ID: 965757415

View in Genome Browser
Species Human (GRCh38)
Location 3:172040309-172040331
Sequence CCGCCTCTCCGCGCCGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 351}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965757400_965757415 30 Left 965757400 3:172040256-172040278 CCATATGGTGGAGGGAAGAGGGC 0: 1
1: 0
2: 2
3: 22
4: 192
Right 965757415 3:172040309-172040331 CCGCCTCTCCGCGCCGGCGGGGG 0: 1
1: 0
2: 1
3: 27
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965757415 Original CRISPR CCGCCTCTCCGCGCCGGCGG GGG Intronic
900000201 1:10640-10662 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900000206 1:10669-10691 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900000211 1:10698-10720 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900000216 1:10727-10749 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900000221 1:10756-10778 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900019903 1:181149-181171 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900019908 1:181178-181200 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900019913 1:181207-181229 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900019918 1:181236-181258 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900019925 1:181265-181287 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900019930 1:181294-181316 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900645324 1:3706361-3706383 CCCCCTCCCCGGGCCTGCGGCGG - Intronic
900645341 1:3706406-3706428 CCCCCTCCCCGGGCCTGCGGCGG - Intronic
900900852 1:5514734-5514756 CCGCCTCGCTGCGCCCCCGGTGG - Intergenic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
902148219 1:14420950-14420972 CCCCCTCTCTGGGCTGGCGGAGG - Intergenic
904050212 1:27634296-27634318 CGCCCCCTCCGCGCCCGCGGCGG - Intronic
904199823 1:28812397-28812419 CTGCAGCTCGGCGCCGGCGGAGG - Exonic
905449329 1:38046773-38046795 CCGCCGCTCCGCTCCGTCTGCGG + Exonic
906114673 1:43348852-43348874 CCGCCTCTCGGGGCCCGAGGAGG + Exonic
908195382 1:61742409-61742431 CCGACTCTCCCCGCCCGGGGCGG - Intergenic
909585288 1:77282126-77282148 CCGCCTCTCCCCGGGGGCTGTGG - Exonic
910193859 1:84621085-84621107 CCGCCCCTCGGCCCCGGCAGAGG - Intergenic
913959467 1:143327637-143327659 GCGCCTCTCCGCGCCAGAGCCGG - Intergenic
914053826 1:144153210-144153232 GCGCCTCTCCGCGCCAGAGCCGG - Intergenic
914125320 1:144813155-144813177 GCGCCTCTCCGCGCCAGAGCCGG + Intergenic
915171015 1:153977309-153977331 CCGCCTCTGCGCTCCGACGGAGG - Exonic
919463174 1:197902626-197902648 CCGCCTCCCAAGGCCGGCGGCGG + Exonic
922250488 1:223845529-223845551 CGGCCCCTCCGCGCGGGCTGCGG + Intronic
924957675 1:248944946-248944968 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
924957680 1:248944975-248944997 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
924957685 1:248945004-248945026 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1062759941 10:10741-10763 GCGCCCCTCCGCGCCTGCGCCGG - Intergenic
1062759948 10:10770-10792 GCGCCCCTCCGCGCCTGCGCCGG - Intergenic
1065549893 10:26860332-26860354 CCGCCTCTCTGCGCCGGGAGAGG - Intronic
1070570647 10:77637748-77637770 CCCGCGCTCCGCGGCGGCGGCGG - Intronic
1070835639 10:79445486-79445508 CCGCCCCTCCGCTGCGGAGGGGG - Exonic
1076754138 10:132559175-132559197 CCGCCGCTCGGGGCCGTCGGTGG + Intronic
1076963519 10:133786460-133786482 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1076963526 10:133786489-133786511 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1076963533 10:133786518-133786540 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1078164472 11:8870793-8870815 CCGCTCCTCTGCGCCTGCGGCGG + Intronic
1078771904 11:14359054-14359076 CCGCTTCTCCGCGCCTCGGGCGG - Exonic
1078928651 11:15896261-15896283 CCAGCTCGCCGCGCCGGCTGCGG - Intergenic
1081699945 11:45146699-45146721 CAGCCTCGGCGCGGCGGCGGCGG - Intronic
1082928991 11:58579502-58579524 CCGAGTATCCCCGCCGGCGGAGG + Exonic
1083823420 11:65184788-65184810 CCACCTCTCCGTGCCTGAGGAGG + Intronic
1087076217 11:94129095-94129117 CCGCCCCGCCCCGCCGGCGGCGG + Exonic
1089560166 11:119339804-119339826 CCGCCTCTCCTCGCGGCCCGGGG + Exonic
