ID: 965754410

View in Genome Browser
Species Human (GRCh38)
Location 3:172010869-172010891
Sequence CTTGAAGAAAGAAAAACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965754409_965754410 -8 Left 965754409 3:172010854-172010876 CCTAGGTTACTTATACTTGAAGA No data
Right 965754410 3:172010869-172010891 CTTGAAGAAAGAAAAACAGCAGG No data
965754408_965754410 -7 Left 965754408 3:172010853-172010875 CCCTAGGTTACTTATACTTGAAG No data
Right 965754410 3:172010869-172010891 CTTGAAGAAAGAAAAACAGCAGG No data
965754405_965754410 10 Left 965754405 3:172010836-172010858 CCCAATGTACTACACTTCCCTAG No data
Right 965754410 3:172010869-172010891 CTTGAAGAAAGAAAAACAGCAGG No data
965754406_965754410 9 Left 965754406 3:172010837-172010859 CCAATGTACTACACTTCCCTAGG No data
Right 965754410 3:172010869-172010891 CTTGAAGAAAGAAAAACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965754410 Original CRISPR CTTGAAGAAAGAAAAACAGC AGG Intergenic