ID: 965759263

View in Genome Browser
Species Human (GRCh38)
Location 3:172057758-172057780
Sequence CCAAGGCATGCACTGAGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965759263_965759271 19 Left 965759263 3:172057758-172057780 CCCCACCTCAGTGCATGCCTTGG 0: 1
1: 0
2: 2
3: 19
4: 231
Right 965759271 3:172057800-172057822 TCCCATTATTTCCTTGCAGTAGG 0: 1
1: 0
2: 0
3: 18
4: 151
965759263_965759274 23 Left 965759263 3:172057758-172057780 CCCCACCTCAGTGCATGCCTTGG 0: 1
1: 0
2: 2
3: 19
4: 231
Right 965759274 3:172057804-172057826 ATTATTTCCTTGCAGTAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965759263 Original CRISPR CCAAGGCATGCACTGAGGTG GGG (reversed) Intronic
901453802 1:9352059-9352081 CCAAGGCCTGGGCTGGGGTGAGG + Intronic
903123698 1:21233498-21233520 CCAAGGCTTGCCCACAGGTGGGG + Intronic
906702040 1:47866644-47866666 CCAAGGCATGCGCTGGAATGAGG + Intronic
907922578 1:58927525-58927547 CAAAGGCATGCAGAGAGGTGAGG - Intergenic
911184027 1:94885975-94885997 CTAAGGCATCCACCGAGGTGGGG + Intronic
911543381 1:99185772-99185794 CAAAGGCAATCACTGAAGTGGGG - Intergenic
911545636 1:99213267-99213289 GCAAGGCATCCACTGAAGTTTGG + Intergenic
911729798 1:101281227-101281249 CTAAGGCAGGCACTGAGGGATGG + Intergenic
912224943 1:107722683-107722705 CCAAGCCATGGCATGAGGTGAGG + Intronic
912493937 1:110079328-110079350 CAAAGGCCTGCACTGGGATGTGG + Intergenic
913118075 1:115714821-115714843 TGTAAGCATGCACTGAGGTGAGG - Intronic
913492987 1:119399494-119399516 CCAGGGCCTGTAGTGAGGTGGGG - Intergenic
913664282 1:121033254-121033276 CCACTGCCTGCAGTGAGGTGTGG - Intergenic
914015672 1:143816533-143816555 CCACTGCCTGCAGTGAGGTGTGG - Intergenic
914162111 1:145144475-145144497 CCACTGCCTGCAGTGAGGTGTGG + Intergenic
914654292 1:149725074-149725096 CCACTGCCTGCAGTGAGGTGTGG - Intergenic
914781376 1:150788640-150788662 CCAAGAAATGCACAAAGGTGAGG + Intergenic
915489043 1:156241456-156241478 GGGAGGCAGGCACTGAGGTGGGG - Intronic
916118933 1:161511288-161511310 CCAAGGCAGGGACTGAGGCTGGG + Intronic
917245070 1:172991815-172991837 GCAAGGCATTCACTGAAGTTAGG - Intergenic
918143793 1:181738699-181738721 CCAAGACAAGCACTGGGGAGGGG - Intronic
919800768 1:201353458-201353480 CCAAGGCCAGCACTGAGGGCAGG + Intergenic
919928089 1:202203052-202203074 CCCAGCAATGCACTGAGCTGGGG - Intronic
922491876 1:226024115-226024137 CCAAGGCAGGCCTTGAGGTCAGG + Intergenic
922560878 1:226568745-226568767 CCAAGGCATGAAATGCAGTGAGG + Intronic
1065328753 10:24572173-24572195 CAGAGGCTGGCACTGAGGTGTGG - Intergenic
1065760080 10:28974036-28974058 CCAAGGTAGGCAGGGAGGTGAGG - Intergenic
1067395735 10:45915246-45915268 CCAAGGCATCATCTGAGGTCAGG + Intergenic
