Intergenic
1103623777 12:122204114-122204136 CAGCAGAGACCCACTCTGCGGGG - Intronic
1104965972 12:132509004-132509026 GCGCAGAGCCCCACCCTGGAAGG - Intronic
1110713007 13:78670736-78670758 TAGTTGAGGCCAACCCTGAAGGG - Intergenic
1113577506 13:111404605-111404627 TAGCACAGACCCAACATCAAAGG - Intergenic
1113597736 13:111546561-111546583 TTGCAAAGGCCCACCCTGGATGG - Intergenic
1114144246 14:19955165-19955187 TTTCAGAGACCCACCCTCAGGGG - Intergenic
1114599001 14:23939098-23939120 TGGCAGAGAACCTTCCTGAAAGG - Intergenic
1115657059 14:35453430-35453452 AAGCAGAAACCCACCCTGGACGG - Intergenic
1116061799 14:39933148-39933170 TACCAGAGACACACCCTGCAAGG - Intergenic
1128317924 15:66672744-66672766 TAGCAGGGAGGCACCCTCAAGGG + Intronic
1128408673 15:67370450-67370472 TATCAGAGACCGTTCCTGAAGGG + Intronic
1128556150 15:68633121-68633143 TAGAAGTGACCCACACTCAATGG - Intronic
1131444930 15:92490755-92490777 TAGCAGAGAGCATCTCTGAAGGG - Intronic
1138133922 16:54504993-54505015 TAACAGAGACCCACCTTAACAGG + Intergenic
1140339722 16:74146032-74146054 TAGCATGGACCACCCCTGAAAGG + Intergenic
1140711517 16:77682635-77682657 TAGGTGAGAATCACCCTGAATGG - Intergenic
1144991832 17:19238196-19238218 TGGCAGAGACCCACCCGGCCCGG + Intronic
1147949442 17:44098810-44098832 TAGCAAAGAGCCCCACTGAAAGG + Intronic
1150325173 17:64251215-64251237 TACCAGAGCCCCTCCCTTAATGG + Intronic
1154360255 18:13654747-13654769 TTCCAGAGACCCACCCAGAGTGG + Intergenic
1157359340 18:46963788-46963810 CAGCAGAGGCCCGCCCTGAGCGG + Exonic
1157360335 18:46969715-46969737 CAGCAGAGGCCCGCCCTGAGCGG + Intronic
1157360934 18:47023307-47023329 CAGCAGAGGCCCGCCCTGAGCGG + Exonic
1157361924 18:47029222-47029244 CAGCAGAGGCCCGCCCTGAGCGG + Exonic
1163403746 19:17110020-17110042 GAGCAGAGAGGCAGCCTGAACGG - Intronic
1168312920 19:55470275-55470297 TAGCAAAGTCCCACACTGAGTGG - Intergenic
925360133 2:3273329-3273351 TAGCAGAGGCCAAGCATGAAGGG - Intronic
925670141 2:6302563-6302585 TAGCAGAAACAGGCCCTGAAAGG + Intergenic
931690747 2:64832718-64832740 TAGCAAAAACCAACCCTGCAGGG - Intergenic
933247993 2:79997134-79997156 TAGCAGAGATGCACCCAAAAGGG - Intronic
939558088 2:143701384-143701406 TATCAGAGATCCATCCTCAAAGG + Intronic
943541466 2:189220136-189220158 CAGCTGAGGCCCACCCTGAAGGG + Intergenic
945502411 2:210592464-210592486 TCCCAGAGACCCACCCAGATGGG - Intronic
948342903 2:237269641-237269663 TGGCAGGGAACCACCCAGAATGG - Intergenic
1174967261 20:55231578-55231600 TGGCGGAGATGCACCCTGAATGG - Intergenic
1175221741 20:57421247-57421269 TAGCTGGGACCCACCCTGTGTGG + Intergenic
1180070913 21:45435468-45435490 GAGCACAGACCCACCAGGAATGG + Intronic
1184693201 22:46126676-46126698 TTGCAGAGACCTGCCCGGAAAGG + Intergenic
953186386 3:40641975-40641997 TACCAGAAAACCACCCTGGAGGG - Intergenic
954034022 3:47840869-47840891 TAGCAGACCCCAACCCTGGAGGG - Exonic
954272398 3:49520063-49520085 TAGCAGAGTCACACCCACAAGGG - Intronic
