ID: 965756276

View in Genome Browser
Species Human (GRCh38)
Location 3:172030819-172030841
Sequence GTAGTAGTAGCTCACTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965756269_965756276 16 Left 965756269 3:172030780-172030802 CCATTTATGTTATTCACAAGGTT No data
Right 965756276 3:172030819-172030841 GTAGTAGTAGCTCACTTTGGGGG No data
965756272_965756276 -8 Left 965756272 3:172030804-172030826 CCAGTCAACAGTAGGGTAGTAGT No data
Right 965756276 3:172030819-172030841 GTAGTAGTAGCTCACTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965756276 Original CRISPR GTAGTAGTAGCTCACTTTGG GGG Intergenic
No off target data available for this crispr