1067488818 10:46678597-46678619 CCAAGGCAGGCCTTGAGGTCAGG + Intergenic
1067605850 10:47661779-47661801 CCAAGGCAGGCCTTGAGGTCAGG - Intergenic
1067864057 10:49884369-49884391 CCAAGGCATCATCTGAGGTCAGG + Intronic
1069886452 10:71626934-71626956 GCAAGGCATGCAGAGAAGTGGGG + Intronic
1070257514 10:74825228-74825250 CCAGGGCTGGGACTGAGGTGCGG - Intergenic
1070551393 10:77493413-77493435 CCAGGGCAGGCACTGCTGTGTGG + Intronic
1070703104 10:78617683-78617705 CAAATGCCAGCACTGAGGTGGGG + Intergenic
1071621410 10:87123138-87123160 CCAAGGCAGGCCTTGAGGTCAGG - Intronic
1072687427 10:97546619-97546641 CCAGGGCACGCAGTCAGGTGTGG + Intronic
1072717482 10:97761340-97761362 GCAAGCCATGCCCTGAGCTGGGG + Intergenic
1072954799 10:99878891-99878913 CCAAGGCAGGCAGCGAGGTCAGG + Intronic
1073327377 10:102650607-102650629 CCAGGCCATGCACTGCTGTGGGG + Intronic
1073354838 10:102845531-102845553 TCAGGGCATGCACTGTGGTCGGG + Intergenic
1075347851 10:121697387-121697409 CCAAGGCATCCAGTGTGATGAGG + Intergenic
1076480241 10:130780052-130780074 CCAAGGCATCCACTGGTGGGAGG + Intergenic
1076798939 10:132811833-132811855 CCAGGGCCTGCACTTGGGTGGGG - Intronic
1077783812 11:5360977-5360999 CCAGGGCCTGCAGTGGGGTGGGG + Intronic
1081657730 11:44868474-44868496 CCAACGCCAGTACTGAGGTGGGG - Intronic
1083305126 11:61758077-61758099 CCAAGGCCTGGAGTGAGGGGGGG + Intronic
1083514226 11:63241784-63241806 TGAGGGTATGCACTGAGGTGAGG + Intronic
1083804500 11:65066043-65066065 CCAAGATAAGCACTGGGGTGAGG - Intergenic
1085388512 11:76170637-76170659 CCAAGCCCTGCCCTGAGGTGTGG - Intergenic
1085393448 11:76194350-76194372 CCAAGGCGTCCACTGGGGTTTGG - Intronic
1087633809 11:100680967-100680989 CCAACGTATTCACTGTGGTGTGG + Intergenic
1089502272 11:118939732-118939754 CCAAGGAATGCAGTGAGCAGAGG + Intronic
1090745162 11:129699479-129699501 GCAAGTCAGGCACTGGGGTGGGG - Intergenic
1091831055 12:3551494-3551516 CCAAGGCCGGCACTGAGACGGGG - Intronic
1092173746 12:6389320-6389342 CCAAAGCATGCGGTGGGGTGTGG + Intronic
1092322584 12:7493364-7493386 CCAAGGAACTCACTGAGCTGCGG + Intronic
1092769251 12:11881941-11881963 CCAGGGGATGGGCTGAGGTGGGG - Intronic
1094553458 12:31474180-31474202 CACAGGCATGCAGTGTGGTGTGG + Intronic
1094850070 12:34378387-34378409 CCCATGCATGCGCTGTGGTGAGG + Intergenic
1094852654 12:34389205-34389227 CCCAGGCATGCACGGTGGGGAGG - Intergenic
1095996698 12:48093258-48093280 CCAAGGAATGAATTCAGGTGAGG + Intronic
1096212366 12:49776426-49776448 CCAAGGCCTGCAATGGGTTGGGG + Intergenic
1101070778 12:101073409-101073431 CCAAGGCATGTCGTGGGGTGGGG + Intronic
1102191688 12:110993482-110993504 CCAAACCTTGCACTGGGGTGAGG - Intergenic