962074636 3:132068676-132068698 AAGCACAGACCTAACCTGAAAGG + Intronic
965746840 3:171935176-171935198 TAGCAGAGACCCACCCTGAAGGG + Intronic
968083265 3:195861846-195861868 TGGCCCAGACTCACCCTGAATGG + Intergenic
968596628 4:1489389-1489411 AAGCAGAGACACAGCCTGGACGG - Intergenic
986514744 5:8549363-8549385 TAGCAGAGCCACTCCCTGCAGGG - Intergenic
993466304 5:88250829-88250851 TAGCAGACAGGCACCCAGAAGGG + Intronic
995204973 5:109469387-109469409 AAGCAGAGACCAACCTTCAAAGG - Intergenic
997066035 5:130560025-130560047 TGGCAGAGACACAACATGAAAGG + Intergenic
998585196 5:143419948-143419970 TTTCAGAGACCCACCCTCAGGGG + Intronic
1004003213 6:11614842-11614864 TACCAGAGACTCTCCTTGAAGGG + Intergenic
1005673747 6:28133253-28133275 TAGCAGAGAGCTATCCTGAATGG + Intergenic
1006180995 6:32153494-32153516 TATAAGCGACCCACCCTCAAGGG - Intronic
1006785670 6:36665200-36665222 CACCAGAGACCCACCCTGGGTGG + Intergenic
1010932376 6:81818466-81818488 TAGCTGAGACCCACCATGCTGGG - Intergenic
1011516640 6:88162147-88162169 AAGCAGATATCCACCTTGAATGG - Intronic
1014223918 6:118826278-118826300 TAGCAGTGCACCTCCCTGAAGGG + Exonic
1018923135 6:168189587-168189609 CAGCAGAGGCCCCCCCTCAAAGG + Intergenic
1019284529 7:216956-216978 GAGCGGGGGCCCACCCTGAACGG + Intronic
1021857775 7:24874591-24874613 TATCAGTGACCCACCAAGAAGGG + Intronic
1024251341 7:47507920-47507942 AAGCAGAGACCCAGCTTGAGGGG - Intronic
1026681158 7:72467532-72467554 TGGCAGAGCCCCACCCAGATTGG + Intergenic
1029646518 7:101860135-101860157 TAGCAGAGACTCTCCTTGAAGGG + Intronic
1031201733 7:118697120-118697142 TAGGAAAGATCCACCCTCAATGG + Intergenic
1034470887 7:151253814-151253836 CAGCAGAGCCACACCCTGGAAGG - Intronic
1036506388 8:9360273-9360295 CAGCAGAGACCCCGACTGAAAGG - Intergenic
1049794029 8:144488351-144488373 TAGCAGAGCCACTCCCTCAAGGG - Intronic
1050928235 9:11293191-11293213 TCGCAGAGACCCACCAAAAAAGG - Intergenic
1051662535 9:19439524-19439546 TAGTAGAGACCCAGCCTAAAGGG + Intronic
1054207453 9:62143454-62143476 GAGTAGAGAAACACCCTGAAAGG - Intergenic
1054630900 9:67444900-67444922 GAGTAGAGAAACACCCTGAAAGG + Intergenic
1059699761 9:116763858-116763880 TCGCAGAGACCCACCTGCAATGG - Intronic
1059905578 9:118981436-118981458 TATCAGAGACCCTCTCTGGAAGG - Intergenic
1061136261 9:128735695-128735717 GAGCAGAGACCCAGCCTGTGGGG + Intronic
1062321840 9:135994040-135994062 TACCAGAGCCCCACCGGGAAGGG - Intergenic
1185912666 X:3999689-3999711 AAGCAGAGACACAGCCTGAGGGG - Intergenic
1188363220 X:29282390-29282412 TAACAGAGACCCTCCCTCTAAGG + Intronic
1189165558 X:38857592-38857614 AAGCAGAGACCCGCCTTCAACGG - Intergenic
1190292322 X:49001125-49001147 TTGTAGAGGCCTACCCTGAAGGG - Intronic
1194966694 X:100296620-100296642 GAGGAGAGGCCTACCCTGAAAGG - Exonic
1196174510 X:112626404-112626426 TAGCAGAGACACTACATGAAAGG + Intergenic
1197427391 X:126314135-126314157 GAGAGTAGACCCACCCTGAAGGG - Intergenic
1199000990 X:142636110-142636132 CAGCTGAGACTCACCCTGAAGGG + Intergenic