ID: 965750100

View in Genome Browser
Species Human (GRCh38)
Location 3:171966842-171966864
Sequence TCAATTCTGTTTCCATCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965750100_965750108 5 Left 965750100 3:171966842-171966864 CCCCAGGATGGAAACAGAATTGA No data
Right 965750108 3:171966870-171966892 AGGTTAACGGCAGAGGCAAGAGG No data
965750100_965750109 6 Left 965750100 3:171966842-171966864 CCCCAGGATGGAAACAGAATTGA No data
Right 965750109 3:171966871-171966893 GGTTAACGGCAGAGGCAAGAGGG No data
965750100_965750106 -8 Left 965750100 3:171966842-171966864 CCCCAGGATGGAAACAGAATTGA No data
Right 965750106 3:171966857-171966879 AGAATTGAGGGCTAGGTTAACGG No data
965750100_965750110 13 Left 965750100 3:171966842-171966864 CCCCAGGATGGAAACAGAATTGA No data
Right 965750110 3:171966878-171966900 GGCAGAGGCAAGAGGGCAGTAGG No data
965750100_965750107 -2 Left 965750100 3:171966842-171966864 CCCCAGGATGGAAACAGAATTGA No data
Right 965750107 3:171966863-171966885 GAGGGCTAGGTTAACGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965750100 Original CRISPR TCAATTCTGTTTCCATCCTG GGG (reversed) Intergenic
No off target data available for this crispr