1102456929 12:113076985-113077007 CCAAGACAGACACTGAAGTGGGG - Intronic
1102533298 12:113562705-113562727 CCAGGACATGCTCTGAGCTGGGG - Intergenic
1104064027 12:125291651-125291673 TCAAGGCATGCCCTGAGGTGTGG - Intronic
1109058691 13:57584414-57584436 ATCAGGCATGCATTGAGGTGTGG + Intergenic
1111183033 13:84693915-84693937 CCAAGGGTTGCACAGATGTGTGG - Intergenic
1111457248 13:88500810-88500832 CCAATTCATATACTGAGGTGAGG + Intergenic
1112611304 13:100957348-100957370 CAATGGCATGCACTGAGCAGAGG - Intergenic
1112621304 13:101056671-101056693 CAAAGGCATGGACAGAGCTGGGG - Intronic
1113692673 13:112322769-112322791 CCATGGCATGCCCTGTGCTGGGG + Intergenic
1113850188 13:113413457-113413479 CCAAGTCATGGACTGAGAGGGGG + Intergenic
1114674479 14:24431216-24431238 CCAAGGAATGCACTGTGGGGTGG + Intronic
1115257143 14:31415221-31415243 CCAAGGAAAGCCCTCAGGTGAGG - Intronic
1119784798 14:77304784-77304806 CCAAGGAATGCACAGAACTGTGG + Exonic
1121035987 14:90704027-90704049 GCCAGGCATGCACTGAGATGGGG + Intronic
1122783640 14:104154217-104154239 CCAAGGCAAACACTGATCTGGGG + Intronic
1124445935 15:29732153-29732175 CCCAGTCATGCTCTGAGGTAAGG - Intronic
1124864618 15:33477070-33477092 GGAAGTCATGCAGTGAGGTGAGG + Intronic
1126733749 15:51710934-51710956 CCAAGGCATGCACTAAGAGAAGG + Intronic
1128568770 15:68718465-68718487 CTAAAGCACGCACTGTGGTGAGG + Intronic
1129276323 15:74448091-74448113 ACCAGGCAGGCACTGAGCTGGGG - Intronic
1129498513 15:76012470-76012492 CCAAGGTGTGCACAGAGGTCAGG + Intronic
1130355856 15:83129803-83129825 CCCAGGGAAACACTGAGGTGTGG + Exonic
1131098839 15:89672602-89672624 CCAAGGCATACACAGGGCTGAGG - Intronic
1132113024 15:99116052-99116074 CCAAGGGATGAATTGAGGGGTGG + Intronic
1132843821 16:1990861-1990883 CCAAGACAGGCGCCGAGGTGCGG - Intronic
1133039765 16:3054327-3054349 CAGATGCATGCACAGAGGTGGGG + Intronic
1133039817 16:3054667-3054689 CAGATGCATGCACAGAGGTGGGG + Intronic
1133488451 16:6243672-6243694 CCAAGCCATGCACTGAGGTCAGG - Intronic
1136395414 16:29989879-29989901 GCAGGGCATGCACAGAGCTGGGG + Intronic
1136605003 16:31327661-31327683 CAAAGGCATGAACTGAGGGCGGG + Intronic
1137227089 16:46523935-46523957 CCAAGGCATGGAAAGAGTTGGGG + Intergenic
1139688807 16:68625698-68625720 CCAAGGCATGGACTGAGACAGGG - Intergenic
1140531542 16:75671018-75671040 CAAAGGCATGGAGGGAGGTGAGG - Intronic
1141185512 16:81784246-81784268 CTATGCCAGGCACTGAGGTGGGG - Intronic
1141893353 16:86942569-86942591 CCACGGCCTGCACAGATGTGGGG + Intergenic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1145415386 17:22710183-22710205 ACATGGCATGGACAGAGGTGAGG - Intergenic
