ID: 965754902

View in Genome Browser
Species Human (GRCh38)
Location 3:172015813-172015835
Sequence CCGTGTCAAGCACTGTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965754902_965754910 12 Left 965754902 3:172015813-172015835 CCCCAGCACAGTGCTTGACACGG No data
Right 965754910 3:172015848-172015870 ATCAATAAATGAGACCAAGAAGG No data
965754902_965754911 13 Left 965754902 3:172015813-172015835 CCCCAGCACAGTGCTTGACACGG No data
Right 965754911 3:172015849-172015871 TCAATAAATGAGACCAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965754902 Original CRISPR CCGTGTCAAGCACTGTGCTG GGG (reversed) Intergenic
No off target data available for this crispr