1089622051 11:119727938-119727960 CCGACTCTCCGCGCCCGCTGTGG + Intronic
1090474052 11:127003838-127003860 CCGGCTCGCCCCGCTGGCGGAGG - Intergenic
1091372954 11:135076179-135076201 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1091372959 11:135076208-135076230 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1091372964 11:135076237-135076259 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1091372969 11:135076266-135076288 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1091372974 11:135076295-135076317 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1091372979 11:135076324-135076346 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1091372984 11:135076353-135076375 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1091373280 12:10736-10758 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1091373285 12:10765-10787 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1091373290 12:10794-10816 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1091373295 12:10823-10845 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1091373300 12:10852-10874 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1091373305 12:10881-10903 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1091373310 12:10910-10932 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1091474079 12:754097-754119 CTGCCACTTCTCGCCGGCGGCGG - Exonic
1092502652 12:9064544-9064566 CTCCCACTCCGCGGCGGCGGCGG - Intergenic
1096459550 12:51814617-51814639 CCGCCTCTCGCCGCCGCCGCCGG + Intergenic
1096459554 12:51814630-51814652 CGGGGTCTCCGAGCCGGCGGCGG - Intergenic
1096796579 12:54081781-54081803 CCGCCTGTCTTCGCCGGCGCTGG - Intergenic
1100444822 12:94650587-94650609 CCCCCACCCCGCGGCGGCGGCGG - Intergenic
1101493947 12:105236111-105236133 CGGCCACTCCGTGCCCGCGGCGG + Intronic
1102003561 12:109573824-109573846 CCGCCCCTCCGCGCCGAAGCCGG - Exonic
1102498380 12:113334959-113334981 CCGCCTCCCCGCACGGCCGGAGG - Intronic
1102520681 12:113476062-113476084 CCGGGTCTGCGCGGCGGCGGCGG + Intergenic
1103931095 12:124451492-124451514 CCGCCTCTCAGCCCCAGCGCTGG + Intronic
1105578051 13:21671073-21671095 GCCACTCTGCGCGCCGGCGGGGG + Intergenic
1106241928 13:27919968-27919990 CCGCCGGTCCGCGCTGGCTGTGG + Intergenic
1107468023 13:40666644-40666666 CCGCCGCCCCCCGCCCGCGGCGG + Intergenic
1108063250 13:46553353-46553375 CCGCCCCGCCGCTCCTGCGGGGG - Exonic
1113989949 13:114353281-114353303 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1113989954 13:114353310-114353332 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1113989959 13:114353339-114353361 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1113989964 13:114353368-114353390 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1113989969 13:114353397-114353419 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1114031272 14:18583165-18583187 GCGCCTCTTCGCGCCTGCGCCGG - Intergenic
1114612519 14:24052094-24052116 CCGCGGCTCCCCGGCGGCGGCGG + Exonic
1116905089 14:50396635-50396657 CCGGCTCCCCGCGGAGGCGGCGG + Intronic
1117647362 14:57865980-57866002 CCGCATCACAGCGGCGGCGGCGG + Intronic
1118339149 14:64880002-64880024 CCGCCTCCCCGCCCCCGCCGCGG - Intergenic
1118351005 14:64972377-64972399 CCCTCTCTCCGGGGCGGCGGCGG - Intronic
1120168029 14:81220939-81220961 CTGTCTCTCGGCGGCGGCGGCGG - Intronic
1202853658 14_GL000225v1_random:37019-37041 CAGCCTGGCCGCGCCGGCAGAGG + Intergenic
1123423275 15:20148388-20148410 GCGCCTCTCCGCGCCAGCGCCGG - Intergenic
1123439908 15:20282672-20282694 GCGCCTCTCTGCGCCTGCGCTGG + Intergenic
1123532496 15:21154909-21154931 GCGCCTCTCCGCGCCAGCGCCGG - Intergenic
1124629520 15:31328461-31328483 CCGCCCATCCGGCCCGGCGGGGG + Intronic
1126150851 15:45522645-45522667 CCGCCTCGCTGAGCCGGCCGGGG - Exonic
1128582179 15:68818195-68818217 CCGCCCCTCCTCCCCGGCGCGGG - Intronic
1129761474 15:78131427-78131449 CGCCCTCTTCCCGCCGGCGGCGG - Exonic
1130162327 15:81414016-81414038 CCGCACCTCCGCGCCAGCAGAGG - Intergenic
1131827009 15:96330393-96330415 CCCCCTCTCGGCGGCGGCGGCGG + Intronic