1147939209 17:44033958-44033980 GAAAGGCAGGCAGTGAGGTGTGG - Intergenic
1148471671 17:47897285-47897307 CCAAGGAATGCAGTGAGGACAGG - Intronic
1149149024 17:53536761-53536783 GCAAGGCATCCACTAAAGTGAGG + Intergenic
1149553898 17:57559598-57559620 ACCAGGCAGGCACTGGGGTGAGG + Intronic
1150844544 17:68641834-68641856 CCAAGGCATCAACTGAGTTCAGG + Intergenic
1152036380 17:77875604-77875626 CCAAGGCTGGCTCTCAGGTGTGG + Intergenic
1152677117 17:81647338-81647360 CCTAGGCATCCACTGATGTCTGG - Intronic
1203193053 17_KI270729v1_random:207077-207099 ACATGGCATGGACAGAGGTGAGG - Intergenic
1203202417 17_KI270730v1_random:6512-6534 ACATGGCATGGACAGAGGTGAGG - Intergenic
1153310503 18:3673161-3673183 CCCAGGCACGCACAGAGGTGTGG - Intronic
1153431752 18:5025043-5025065 CCATGGCATGCACAGGGTTGGGG - Intergenic
1158354946 18:56607626-56607648 CCAAGGAAGGCAGTGAGGTCAGG + Intronic
1160924814 19:1538880-1538902 CCAAGCCATTCTCTGGGGTGGGG - Intergenic
1161747193 19:6068200-6068222 CCAAGGGAGGCATTGAGGTGCGG + Intronic
1166297952 19:41897808-41897830 CCAGGGCAGGGACAGAGGTGGGG - Intronic
1166778455 19:45326623-45326645 CCATGGCAAGCTCTGAGGAGGGG - Intergenic
1167694841 19:51009328-51009350 CCCAGCCATGCCCTGGGGTGGGG + Exonic
1168042082 19:53766620-53766642 CCAAAGCAAGCACTTAAGTGTGG + Intergenic
927696355 2:25242184-25242206 GCAAGGGATGCACAGAGCTGGGG - Intronic
927865060 2:26582950-26582972 CCATGTCAGGCAGTGAGGTGGGG + Intronic
930056538 2:47256729-47256751 CCAAGGCAAGCATTCAGGCGAGG + Intergenic
931915860 2:66955663-66955685 CCAAGGCTTACAGAGAGGTGAGG - Intergenic
932408468 2:71530090-71530112 CCAAAACCTGCACTCAGGTGAGG - Intronic
934535460 2:95129639-95129661 CCAATGAATGAACTGAGATGAGG - Intronic
934735011 2:96685703-96685725 CCAGGGCCTGCAGGGAGGTGGGG - Intergenic
936502614 2:113078124-113078146 CCAGGGCTTGGACTGAGGAGTGG + Intergenic
936654759 2:114472225-114472247 GCAAGGCATCCACTGAAGTTAGG + Intronic
936685513 2:114822206-114822228 CAAAGTCATGAACTGAGGTTTGG - Intronic
937743886 2:125387873-125387895 AAAAGGGATGCTCTGAGGTGGGG - Intergenic
937750567 2:125472160-125472182 CCAGGGCAGCCACTGTGGTGAGG - Intergenic
937973597 2:127567619-127567641 CCACGCCATGGACTGAGTTGGGG - Intronic
939016431 2:136909242-136909264 CCAAGGCAAGGACTGAAATGAGG + Intronic
942370242 2:175276138-175276160 CCAAGTCATGGAGTGAGGTGGGG - Intergenic
942754331 2:179321359-179321381 CCAAGGCCTGCCGTGGGGTGAGG + Intergenic
943365306 2:186962482-186962504 CCAAGCCCTGCACTGTGGGGAGG - Intergenic
947256991 2:228177389-228177411 TCAAGGCCAGCACTGAGCTGTGG - Intronic
947865337 2:233393907-233393929 CCAAGGTGGGCACTGAGGTCAGG - Intronic
948462967 2:238139088-238139110 CCTGGGCAGGCACTGGGGTGAGG + Intronic
