ID: 965754406

View in Genome Browser
Species Human (GRCh38)
Location 3:172010837-172010859
Sequence CCTAGGGAAGTGTAGTACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965754406_965754410 9 Left 965754406 3:172010837-172010859 CCAATGTACTACACTTCCCTAGG No data
Right 965754410 3:172010869-172010891 CTTGAAGAAAGAAAAACAGCAGG No data
965754406_965754411 15 Left 965754406 3:172010837-172010859 CCAATGTACTACACTTCCCTAGG No data
Right 965754411 3:172010875-172010897 GAAAGAAAAACAGCAGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965754406 Original CRISPR CCTAGGGAAGTGTAGTACAT TGG (reversed) Intergenic
No off target data available for this crispr