1132453287 15:101980190-101980212 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1132453292 15:101980219-101980241 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1132604592 16:788433-788455 CCGCCCTTCCGCGGCGGGGGCGG - Intergenic
1132671321 16:1103249-1103271 CCACCTCTCCTGGCAGGCGGTGG + Intergenic
1132683679 16:1153647-1153669 CCGCAGCTCCGCGCCGCGGGAGG + Intronic
1135419668 16:22297444-22297466 CCGGCTCTCCTCTCAGGCGGCGG - Exonic
1135821885 16:25692387-25692409 CCGGCTCGCGGCGGCGGCGGCGG - Exonic
1137261057 16:46830762-46830784 CAGACTCTCCTCGCCGGCGGCGG - Intronic
1139549815 16:67666975-67666997 CCGCCTCTCCGCCCCTGCCGAGG - Exonic
1139750439 16:69106448-69106470 CCGCCTCCCCGCGCCGGACGCGG - Intronic
1140091907 16:71845938-71845960 CAATCTCTCCGCGCCGGGGGCGG + Intergenic
1141538630 16:84700439-84700461 CCTCCCCGCCGCGCCGGCCGGGG + Intronic
1141838497 16:86559055-86559077 CCGCCTCTCCACGCTGGTGACGG + Intergenic
1142474591 17:181452-181474 CCTTCTCCCCGCGCCGCCGGAGG + Exonic
1143483434 17:7239558-7239580 CTGCGCCTCGGCGCCGGCGGGGG - Intronic
1143527262 17:7479695-7479717 CCTCCTCTCGGCGGCGGCGGCGG - Intronic
1144784433 17:17823819-17823841 CCACCTCCCCACGGCGGCGGGGG + Intronic
1148760446 17:49997098-49997120 CCGCCGCTCCGAGCCCGTGGCGG + Intergenic
1148769023 17:50056347-50056369 CCTGCTCCCCGCGCCGCCGGAGG - Intronic
1149430658 17:56593894-56593916 CTGCCTTCCCGGGCCGGCGGCGG - Exonic
1152438007 17:80288036-80288058 CGGCCTCTCCGCGCCCACCGAGG + Exonic
1152952812 18:10937-10959 GCGCCCCTCCGCGCCTGCGCCGG - Intergenic
1152952819 18:10966-10988 GCGCCCCTCCGCGCCTGCGCCGG - Intergenic
1152952826 18:10995-11017 GCGCCCCTCCGCGCCTGCGCCGG - Intergenic
1152952833 18:11024-11046 GCGCCCCTCCGCGCCTGCGCCGG - Intergenic
1152952840 18:11053-11075 GCGCCCCTCCGCGCCTGCGCCGG - Intergenic
1160904557 19:1446186-1446208 GCCCCTCTCCGCGCAGGCGCAGG + Intergenic
1161802681 19:6424643-6424665 CCGCCGCCGCCCGCCGGCGGGGG - Exonic
1162033199 19:7926041-7926063 CGGCCTCTCCCCGGCGGCGGCGG + Exonic
1163158204 19:15450068-15450090 CCCCCTCGCCGCCCCGGGGGGGG + Intergenic
1165994307 19:39833460-39833482 CCTCCTCTCCCCGCCCCCGGTGG - Exonic
1166704410 19:44900797-44900819 CCTCCTCTCCAGGCCGCCGGTGG - Exonic
1168718987 19:58544642-58544664 CGGCCTCGCGGCGGCGGCGGCGG + Exonic
1168728654 19:58606914-58606936 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1168728660 19:58606944-58606966 CCCCCTCTCTGCGCCTGCGCCGG + Intergenic
1168728668 19:58606974-58606996 CCCCCTCTCTGCGCCTGCGCCGG + Intergenic
1168728676 19:58607004-58607026 CCCCCTCTCTGCGCCTGCGCCGG + Intergenic
1168728691 19:58607064-58607086 CCCCCTCTCTGCGCCTGCGCCGG + Intergenic
1168728702 19:58607098-58607120 CCCCCTCTCTGCGCCTGCGCCGG + Intergenic
1168728710 19:58607129-58607151 CCCCCTCTCTGCGCCTGCGCCGG + Intergenic
1168728725 19:58607167-58607189 CCCCCTCTCTGCGCCTGCGCCGG + Intergenic
1168728733 19:58607198-58607220 CCCCCTCTCTGCGCCTGCGCCGG + Intergenic
1202693302 1_KI270712v1_random:105868-105890 GCGCCTCTCCGCGCCAGAGCCGG - Intergenic
924958320 2:10854-10876 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958325 2:10883-10905 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958330 2:10912-10934 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958335 2:10941-10963 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958340 2:10970-10992 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958345 2:10999-11021 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958350 2:11028-11050 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958355 2:11057-11079 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958360 2:11086-11108 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958365 2:11115-11137 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924985059 2:263586-263608 CCTCCTCCCCGCGCCTGCCGCGG + Intronic
934275693 2:91571629-91571651 GCGCCTCTCCGCGCCAGAGCCGG - Intergenic
935237662 2:101151637-101151659 CCGCCTCTCCGCGCTCTCAGGGG + Intronic
935820350 2:106887139-106887161 CCGGCCTTCCGCGCTGGCGGGGG - Intergenic
936569404 2:113602184-113602206 GCGCCTCTCTGCGCCGGCGCCGG + Intergenic
936569836 2:113603726-113603748 GCGCCTCTCCGCGCCTCCGCCGG - Intergenic
937283635 2:120736601-120736623 CGGCCTCCGCGCGCCGGCGGGGG + Intronic
