ID: 965759803

View in Genome Browser
Species Human (GRCh38)
Location 3:172063665-172063687
Sequence AATGATCACATGATGTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 291}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965759801_965759803 21 Left 965759801 3:172063621-172063643 CCATTCGGAGTTGGCTCAGGACA 0: 1
1: 0
2: 0
3: 6
4: 63
Right 965759803 3:172063665-172063687 AATGATCACATGATGTTTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 291
965759802_965759803 -10 Left 965759802 3:172063652-172063674 CCATTATTTTAGTAATGATCACA 0: 1
1: 0
2: 0
3: 33
4: 334
Right 965759803 3:172063665-172063687 AATGATCACATGATGTTTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965759803 Original CRISPR AATGATCACATGATGTTTTG AGG Intronic
900454610 1:2768037-2768059 AATGATCACCTGGGGTTGTGGGG - Intronic
900456128 1:2775662-2775684 AATGATCACCTGGGGTTGTGGGG - Intronic
903443083 1:23402859-23402881 AATGAATACATGATGAATTGAGG + Intronic
904686273 1:32263073-32263095 AATCATCACAAAATGTTCTGTGG - Intronic
904881776 1:33704538-33704560 CTTAATCACATGATGTTTTGGGG + Intronic
906755402 1:48309262-48309284 AATGAACACATAAGGATTTGTGG - Intronic
906879526 1:49575292-49575314 AATGACCACAGGATGAGTTGAGG - Intronic
907396489 1:54194047-54194069 AATAATGTCATGTTGTTTTGGGG + Intronic
907620772 1:55976604-55976626 TATGAGCACATGATTATTTGTGG - Intergenic
907753108 1:57282652-57282674 ACTGATCATATGATGTGCTGTGG - Intronic
908981549 1:69965339-69965361 ACAGATGACATGATGTTTGGAGG - Intronic
909279788 1:73735050-73735072 AATTATTACAGGATATTTTGGGG + Intergenic
909544579 1:76831639-76831661 AATGTTAACATGATGTTGTTGGG - Intergenic
910080601 1:83337298-83337320 AATGATAACAATGTGTTTTGAGG - Intergenic
913085460 1:115432577-115432599 AGAGATCACAGGACGTTTTGAGG + Intergenic
913102017 1:115576949-115576971 ACTGAACACAGTATGTTTTGAGG - Intergenic
914345768 1:146797226-146797248 GATGCTCACATGAGGTTTTCAGG - Intergenic
914353326 1:146859495-146859517 AATGATCAGATCTTGTTTGGGGG - Intergenic
914423051 1:147547016-147547038 TGTGCTCACATGTTGTTTTGAGG + Intronic
914809040 1:151013221-151013243 AATGTGCACATCATGGTTTGCGG + Intronic
915258535 1:154656055-154656077 AATTATAACTTTATGTTTTGGGG - Intergenic
915667821 1:157460820-157460842 AATGACCACAGGATGATTTCAGG + Intergenic
916380790 1:164208458-164208480 AATAATCACAAGATGAATTGAGG - Intergenic
917266423 1:173225376-173225398 AATGATCAAATGAAAATTTGTGG - Intergenic
917705556 1:177630664-177630686 AATGATGGGATGATGCTTTGTGG - Intergenic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
920746435 1:208633392-208633414 AAAGTTGACATGATGTTCTGGGG - Intergenic
920754134 1:208712019-208712041 AATTATCACATAATGGATTGTGG - Intergenic
921550761 1:216532798-216532820 AATCATCATATAATGTTTTACGG - Intronic
922369443 1:224894909-224894931 AAAGATAAAATGATGTTCTGTGG - Intergenic
923797199 1:237169217-237169239 AATGATCTCTTGATATTTGGGGG - Intronic
923962328 1:239100015-239100037 AATGGTCACATTATTTATTGAGG - Intergenic
