ID: 965756272

View in Genome Browser
Species Human (GRCh38)
Location 3:172030804-172030826
Sequence ACTACTACCCTACTGTTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965756272_965756274 -10 Left 965756272 3:172030804-172030826 CCAGTCAACAGTAGGGTAGTAGT No data
Right 965756274 3:172030817-172030839 GGGTAGTAGTAGCTCACTTTGGG No data
965756272_965756278 29 Left 965756272 3:172030804-172030826 CCAGTCAACAGTAGGGTAGTAGT No data
Right 965756278 3:172030856-172030878 CTCAGATTTTTGACTTTGCAGGG No data
965756272_965756276 -8 Left 965756272 3:172030804-172030826 CCAGTCAACAGTAGGGTAGTAGT No data
Right 965756276 3:172030819-172030841 GTAGTAGTAGCTCACTTTGGGGG No data
965756272_965756275 -9 Left 965756272 3:172030804-172030826 CCAGTCAACAGTAGGGTAGTAGT No data
Right 965756275 3:172030818-172030840 GGTAGTAGTAGCTCACTTTGGGG No data
965756272_965756277 28 Left 965756272 3:172030804-172030826 CCAGTCAACAGTAGGGTAGTAGT No data
Right 965756277 3:172030855-172030877 ACTCAGATTTTTGACTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965756272 Original CRISPR ACTACTACCCTACTGTTGAC TGG (reversed) Intergenic
No off target data available for this crispr