948600539 2:239105453-239105475 CCAAGGCCTGCTCTGGAGTGAGG + Intronic
948884003 2:240874080-240874102 CCCAGCCCTGCACAGAGGTGAGG - Intronic
1170204273 20:13781572-13781594 CCAAGCCATGCACTCTGGAGGGG + Intronic
1170501345 20:16977484-16977506 CCAAGGCAAAGATTGAGGTGAGG - Intergenic
1171303788 20:24087048-24087070 CCAAGGCATGCAGGGAGGGAAGG - Intergenic
1171422047 20:25024149-25024171 CCCAGTCATCCACTGGGGTGTGG - Intronic
1172085060 20:32375072-32375094 CCAAGGCAGGCCTTGAGGTCAGG - Intronic
1172093961 20:32451734-32451756 ACAAGGCAGGCCCTGAGCTGAGG + Intronic
1173249167 20:41355644-41355666 CCAAGGCAGACACTGAGGGCTGG + Intronic
1174578025 20:51551155-51551177 GCAAGGCTGGCACTAAGGTGAGG + Intronic
1175662045 20:60821828-60821850 ACAGGGCATGCAGGGAGGTGGGG + Intergenic
1176189400 20:63800766-63800788 CCAAGCCCTGCCCTGAGGGGAGG - Intronic
1178829679 21:36045384-36045406 CCAAGGCAAGCACTGCGGGAGGG + Intronic
1178874271 21:36400832-36400854 CCGAGGCAGGCAGCGAGGTGCGG + Intronic
1179158410 21:38872272-38872294 TACAGGCATGCACTGTGGTGTGG + Intergenic
1179292334 21:40029589-40029611 CCAAGGCATGCAGAGAGGCCAGG + Intronic
1179964991 21:44798086-44798108 TCAAGGCTTGCAATGAGCTGTGG + Intronic
1180711191 22:17840861-17840883 CCCCGGCATGCACGGAGGAGCGG + Intronic
1181343516 22:22200878-22200900 CTGAGGCAGACACTGAGGTGGGG - Intergenic
1181633587 22:24164105-24164127 CTATGGGATGCACTCAGGTGGGG - Intronic
1185385179 22:50528652-50528674 TGAAGGGATGCACAGAGGTGGGG - Intronic
949520423 3:4847951-4847973 CCAGGGCAAGCACTGATTTGAGG - Intronic
949574706 3:5327686-5327708 CCAAGGCCTGTCCTGGGGTGGGG - Intergenic
952450499 3:33427855-33427877 CCAAGGCAGGAGCTTAGGTGGGG - Intronic
952453713 3:33453683-33453705 CCAAGGCCTGCCCTGCGGGGAGG - Intergenic
952617453 3:35291994-35292016 CCAAGGTAAGCAGTGAGTTGTGG - Intergenic
952817533 3:37458621-37458643 CCAGGGCAGCCACAGAGGTGTGG - Intronic
952865534 3:37852948-37852970 CCCAGCCAGGCACTCAGGTGTGG + Intergenic
952973804 3:38676212-38676234 CAAAGACATGAACTGTGGTGGGG + Intergenic
955402670 3:58604349-58604371 CCAGGACATGCTCTGAGCTGAGG - Intronic
956411078 3:68980478-68980500 CCAAACAATTCACTGAGGTGAGG + Intronic
957136793 3:76298563-76298585 TCAAAGAATGCACAGAGGTGAGG + Intronic
957167321 3:76691644-76691666 CCAAGGCATGGACATAGGAGAGG + Intronic
957187316 3:76958394-76958416 CCAAAGCATGAGCTGAGGAGAGG - Intronic
960735298 3:120772865-120772887 CCAAGGCCTGCAGTGAGTGGGGG - Intronic
961312215 3:126010238-126010260 CCAAGGCAGGCAATCAGTTGAGG + Intronic
961604764 3:128085468-128085490 CCAAGGCATTCACTGAACGGAGG - Intronic
963427639 3:145152845-145152867 CCACAGCATGGTCTGAGGTGAGG + Intergenic