938496931 2:131802629-131802651 GCGCCTCTCCGCGCCTGCGCCGG + Intergenic
938498051 2:131813623-131813645 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
942241111 2:173964677-173964699 CCGCCCCCCGGCGGCGGCGGCGG + Intronic
942346116 2:175004861-175004883 CCGTCTCCCCGCGCCGCCGCAGG - Intronic
946386859 2:219388515-219388537 CCTCGTCTCCGCCCCTGCGGGGG + Intronic
947418487 2:229921713-229921735 CCTGCTCCCGGCGCCGGCGGCGG - Intronic
949088913 2:242182551-242182573 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949088920 2:242182580-242182602 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949088927 2:242182609-242182631 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949088934 2:242182638-242182660 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949088941 2:242182667-242182689 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949088948 2:242182696-242182718 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949088955 2:242182725-242182747 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949088962 2:242182754-242182776 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1170894579 20:20402051-20402073 CTGCCTCTCCGTGCCTGCTGTGG - Intronic
1171848038 20:30289796-30289818 CCGCCTCTCTTCGCCGGCGCTGG - Intergenic
1172275499 20:33676908-33676930 CCGCCTGTCCCCGCTGGTGGCGG - Exonic
1173221609 20:41136977-41136999 CCGCCTCACACCGGCGGCGGCGG - Exonic
1173672948 20:44810559-44810581 CCGCCTCGCGCTGCCGGCGGGGG - Intergenic
1174172454 20:48625899-48625921 CCGCCTCTGCCAGCCGCCGGTGG - Exonic
1175108833 20:56631534-56631556 CCACCTCTCCGGGCTGGAGGCGG + Exonic
1175429408 20:58891328-58891350 CCGCCTCCCCCCGCCCGCCGCGG + Intronic
1175922558 20:62456977-62456999 CAGCCTCTCCGGGCCAGGGGAGG - Intergenic
1176706230 21:10121407-10121429 GCGCCTCTCTGCGCCTGCGCAGG + Intergenic
1178513830 21:33229897-33229919 CCCCGCCCCCGCGCCGGCGGCGG + Intronic
1180264137 21:46698833-46698855 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264142 21:46698862-46698884 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264147 21:46698891-46698913 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264152 21:46698920-46698942 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264158 21:46698949-46698971 GCGCCTCTCTGCGCCTGCGGCGG + Intergenic
1180264162 21:46698978-46699000 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264167 21:46699007-46699029 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264172 21:46699036-46699058 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264177 21:46699065-46699087 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264182 21:46699094-46699116 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264187 21:46699123-46699145 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264192 21:46699152-46699174 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264197 21:46699181-46699203 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264202 21:46699210-46699232 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264207 21:46699239-46699261 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180346439 22:11706968-11706990 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180354208 22:11825121-11825143 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180384038 22:12167205-12167227 CTGCCTCTCTGCGCCTGCGCCGG - Intergenic
1180455385 22:15510223-15510245 GCGCCTCTTCGCGCCTGCGCCGG - Intergenic
1181162100 22:20965264-20965286 CCGCCTCTTCGCCCCGGCGCCGG + Intronic
1183942032 22:41301459-41301481 TCGCCTCGCCGCGCCCGGGGTGG - Intergenic
1185278485 22:49960108-49960130 CAGCCTCGCAGCCCCGGCGGGGG - Intergenic