924907110 1:248467469-248467491 CAGGATCTCATTATGTTTTGTGG + Intergenic
1063328916 10:5135976-5135998 AATTATGACATGATGTTTATTGG + Intergenic
1063727844 10:8658663-8658685 AATGATCTCATCATATCTTGTGG - Intergenic
1064516364 10:16153289-16153311 TAGGATCACATGATTTTTAGAGG - Intergenic
1064847942 10:19676989-19677011 CATGATCTCATTCTGTTTTGTGG + Intronic
1065181101 10:23127187-23127209 AATTATAACATGGTCTTTTGGGG - Intergenic
1066400995 10:35075741-35075763 AATGTTGACATAATGTTTTCTGG - Intronic
1066543570 10:36475315-36475337 AATGATCACAGGATGTGTCTGGG - Intergenic
1067223392 10:44360113-44360135 AATGAGCTCATGATGGTTTAGGG + Intergenic
1067518846 10:46979338-46979360 AATAATCACAAGATGGTTTTAGG - Intronic
1067643401 10:48072496-48072518 AATAATCACAAGATGGTTTTAGG + Intergenic
1068512020 10:57978719-57978741 AAATATCACATGATCTTATGTGG + Intergenic
1068888327 10:62120951-62120973 AATAATCACATGAGGGTATGTGG + Intergenic
1069559477 10:69419456-69419478 AACAATCACATGATTTCTTGGGG - Intergenic
1072814731 10:98494725-98494747 AATTATCAGTTTATGTTTTGGGG - Intronic
1073668068 10:105555889-105555911 CATGAACACATGATTTTTTATGG - Intergenic
1074235845 10:111583666-111583688 AATAATCACAGGATGTATTTGGG + Intergenic
1074647906 10:115485386-115485408 AATGTAAACATGATGTTTTGAGG + Intronic
1074854540 10:117463876-117463898 AATGATAGCAAGATGCTTTGAGG - Intergenic
1075930199 10:126288968-126288990 CATGGTCACATGATGGCTTGGGG + Intronic
1076382614 10:130035716-130035738 AGTGAACACATGATGTGTGGTGG - Intergenic
1076455763 10:130593649-130593671 CATGATCACATTATTTTTTATGG - Intergenic
1079608763 11:22404162-22404184 ATTTATAATATGATGTTTTGTGG - Intergenic
1081242198 11:40720736-40720758 AATGATAAAATGATTCTTTGGGG - Intronic
1082703887 11:56468562-56468584 AATAATCACCTTCTGTTTTGAGG - Intergenic
1082729806 11:56781870-56781892 AATGATCAAAGGAAGTTTTACGG - Intergenic
1083978003 11:66139677-66139699 AAGGATCACATTCTTTTTTGTGG + Intronic
1087121845 11:94583292-94583314 AATCATCACATTATGTTCAGAGG - Intronic
1088233138 11:107693680-107693702 AATTATAACATTATGTTTTCTGG + Intergenic
1092677107 12:10932259-10932281 CATGATCACATTATGTTTCAAGG - Exonic
1094292905 12:28872241-28872263 AAAGATACCATGATATTTTGGGG - Intergenic
1095760103 12:45822580-45822602 AATGATAGCATGGTGTTTTAGGG + Intronic
1097872657 12:64613979-64614001 AACGAACATATGACGTTTTGTGG + Intronic
1098695130 12:73542993-73543015 CATGATCTCATTCTGTTTTGTGG - Intergenic
1099735302 12:86561250-86561272 AACGATCACAGGGTCTTTTGTGG - Intronic
1100205913 12:92349452-92349474 AATAGTCACTTGATGTTTAGGGG + Intergenic
1100387591 12:94118329-94118351 AATGAGGACATGAGGTTTAGGGG + Intergenic
1101190663 12:102329117-102329139 AATAATCACAGGATGTGTTCAGG - Intergenic
1101199709 12:102421655-102421677 AATGGTAACTTGATGTTTGGGGG + Intronic
1101384719 12:104246463-104246485 AATGATGACTTGATAATTTGGGG - Intronic
1103639951 12:122342527-122342549 AAGGATCACAAAATGTCTTGTGG + Intronic
