ID: 965752375

View in Genome Browser
Species Human (GRCh38)
Location 3:171989673-171989695
Sequence CACCCAGTTGTGGCAGCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965752375_965752380 4 Left 965752375 3:171989673-171989695 CCCGAGGCTGCCACAACTGGGTG No data
Right 965752380 3:171989700-171989722 AAAGCAACAAAAATTTGGCCAGG No data
965752375_965752379 -1 Left 965752375 3:171989673-171989695 CCCGAGGCTGCCACAACTGGGTG No data
Right 965752379 3:171989695-171989717 GGTTTAAAGCAACAAAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965752375 Original CRISPR CACCCAGTTGTGGCAGCCTC GGG (reversed) Intergenic
No off target data available for this crispr