963709242 3:148727487-148727509 CCAAGGTCTGCACTGAAGGGAGG - Intronic
964864191 3:161236812-161236834 CCAAGGCATTCACTGAGGAAAGG - Intronic
965098841 3:164271486-164271508 CCATAGCATGCACTGAGGAAAGG + Intergenic
965759263 3:172057758-172057780 CCAAGGCATGCACTGAGGTGGGG - Intronic
966425456 3:179775646-179775668 CCAAGGCCTGCCCTGTGGGGAGG + Intronic
967194458 3:187014480-187014502 CCCAGGCCAGCACTGGGGTGAGG + Intronic
968978604 4:3834793-3834815 GCAAGGGGTGCACTGAGGTCAGG + Intergenic
969299119 4:6287159-6287181 CCAAGGCACAGACTGAGGTGAGG + Exonic
969307804 4:6335717-6335739 CCACTGCATGCAGGGAGGTGAGG + Intronic
974981892 4:68967188-68967210 AGAAGTCATGAACTGAGGTGTGG - Intergenic
977551803 4:98450600-98450622 CCAAGGCATGAACAGAGTTATGG + Intergenic
979469930 4:121083442-121083464 CCAAGGCCTGCAATGGGGTAGGG + Intergenic
982308499 4:153959151-153959173 CCAACGCCTGTAGTGAGGTGGGG + Intergenic
982606446 4:157522438-157522460 GCAGGGCATGAACTGAGCTGAGG + Intergenic
983489716 4:168374178-168374200 CCAAGTCATGCACTCAGGTCTGG + Intronic
985090985 4:186362443-186362465 CCCATGCATGCACTGAGGAAAGG + Intergenic
986412637 5:7495987-7496009 CCTAGGCAAGCACTGAAGGGTGG + Intronic
986727340 5:10608964-10608986 CCAAGGCTGGCACTAAGATGTGG - Intronic
989470502 5:41811876-41811898 CCTAGGCATGAAGTGTGGTGAGG + Intronic
992098272 5:73381927-73381949 CCGAGGCAGGCACTGAGCTCCGG + Intergenic
993658379 5:90600308-90600330 CCAAGGCCTGTTGTGAGGTGGGG - Intronic
997665686 5:135627989-135628011 CTGAGGCATGCACACAGGTGAGG + Intergenic
1000114777 5:158143442-158143464 TCAGGGCATGCAGTGGGGTGGGG - Intergenic
1000298979 5:159937981-159938003 CCTAGGAGAGCACTGAGGTGTGG - Intronic
1001892295 5:175349803-175349825 CCGATGCATGTACTGACGTGTGG - Intergenic
1002080475 5:176734409-176734431 CCAAGCCAAGCACTGAAGTGGGG - Intergenic
1002850663 6:993613-993635 GCATGGTATGCACTGAGATGTGG - Intergenic
1003427600 6:6007907-6007929 CCAAGGCAAGCGCTGGTGTGCGG + Intergenic
1003649149 6:7942604-7942626 CCAAGGAATGCAGTGAGGACAGG - Intronic
1007144701 6:39616719-39616741 CAAAGGCATGAACATAGGTGGGG - Intronic
1007396848 6:41582873-41582895 CCAAGACCTGCCCTGCGGTGGGG + Intronic
1011011775 6:82711371-82711393 CCAGGGCATGAACTGAGCAGAGG - Intergenic
1013166096 6:107593492-107593514 CCAAGGGAGGCACTGTGGTCTGG + Intronic
1013184430 6:107745608-107745630 ACAAGACATGCCCTGAGATGGGG + Intronic
1014060569 6:117066832-117066854 CCAAAGCCAGCACTAAGGTGAGG + Intergenic
1014639059 6:123886107-123886129 CAAAGGCATGCACTTTAGTGAGG + Intronic
1018581124 6:165309177-165309199 CCAGGGAATGCTCTGAAGTGCGG + Intronic
1018690221 6:166338656-166338678 GCAAGGCAAGCACTGGGGAGAGG + Intronic