1185430375 22:50807214-50807236 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1185430380 22:50807243-50807265 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949089489 3:11012-11034 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089494 3:11041-11063 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089499 3:11070-11092 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089504 3:11099-11121 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089509 3:11128-11150 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089514 3:11157-11179 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089519 3:11186-11208 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089524 3:11215-11237 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089529 3:11244-11266 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089534 3:11273-11295 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089539 3:11302-11324 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089544 3:11331-11353 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089549 3:11360-11382 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089554 3:11389-11411 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089564 3:11447-11469 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089569 3:11476-11498 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089574 3:11505-11527 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089579 3:11534-11556 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089584 3:11563-11585 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089589 3:11592-11614 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089594 3:11621-11643 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089599 3:11650-11672 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089604 3:11679-11701 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089609 3:11708-11730 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
950729766 3:14947541-14947563 CAGCCTCGCCGCCGCGGCGGGGG - Intergenic
950829415 3:15859596-15859618 TCACCTCTCGGCGGCGGCGGCGG - Exonic
953598349 3:44338533-44338555 CACCCTCCCCGCTCCGGCGGCGG - Exonic
954202102 3:49029500-49029522 CCGCCTCGCTGCGGCGGGGGCGG + Intergenic
954468836 3:50674812-50674834 CCGCTGCTGCGCGCCAGCGGAGG - Intergenic
957555633 3:81761708-81761730 CCGCTCCTCCCCGCTGGCGGGGG - Exonic
959591889 3:108090903-108090925 CCACATCTCCGCGCCCGCCGCGG + Exonic
962263205 3:133927776-133927798 CCGCCTCGCCCACCCGGCGGGGG + Intergenic
962498637 3:135966504-135966526 ACGCCCCTCCGCGGCGGCGGCGG - Intronic
965757415 3:172040309-172040331 CCGCCTCTCCGCGCCGGCGGGGG + Intronic
966849345 3:184155290-184155312 GCGCCTCTCCGCGGCGGCCGGGG + Intronic
966911600 3:184562843-184562865 CCGCCTGTCCGCCCCCGCAGCGG - Intronic
968048322 3:195636101-195636123 CCGCCTCTCCGGTCCCGCTGAGG - Intergenic
968161638 3:196432021-196432043 CCGGGTCCCCGGGCCGGCGGGGG + Intronic
968575069 4:1362227-1362249 CCGCCTCCCCGCGGTGGCTGGGG + Intronic
968623254 4:1614146-1614168 CCTCCTGTCCTTGCCGGCGGTGG - Intergenic
968636664 4:1684428-1684450 CAGCCGCGCCGCGCCGACGGAGG + Intergenic
968803141 4:2756118-2756140 CCGCCTGGCCGCGCTGGAGGGGG - Exonic
969057025 4:4408412-4408434 CTGCCTCTCTGGGCAGGCGGAGG + Intronic
972396453 4:38663529-38663551 GCGCCGCGCCGCGCCGGCCGCGG + Intergenic
973373962 4:49275530-49275552 CTGCCTCTCTGCGCCTGCGCCGG - Intergenic
973383450 4:49334709-49334731 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
973387057 4:49519723-49519745 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
973867028 4:55124869-55124891 CCGCCTGTTCTCGCCTGCGGAGG + Intronic
975612182 4:76213889-76213911 CCGCCTCCCCGCGCAGTCGCCGG - Exonic
976431292 4:84966160-84966182 CCGCCTCTCCGGGAGCGCGGGGG + Intronic
985466742 4:190203758-190203780 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985466747 4:190203787-190203809 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985466752 4:190203816-190203838 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985466759 4:190203845-190203867 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985466766 4:190203874-190203896 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985466773 4:190203903-190203925 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985466780 4:190203932-190203954 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985466787 4:190203961-190203983 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985467607 5:12473-12495 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467612 5:12502-12524 