1104068318 12:125323919-125323941 AATGCTCACATGATTTTTCTGGG - Intronic
1104315452 12:127696176-127696198 AATGAACACAATCTGTTTTGGGG + Intergenic
1104622356 12:130326384-130326406 CATGAAAAAATGATGTTTTGAGG - Intergenic
1105822522 13:24092250-24092272 AATGATCATGTGATGTTTTCTGG + Intronic
1105982567 13:25533940-25533962 AATGGACACAAGATGTGTTGGGG + Intronic
1105995428 13:25666611-25666633 AATTATCATTTGATGTTGTGGGG + Intronic
1107918984 13:45183690-45183712 AATGATCTCATGAGGTGATGGGG - Intronic
1109317466 13:60767174-60767196 AATGATGGGATGATGTTTTCTGG + Intergenic
1109982662 13:69928999-69929021 TATGCTCAAATAATGTTTTGTGG + Intronic
1110794406 13:79620150-79620172 TAGGATCAACTGATGTTTTGGGG - Intergenic
1111475190 13:88736913-88736935 AAAAATCACATGATTTCTTGAGG - Intergenic
1113159100 13:107359075-107359097 AATGTTCAAAGCATGTTTTGAGG - Intronic
1115425796 14:33257655-33257677 AATGCACAGAAGATGTTTTGAGG - Intronic
1116046107 14:39744547-39744569 AGTGATAACATCATGTTTTGTGG + Intergenic
1118385626 14:65253386-65253408 AATAATCACAGGATGTCTTTGGG + Intergenic
1119582014 14:75793511-75793533 CATGATCTCAGGATGTTTTATGG + Intronic
1119658470 14:76434168-76434190 AATGAACACATGAGGTCCTGGGG + Intronic
1119900489 14:78255363-78255385 AATGACCACATGATGGTGTGAGG - Intronic
1120153881 14:81069509-81069531 AATAACCAAATGATGTTTTTGGG - Intronic
1120554367 14:85910869-85910891 CATGATCACATTATTTTTTATGG + Intergenic
1125063319 15:35451558-35451580 AATGATCACATTCTGCATTGTGG - Intronic
1125221929 15:37347957-37347979 ATTGATCAGATGCTGTTTTACGG + Intergenic
1125542688 15:40479427-40479449 CATAATCAGGTGATGTTTTGTGG - Intergenic
1126318421 15:47395970-47395992 AAGAATCAGATGATGTCTTGAGG + Intronic
1126424420 15:48511436-48511458 AAGGATCCCATAATTTTTTGAGG + Intronic
1128471131 15:67954447-67954469 TATCATCACATGAGTTTTTGTGG + Intergenic
1129179970 15:73867783-73867805 ATTGATTTCATGCTGTTTTGGGG + Intergenic
1130873231 15:87989321-87989343 AATGAACACATCATTTTTTATGG - Intronic
1133214086 16:4280367-4280389 AGCGATCAAATGATATTTTGTGG - Intergenic
1133603655 16:7364973-7364995 AATGATCAGATGATTCTTTTGGG + Intronic
1135550628 16:23395519-23395541 AATGCTCACATGATTCTGTGTGG + Intronic
1139980698 16:70856023-70856045 AATGATCAGATCTTGTTTGGGGG + Intronic
1139988218 16:70918041-70918063 GATGCTCACATGAGGTTTTCAGG + Intronic
1140946496 16:79772971-79772993 ACTGATTACATAATGTTTTATGG - Intergenic
1143773376 17:9182314-9182336 AACGATCACATGCTTTTATGAGG + Intronic
1151509626 17:74550270-74550292 AATGATCAGAAGAGGGTTTGTGG - Intergenic
1152132756 17:78486845-78486867 AAAGATCTCATGATGTCATGTGG + Intronic
1153159842 18:2191578-2191600 ACTGATTACATGATGTATTTTGG - Intergenic
1153253103 18:3142204-3142226 AATGAATGAATGATGTTTTGGGG - Intronic
1154498426 18:14979496-14979518 AGTGATCCCATGATGTGCTGGGG + Intergenic
1156138237 18:34071147-34071169 AATGATCAAATCATGTTTTTTGG - Intronic
1156566940 18:38202384-38202406 AAAAATCAAATGGTGTTTTGAGG - Intergenic