1019721856 7:2577165-2577187 CCCAGGGAAGCACTGAGCTGGGG - Intronic
1022527350 7:31046934-31046956 CCACGGCAAGCATGGAGGTGTGG - Intergenic
1023306381 7:38833012-38833034 AGAAGGCATTAACTGAGGTGGGG - Intronic
1024199081 7:47088375-47088397 GCAAGGAATGAATTGAGGTGGGG + Intergenic
1024209756 7:47192974-47192996 CCCAGGCAAGCACAGAGGGGAGG + Intergenic
1024748666 7:52436912-52436934 CCAAGGCATTTTCTGAGTTGGGG + Intergenic
1029359324 7:100076850-100076872 CCAAGGTGGGCACTGAGGTCAGG + Intronic
1032878163 7:136059975-136059997 CCCAGGCATGCAAAGAGCTGGGG + Intergenic
1035034997 7:155889049-155889071 CCAAGTGATGCACTAAGGAGGGG - Intergenic
1037946165 8:22990917-22990939 ACAAGGCATGAATTGAGGTCGGG - Intronic
1038831125 8:31062028-31062050 CCAAGGAGAGCACTGAGTTGGGG - Intronic
1039300966 8:36208402-36208424 CCAAGGCATCCACAGAGAAGGGG + Intergenic
1039574517 8:38612654-38612676 CCCAGGCCTGGACTGAGTTGGGG - Intergenic
1039790443 8:40871697-40871719 CCCAGGACAGCACTGAGGTGTGG + Intronic
1045631718 8:104131787-104131809 CCAAGGCAGGAACTGAGGATTGG + Intronic
1048274557 8:133056509-133056531 TCCAGGCACACACTGAGGTGGGG + Intronic
1049717572 8:144100153-144100175 CCCTGGCATGGACTGAGGTGAGG - Intronic
1051502014 9:17788364-17788386 TCAGGGCATGGACTGAGGGGCGG + Intronic
1052343851 9:27388765-27388787 CCAAGGCACGTACTGAGATGGGG - Intronic
1053655088 9:40210662-40210684 CCAAGGCAGGCAGTGAGGTCTGG - Intergenic
1054367203 9:64356878-64356900 CCAAGGCAGGCAGTGAGGTCTGG - Intergenic
1054529511 9:66165652-66165674 CCAAGGCAGGCAGTGAGGTCTGG + Intergenic
1054674834 9:67846615-67846637 CCAAGGCAGGCAGTGAGGTCTGG - Intergenic
1057735779 9:97658426-97658448 CACTGGCTTGCACTGAGGTGCGG - Intronic
1059524115 9:114974117-114974139 CAAAGACATGAAGTGAGGTGTGG + Intergenic
1060134817 9:121143184-121143206 GCAAGGCATTCACTGAGGCTGGG - Intronic
1061925993 9:133806314-133806336 CCCTGGCATGCACAGAGATGTGG - Intronic
1062308346 9:135921971-135921993 CCTAGGCATGGACGGAGGAGTGG + Intergenic
1062375189 9:136258954-136258976 CCGAGACCTGCACTGAGCTGTGG + Intergenic
1062547200 9:137069165-137069187 CCAAGGCAGGCACTGGGTTGGGG + Intronic
1185742971 X:2548601-2548623 TCTAGGCATGCACACAGGTGGGG + Intergenic
1189770301 X:44418599-44418621 TCAAGGCTACCACTGAGGTGGGG - Intergenic
1192361589 X:70444485-70444507 CCCAGGCTTGCTCTGAGCTGGGG - Intergenic
1194245094 X:91500644-91500666 GCAAGACATGCTCTGTGGTGCGG - Intergenic
1194625679 X:96224425-96224447 CCTAGGCAGGCACTGAGGGATGG - Intergenic
1199871808 X:151904873-151904895 GAAAGGCATGGGCTGAGGTGAGG + Intergenic
1200765719 Y:7079148-7079170 CCAAGACATGGAATGAGCTGGGG - Intronic