ID: 965757374

View in Genome Browser
Species Human (GRCh38)
Location 3:172040156-172040178
Sequence CCTCCCGGAATCTCCGCGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 62}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965757365_965757374 8 Left 965757365 3:172040125-172040147 CCAGCAGATTTTGTCCGAGGAAT 0: 1
1: 0
2: 0
3: 5
4: 70
Right 965757374 3:172040156-172040178 CCTCCCGGAATCTCCGCGGCAGG 0: 1
1: 0
2: 1
3: 7
4: 62
965757360_965757374 18 Left 965757360 3:172040115-172040137 CCCAGCCTTCCCAGCAGATTTTG 0: 1
1: 0
2: 2
3: 26
4: 262
Right 965757374 3:172040156-172040178 CCTCCCGGAATCTCCGCGGCAGG 0: 1
1: 0
2: 1
3: 7
4: 62
965757364_965757374 9 Left 965757364 3:172040124-172040146 CCCAGCAGATTTTGTCCGAGGAA 0: 1
1: 0
2: 0
3: 11
4: 209
Right 965757374 3:172040156-172040178 CCTCCCGGAATCTCCGCGGCAGG 0: 1
1: 0
2: 1
3: 7
4: 62
965757354_965757374 26 Left 965757354 3:172040107-172040129 CCCCCACCCCCAGCCTTCCCAGC 0: 1
1: 4
2: 60
3: 395
4: 2952
Right 965757374 3:172040156-172040178 CCTCCCGGAATCTCCGCGGCAGG 0: 1
1: 0
2: 1
3: 7
4: 62
965757353_965757374 27 Left 965757353 3:172040106-172040128 CCCCCCACCCCCAGCCTTCCCAG 0: 1
1: 2
2: 44
3: 277
4: 1897
Right 965757374 3:172040156-172040178 CCTCCCGGAATCTCCGCGGCAGG 0: 1
1: 0
2: 1
3: 7
4: 62
965757352_965757374 30 Left 965757352 3:172040103-172040125 CCTCCCCCCACCCCCAGCCTTCC 0: 1
1: 7
2: 80
3: 760
4: 4707
Right 965757374 3:172040156-172040178 CCTCCCGGAATCTCCGCGGCAGG 0: 1
1: 0
2: 1
3: 7
4: 62
965757359_965757374 19 Left 965757359 3:172040114-172040136 CCCCAGCCTTCCCAGCAGATTTT 0: 1
1: 0
2: 2
3: 74
4: 1175
Right 965757374 3:172040156-172040178 CCTCCCGGAATCTCCGCGGCAGG 0: 1
1: 0
2: 1
3: 7
4: 62
965757358_965757374 20 Left 965757358 3:172040113-172040135 CCCCCAGCCTTCCCAGCAGATTT 0: 1
1: 0
2: 4
3: 55
4: 896
Right 965757374 3:172040156-172040178 CCTCCCGGAATCTCCGCGGCAGG 0: 1
1: 0
2: 1
3: 7
4: 62
965757366_965757374 -6 Left 965757366 3:172040139-172040161 CCGAGGAATCCGCTCCCCCTCCC 0: 1
1: 0
2: 0
3: 23
4: 274
Right 965757374 3:172040156-172040178 CCTCCCGGAATCTCCGCGGCAGG 0: 1
1: 0
2: 1
3: 7
4: 62
965757356_965757374 24 Left 965757356 3:172040109-172040131 CCCACCCCCAGCCTTCCCAGCAG 0: 1
1: 0
2: 14
3: 97
4: 996
Right 965757374 3:172040156-172040178 CCTCCCGGAATCTCCGCGGCAGG 0: 1
1: 0
2: 1
3: 7
4: 62
965757355_965757374 25 Left 965757355 3:172040108-172040130 CCCCACCCCCAGCCTTCCCAGCA 0: 1
1: 2
2: 21
3: 218
4: 1464
Right 965757374 3:172040156-172040178 CCTCCCGGAATCTCCGCGGCAGG 0: 1
1: 0
2: 1
3: 7
4: 62
965757361_965757374 17 Left 965757361 3:172040116-172040138 CCAGCCTTCCCAGCAGATTTTGT 0: 1
1: 0
2: 2
3: 87
4: 656
Right 965757374 3:172040156-172040178 CCTCCCGGAATCTCCGCGGCAGG 0: 1
1: 0
2: 1
3: 7
4: 62
965757357_965757374 23 Left 965757357 3:172040110-172040132 CCACCCCCAGCCTTCCCAGCAGA 0: 1
1: 0
2: 9
3: 148
4: 3112
Right 965757374 3:172040156-172040178 CCTCCCGGAATCTCCGCGGCAGG 0: 1
1: 0
2: 1
3: 7
4: 62
965757362_965757374 13 Left 965757362 3:172040120-172040142 CCTTCCCAGCAGATTTTGTCCGA 0: 1
1: 0
2: 1
3: 4
4: 75
Right 965757374 3:172040156-172040178 CCTCCCGGAATCTCCGCGGCAGG 0: 1
1: 0
2: 1
3: 7
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965757374 Original CRISPR CCTCCCGGAATCTCCGCGGC AGG Intronic