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467617 5:12531-12553 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467622 5:12560-12582 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467627 5:12589-12611 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467632 5:12618-12640 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467637 5:12647-12669 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467642 5:12676-12698 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467647 5:12705-12727 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467652 5:12734-12756 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467657 5:12763-12785 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467662 5:12792-12814 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467667 5:12821-12843 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467671 5:12845-12867 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467675 5:12869-12891 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467679 5:12893-12915 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467683 5:12917-12939 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
990382919 5:55233467-55233489 CCGCCTCCCCGCTCGGGCGGCGG + Exonic
992627370 5:78648247-78648269 CTGCTTCTCAGCGCCGCCGGCGG - Intronic
997990808 5:138543139-138543161 CGGCGGCTCCGCGGCGGCGGCGG + Exonic
998130411 5:139648796-139648818 CGGCCTCGCGGCGACGGCGGCGG + Exonic
998849346 5:146338832-146338854 GCGCCTTTCTGCGCCCGCGGCGG - Intronic
1000014634 5:157266286-157266308 CCCCCTCTCCCGGCCCGCGGGGG + Intronic
1001984208 5:176060561-176060583 CCGCAGCTCCGCGCCTGCGGGGG - Intronic
1002233267 5:177783504-177783526 CCGCAGCTCCGCGCCTGCGGGGG + Intronic
1002262711 5:178006277-178006299 CCGCAGCTCCGCGCCTGCGGGGG - Intergenic
1002524361 5:179807027-179807049 CCCCCTCGCGGCGCCGGCGACGG - Intronic
1002559459 5:180071741-180071763 CCGCCTCTAGGCGCCGGCCCCGG - Exonic
1003139192 6:3456868-3456890 CCGCTGCTCCGCGCCGGACGCGG + Intronic
1006860839 6:37170671-37170693 CCGCATCCCCGGGCCGGAGGCGG - Intronic
1007902272 6:45422978-45423000 CCGCCGCTCCCGGCCGGGGGCGG - Intronic
1008932552 6:56955221-56955243 CCGCCAGTCCGCGCCGTCCGCGG + Intronic
1011277334 6:85643440-85643462 CCGCCCTTCCGCTCCGACGGTGG + Intronic
1014230095 6:118893965-118893987 GCCCCTCTCCGCGCCGCCGCCGG + Intronic
1016329983 6:142945515-142945537 CCGCCGCTCCGCTCTCGCGGTGG + Intergenic
1019765150 7:2844328-2844350 CCGCCACTCGGGCCCGGCGGAGG + Intergenic
1020204530 7:6104869-6104891 GCGCCCCTCCGGGCCGCCGGGGG - Exonic
1020418126 7:7969162-7969184 CCCCCTCGCCGAGGCGGCGGGGG + Exonic
1026909472 7:74083901-74083923 CCGCCTCCCCGGGCCGGCGGCGG + Intronic
1028585509 7:92447689-92447711 CCGTGTCTCTGCGCCCGCGGGGG + Exonic
1029075514 7:97930869-97930891 CTGGCTCTCCGCGCGGGGGGGGG - Intergenic
1029546201 7:101211815-101211837 CCCCCTCTCCCCGCAGCCGGAGG - Intronic
1035169500 7:157009837-157009859 CGGCTACTCCGCGGCGGCGGCGG - Exonic
1035512935 8:206264-206286 GCGCCTCTCTGCGCCAGCGCCGG - Intergenic
1038537115 8:28361129-28361151 CTGCCTCTCCTCTCCTGCGGAGG + Exonic
1039512819 8:38105363-38105385 CCGGCCTCCCGCGCCGGCGGTGG - Exonic
1043502809 8:80873845-80873867 CCGGCGCTGCGCGGCGGCGGCGG + Intronic
1044719851 8:95134299-95134321 CCGTCCCCCCGCGGCGGCGGCGG - Intronic
1046907238 8:119586947-119586969 CCACCCCTCCCCGCCGGGGGAGG + Intronic
1048214264 8:132480863-132480885 CCGGCGCTCCGGGGCGGCGGCGG + Exonic
1049419529 8:142510705-142510727 GCGGCTCTCGGCGGCGGCGGCGG + Intronic
1049784653 8:144444569-144444591 CCGCCCCTCGACGGCGGCGGCGG + Intergenic
1049883037 9:10977-10999 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1049883042 9:11006-11028 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1049936315 9:504598-504620 CGGCTTCCCCGCCCCGGCGGCGG + Intronic
1052301384 9:26956495-26956517 CCCTCCTTCCGCGCCGGCGGAGG + Intronic
1053114615 9:35490131-35490153 TCGTCCTTCCGCGCCGGCGGCGG - Intronic
1053643515 9:40108524-40108546 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1053762636 9:41356966-41356988 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1054258422 9:62838362-62838384 GCGCCTCTCCACGCCTGCGCCGG + Intergenic
