ID: 965755606

View in Genome Browser
Species Human (GRCh38)
Location 3:172023340-172023362
Sequence TTCCTTGACCTGCCAGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965755603_965755606 28 Left 965755603 3:172023289-172023311 CCAAACCAAGGTAGACATCAGAC No data
Right 965755606 3:172023340-172023362 TTCCTTGACCTGCCAGAAAGTGG No data
965755604_965755606 23 Left 965755604 3:172023294-172023316 CCAAGGTAGACATCAGACTTTGC No data
Right 965755606 3:172023340-172023362 TTCCTTGACCTGCCAGAAAGTGG No data
965755605_965755606 1 Left 965755605 3:172023316-172023338 CCTGCAGTATCTAATATCTGAAG No data
Right 965755606 3:172023340-172023362 TTCCTTGACCTGCCAGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965755606 Original CRISPR TTCCTTGACCTGCCAGAAAG TGG Intergenic
No off target data available for this crispr