ID: 965756269

View in Genome Browser
Species Human (GRCh38)
Location 3:172030780-172030802
Sequence AACCTTGTGAATAACATAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965756269_965756273 13 Left 965756269 3:172030780-172030802 CCATTTATGTTATTCACAAGGTT No data
Right 965756273 3:172030816-172030838 AGGGTAGTAGTAGCTCACTTTGG No data
965756269_965756276 16 Left 965756269 3:172030780-172030802 CCATTTATGTTATTCACAAGGTT No data
Right 965756276 3:172030819-172030841 GTAGTAGTAGCTCACTTTGGGGG No data
965756269_965756275 15 Left 965756269 3:172030780-172030802 CCATTTATGTTATTCACAAGGTT No data
Right 965756275 3:172030818-172030840 GGTAGTAGTAGCTCACTTTGGGG No data
965756269_965756271 -6 Left 965756269 3:172030780-172030802 CCATTTATGTTATTCACAAGGTT No data
Right 965756271 3:172030797-172030819 AAGGTTTCCAGTCAACAGTAGGG No data
965756269_965756270 -7 Left 965756269 3:172030780-172030802 CCATTTATGTTATTCACAAGGTT No data
Right 965756270 3:172030796-172030818 CAAGGTTTCCAGTCAACAGTAGG No data
965756269_965756274 14 Left 965756269 3:172030780-172030802 CCATTTATGTTATTCACAAGGTT No data
Right 965756274 3:172030817-172030839 GGGTAGTAGTAGCTCACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965756269 Original CRISPR AACCTTGTGAATAACATAAA TGG (reversed) Intergenic
No off target data available for this crispr