1054324372 9:63705752-63705774 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054350964 9:64016540-64016562 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054541237 9:66268080-66268102 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1055308348 9:74952819-74952841 CCGCATCTCGGCGGCGGCGAGGG - Exonic
1060700632 9:125747001-125747023 CCGCCTGGCCGAGGCGGCGGCGG + Intergenic
1061003798 9:127917054-127917076 CCGCCCCTCCTCGCCGGCCCCGG - Intergenic
1061365903 9:130172422-130172444 CGGCCACACCGCGCCGGCGCCGG + Intergenic
1061666155 9:132161999-132162021 CCGCGTCTCCGGGACGGCTGCGG + Exonic
1062389229 9:136327466-136327488 CCCCCTCCCCGCGCGGGCGGCGG + Exonic
1062462002 9:136666048-136666070 CCGGCTCCCCCTGCCGGCGGCGG + Intronic
1062499674 9:136846992-136847014 TCGCGGCTCCGCGCCGGGGGCGG - Exonic
1062574577 9:137200262-137200284 CCGCCGCGCCGCGCCGCCGCGGG - Exonic
1202791266 9_KI270719v1_random:91496-91518 GCGCCTCTCTGCGCCTGCGCAGG + Intergenic
1202800350 9_KI270719v1_random:170015-170037 GCGCCTCTCCGCGCCTGCGCCGG - Intergenic
1203788396 EBV:140812-140834 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203788440 EBV:140914-140936 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203788484 EBV:141016-141038 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203788528 EBV:141118-141140 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203788572 EBV:141220-141242 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203788616 EBV:141322-141344 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203788660 EBV:141424-141446 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203788704 EBV:141526-141548 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203788748 EBV:141628-141650 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203788792 EBV:141730-141752 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203788836 EBV:141832-141854 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203788880 EBV:141934-141956 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203788924 EBV:142036-142058 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203788968 EBV:142138-142160 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203789012 EBV:142240-142262 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203789056 EBV:142342-142364 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203789100 EBV:142444-142466 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203789144 EBV:142546-142568 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203789188 EBV:142648-142670 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203789232 EBV:142750-142772 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203789276 EBV:142852-142874 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203789320 EBV:142954-142976 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203789364 EBV:143056-143078 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203789408 EBV:143158-143180 CCGCTGCCCCGCTCCGGCGGGGG + Intergenic
1203551562 Un_KI270743v1:167545-167567 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
1187332439 X:18353940-18353962 CCGCCTCTCCGCCCCTCAGGAGG + Intronic
1190285306 X:48957470-48957492 CCGCCGCGCCGCGGCGCCGGGGG + Exonic
1196707333 X:118727675-118727697 CTGCTGCTCTGCGCCGGCGGCGG + Exonic
1200093870 X:153648211-153648233 CGGCCTCCCCGCGCCGGCGCCGG - Exonic
1200402759 X:156029135-156029157 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1200402764 X:156029164-156029186 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1200402769 X:156029193-156029215 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1200402774 X:156029222-156029244 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1200402779 X:156029251-156029273 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1200402784 X:156029280-156029302 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1200402789 X:156029309-156029331 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1200402794 X:156029338-156029360 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic