ID: 965754923

View in Genome Browser
Species Human (GRCh38)
Location 3:172015945-172015967
Sequence TTTTGAAAGGGGGTTGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965754917_965754923 -3 Left 965754917 3:172015925-172015947 CCAAAGTCGAGGCAGGAAAGTTT No data
Right 965754923 3:172015945-172015967 TTTTGAAAGGGGGTTGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965754923 Original CRISPR TTTTGAAAGGGGGTTGTGGA TGG Intergenic
No off target data available for this crispr