1156984603 18:43334557-43334579 AATTTTCTCTTGATGTTTTGGGG + Intergenic
1157177151 18:45462057-45462079 AATGATAACTTGATGTTTTCTGG - Intronic
1157426443 18:47588421-47588443 AATTCTCACCTGATATTTTGGGG - Intergenic
1158110150 18:53931767-53931789 AAGGACCACCTGATGTTATGAGG - Intergenic
1160241362 18:77125534-77125556 CATGACCACATGTTCTTTTGTGG + Intronic
1160348545 18:78154299-78154321 AATGATCCCATGACTCTTTGGGG + Intergenic
1166413355 19:42572454-42572476 GATGATCACATTATTTTTTATGG + Intergenic
1167572794 19:50300092-50300114 CAGGATAACATGATATTTTGGGG + Intronic
1167832275 19:52034593-52034615 TATGATGACATAGTGTTTTGTGG + Exonic
925108783 2:1315908-1315930 AATGCTCATAGGATGTTTTAAGG + Intronic
926070588 2:9885861-9885883 AAAGATAACATGATGATTTCAGG - Intronic
926104979 2:10144366-10144388 GATGTTCACATGATGTGGTGGGG + Intronic
926110140 2:10177300-10177322 GATCATCACATAAAGTTTTGAGG + Intronic
926603002 2:14866677-14866699 AATGGTCAAATGAGGTTATGTGG + Intergenic
928464364 2:31507786-31507808 AATGATAACATTATCTATTGGGG + Intergenic
929996758 2:46831673-46831695 AATGATTATAAGATTTTTTGGGG + Intronic
931229140 2:60359383-60359405 AATGACAACATTCTGTTTTGGGG - Intergenic
932162829 2:69478249-69478271 AATGATCATATGATGCTTGTTGG - Intronic
933249467 2:80012802-80012824 AATGATCACAGGATATTTCTTGG + Intronic
934489388 2:94749462-94749484 AATGGTCACATGAGATTTTTTGG - Intergenic
935621081 2:105130131-105130153 ACTGGTCACTTGCTGTTTTGTGG + Intergenic
935761084 2:106321411-106321433 AATGATTACAGGGTGTTTGGGGG - Intergenic
936646429 2:114377542-114377564 AATGACCACAGGATGGTTTCAGG + Intergenic
938187150 2:129241533-129241555 AATTAGCACTTTATGTTTTGAGG - Intergenic
939464759 2:142543212-142543234 AGTGTTCAGATTATGTTTTGGGG - Intergenic
939657323 2:144843998-144844020 AATGATACCATGATGTTTGTGGG + Intergenic
939829262 2:147053225-147053247 AATGACCAGATGATGTTTATTGG - Intergenic
940083256 2:149828731-149828753 AATCATCAAATGATGTCCTGTGG + Intergenic
940857857 2:158743684-158743706 AATGATCATTTGGTGTTTTGTGG + Intergenic
941404526 2:165071868-165071890 AATAATCACAGGATTTCTTGAGG - Intergenic
941877896 2:170453652-170453674 AATGATCACTTTCTGTTTTATGG + Intronic
942778309 2:179611836-179611858 AATGATCCCTTGAGTTTTTGTGG + Intronic
946133162 2:217623167-217623189 AATGATCACATTATGTCCTCTGG - Intronic
946471880 2:219968234-219968256 AATGCTGACATGAATTTTTGAGG + Intergenic
948041911 2:234908854-234908876 CATGATCACCTTTTGTTTTGAGG + Intergenic
948160877 2:235823022-235823044 AAAGAACACATGTTGGTTTGTGG - Intronic
949063847 2:241977227-241977249 TATGATCATATGATGTTATTTGG + Intergenic
1169488073 20:6050192-6050214 ATTGAGCACACGATGTTGTGAGG - Intronic
1170045068 20:12076293-12076315 AATGTTCAAATGAAGTTCTGTGG + Intergenic
1173050550 20:39555929-39555951 AATGATCTCATACTTTTTTGGGG + Intergenic
1173765127 20:45600242-45600264 AATGATAACATGATAATTTCAGG - Intergenic
1174189667 20:48731330-48731352 AAGGGTGACAGGATGTTTTGAGG - Intronic
1177522869 21:22252618-22252640 AATAATGACATAATGTTTTAAGG - Intergenic
1178475978 21:32937443-32937465 AACAATTACGTGATGTTTTGAGG - Intergenic
1180017960 21:45099761-45099783 AGTGTTCACATGCTGTTCTGAGG + Intronic
1181449824 22:23012269-23012291 AATGCTGACATTATGCTTTGGGG + Intergenic
1181557824 22:23681877-23681899 AATGAGCACAGGATGCTGTGAGG + Intergenic
1181674004 22:24440255-24440277 AATTAACGCATGATTTTTTGAGG - Intronic
949142987 3:657845-657867 AAAGGTCACATGGTGTTTTCAGG - Intergenic
949148815 3:739270-739292 AATTATCAGTTTATGTTTTGGGG - Intergenic
949578752 3:5365082-5365104 CATGATCACAAGTTGGTTTGAGG - Intergenic
949643937 3:6071511-6071533 AAAAATCTCATGATGTTTTACGG + Intergenic
952119994 3:30231187-30231209 AATGATAATATGGGGTTTTGGGG + Intergenic
952426249 3:33177489-33177511 AATGGTAACATGGTGTTTTTTGG + Intronic
952699746 3:36313714-36313736 AATGCTCACATGATTTTCTAAGG - Intergenic
953836064 3:46345207-46345229 AATACTAACATGTTGTTTTGGGG + Intergenic
954017473 3:47706807-47706829 ACTGTTCACATTCTGTTTTGAGG + Intronic
954419519 3:50411240-50411262 AATGATCACAGGCTGGTGTGAGG - Intronic
955528456 3:59846445-59846467 AATTATTAGTTGATGTTTTGAGG - Intronic
955615220 3:60800406-60800428 AATGATATCAATATGTTTTGGGG - Intronic
956482819 3:69689768-69689790 AATTCTCACATGAGGTTTGGAGG + Intergenic
956645727 3:71453937-71453959 AATGAACACATCAAGTTTTAAGG + Intronic
957375285 3:79348462-79348484 AATGTTCACAGTATTTTTTGAGG + Intronic
957400325 3:79703912-79703934 AATGAATAGATGGTGTTTTGTGG + Intronic
957481458 3:80802548-80802570 AATGATCAAATGAGGGTATGTGG - Intergenic
957531004 3:81440851-81440873 AATGATGACATGATGTGATTTGG + Intergenic
957569948 3:81933845-81933867 AATAATCACATACTGTTTTAGGG + Intergenic
957849546 3:85789630-85789652 AATGAACACATGATTTTTCAAGG - Intronic
958421365 3:93935351-93935373 CAAAATCAAATGATGTTTTGGGG - Intronic
958947200 3:100376776-100376798 CATGATCACATGACTTTTAGTGG - Intronic
959624084 3:108430356-108430378 CATTATCAAATAATGTTTTGAGG + Intronic
960393220 3:117104802-117104824 GATGATCAGATGGTTTTTTGGGG - Intronic
960872638 3:122265148-122265170 AATGATCAGAAAATGTGTTGTGG - Intronic
963010977 3:140770090-140770112 AATGAACACGTCATGGTTTGAGG + Intergenic
963452406 3:145500138-145500160 AATGATTCCAAAATGTTTTGGGG - Intergenic
965657194 3:171000001-171000023 AATTATGACAGGAAGTTTTGTGG - Intronic
965759803 3:172063665-172063687 AATGATCACATGATGTTTTGAGG + Intronic
967237262 3:187397704-187397726 ATTGATCACAAGTTGTTATGAGG - Intergenic
970017497 4:11529128-11529150 TCTGATCACATGATGTTTATTGG + Intergenic
970512468 4:16794883-16794905 AATGAACACATGATTGTATGTGG - Intronic
971460952 4:26895909-26895931 AACAAGCATATGATGTTTTGAGG - Intronic
975420868 4:74163186-74163208 GATGTGCAGATGATGTTTTGTGG - Intronic
975929910 4:79507585-79507607 ACTGATCATATTATGTCTTGGGG - Intergenic
975970737 4:80033218-80033240 ATTGAACAGATGATGGTTTGTGG - Intronic
976469257 4:85408255-85408277 AATTAAAACATGATGTTTAGAGG - Intergenic
976685459 4:87809518-87809540 AACAAACACATGGTGTTTTGGGG + Intronic
977626430 4:99193855-99193877 AATGACCACAGGATGTGTTCAGG + Intergenic
978212040 4:106148486-106148508 AATGATAACATAATATATTGGGG - Intronic
978227768 4:106358707-106358729 AATGATAATATGCAGTTTTGAGG - Intergenic
978656442 4:111070629-111070651 AATGCTGACATGCTGTTTTGGGG + Intergenic
979407689 4:120333460-120333482 AATTATAACATGGTGTTTGGGGG + Intergenic
979658893 4:123229468-123229490 AATGATGAAATGATTTTTTAAGG - Intronic
979754002 4:124317062-124317084 AATGATCAAATAATTTTTTTTGG - Intergenic
979937022 4:126710589-126710611 AATCATCACTTTATGTTTTTTGG - Intergenic
980624497 4:135356777-135356799 AATGATAACATTAAGTTTTCAGG + Intergenic
980862240 4:138513464-138513486 AGAAAGCACATGATGTTTTGGGG + Intergenic
981511117 4:145559867-145559889 AATTATATCATGATGTTTTTTGG - Intergenic
982570245 4:157040731-157040753 AATAATCACATTATTTTATGAGG + Intergenic
983097259 4:163577984-163578006 AATCATAAGATGATGCTTTGGGG + Intronic
983317896 4:166155413-166155435 AATGATGACATGACTATTTGTGG + Intergenic
983679442 4:170335227-170335249 AATGATCATATGATTTTTATTGG + Intergenic
984087681 4:175332560-175332582 AATGACCACAGGTTCTTTTGGGG - Intergenic
984824012 4:183907510-183907532 AATGCTCACATGATTCTGTGTGG + Intronic
985999300 5:3617714-3617736 AATGATCTCATGATGAACTGAGG - Intergenic
989618410 5:43360267-43360289 TTTTATCACATGATTTTTTGGGG + Intergenic
990112237 5:52341218-52341240 AATGATCATCTGAGGCTTTGAGG - Intergenic
990703565 5:58501458-58501480 ACTGATACCATGATATTTTGAGG - Intergenic
991002638 5:61797976-61797998 AATGACCTCATGATATTTAGTGG - Intergenic
993827078 5:92703308-92703330 TTTGATCACATAATGTTTTGTGG - Intergenic
995224326 5:109687199-109687221 AATGGCCACATGTCGTTTTGGGG + Intergenic
995239725 5:109872317-109872339 AATGAGCACATGAACTCTTGGGG - Intergenic
996512957 5:124338000-124338022 AATTTTAACATGATGTTTTGAGG + Intergenic
997044707 5:130300316-130300338 GATGATCACAAGTTCTTTTGAGG - Intergenic
999498014 5:152119249-152119271 AATGAGCAGCTGTTGTTTTGTGG + Intergenic
999893204 5:156000978-156001000 AATTCTCACATGAACTTTTGGGG + Intronic
1000821686 5:165992499-165992521 AATACTCACAGGCTGTTTTGAGG + Intergenic
1003783769 6:9459909-9459931 AAGGATCTCATGGTGTTCTGAGG - Intergenic
1004804042 6:19182414-19182436 AATTATCATATTATGGTTTGGGG + Intergenic
1006729047 6:36221973-36221995 AAAGTTCCCATGAGGTTTTGAGG - Intronic
1007741828 6:44015452-44015474 ATTGACCATATGTTGTTTTGTGG - Intergenic
1010016753 6:71113504-71113526 CATGAACAGATGATGTTTGGAGG - Intergenic
1011050601 6:83144569-83144591 AATGTTCACATGATTATTTTTGG - Intronic
1011095327 6:83655629-83655651 GATGATCACTTGATGTTCTTTGG - Intronic
1011829897 6:91358971-91358993 AATAATCAAAGGATGATTTGAGG + Intergenic
1011980235 6:93365686-93365708 AATGAGTACATTATGGTTTGTGG + Intronic
1012743994 6:103059417-103059439 TATGATCTCATGCTGTTTTATGG - Intergenic
1012789301 6:103673448-103673470 GATGATTACAGGATGTTTTGGGG - Intergenic
1013158707 6:107520795-107520817 AATGATCCCAGTATGTTCTGGGG + Intronic
1013827304 6:114229781-114229803 AATGACGACATGATGCTTTCGGG + Intronic
1014029645 6:116685610-116685632 CATGATCACATTCTTTTTTGTGG + Intronic
1014594893 6:123323025-123323047 AGTGTTCACATAATGTTCTGTGG - Intronic
1014730084 6:125022260-125022282 AATAATCTCTTCATGTTTTGAGG - Intronic
1014895536 6:126895386-126895408 AATGATCACAGGATGGGTTCAGG - Intergenic
1016085397 6:139907465-139907487 AATTTCAACATGATGTTTTGGGG - Intergenic
1016321428 6:142850357-142850379 AATGATGATATAATGATTTGGGG + Intronic
1016529205 6:145039416-145039438 AATGATATCACGATGATTTGTGG + Intergenic
1019784042 7:2962230-2962252 AATTATCAGGTTATGTTTTGGGG - Intronic
1024846264 7:53646221-53646243 GATGATCATATGAAGTTTTATGG - Intergenic
1024997181 7:55280593-55280615 AGTGATCATATGACATTTTGAGG - Intergenic
1025482303 7:60995885-60995907 AATGATGAAATGATGAATTGAGG + Intergenic
1027298378 7:76802567-76802589 AATGATAACAATGTGTTTTGAGG - Intergenic
1027843148 7:83339711-83339733 AATGATCACATGGGGCTTTGAGG - Intergenic
1028142722 7:87290193-87290215 AAGGATCACCTGTTTTTTTGGGG - Intergenic
1029152526 7:98491078-98491100 AATGATAACACTATATTTTGGGG - Intergenic
1030291190 7:107873823-107873845 AATGTAAACATGATGTTTGGTGG - Intergenic
1031027720 7:116698508-116698530 TATGATCACATGCTGTTTATAGG - Intronic
1031760516 7:125707729-125707751 AATGACCACAGGATGTGTTCAGG - Intergenic
1033133562 7:138766180-138766202 AATAATAACATGATATTTTAAGG - Intronic
1033825828 7:145187600-145187622 AATGCTAGCATGATGTTTTCTGG + Intergenic
1035449403 7:158966126-158966148 AATGCTCACAAAGTGTTTTGAGG - Intergenic
1036611192 8:10351196-10351218 ATTCATTACATGATGTTTTTGGG - Intronic
1036693895 8:10962229-10962251 TATGATAATATTATGTTTTGGGG - Intronic
1038498127 8:28021019-28021041 AATGATAAGATGAGCTTTTGGGG + Intergenic
1042798491 8:72690658-72690680 AATGGTCACATAAATTTTTGTGG - Intronic
1043190051 8:77208931-77208953 AATTATCACTCAATGTTTTGTGG + Intergenic
1044219632 8:89654433-89654455 AAAGCTAACATCATGTTTTGTGG + Intergenic
1044415968 8:91940140-91940162 AATCATTACATGGTGTTTTGAGG - Intergenic
1045868596 8:106899159-106899181 AATGATGAGATAATGTGTTGTGG - Intergenic
1046157516 8:110312493-110312515 AATGTCAACATGAGGTTTTGAGG - Intergenic
1046198845 8:110894994-110895016 AATTATAACATGATACTTTGTGG - Intergenic
1046676352 8:117112837-117112859 TGTGATCACATGCAGTTTTGCGG + Intronic
1046904076 8:119553644-119553666 AATGGGCACAGGAAGTTTTGGGG + Intergenic
1047453483 8:124988202-124988224 AGTGACCACAGGATGGTTTGGGG - Intergenic
1047704686 8:127485913-127485935 TATGACCACATAATGTTTTATGG + Intergenic
1048578915 8:135714921-135714943 AATTTTAACATGAGGTTTTGGGG + Intergenic
1050487905 9:6154137-6154159 AATTATTACTTTATGTTTTGGGG + Intergenic
1053226575 9:36363478-36363500 AATGAAAACATGACATTTTGAGG - Intronic
1055523723 9:77108955-77108977 AATTTTAACATGAGGTTTTGGGG - Intergenic
1058024266 9:100123650-100123672 AATGGTTACTTAATGTTTTGAGG + Intronic
1058142589 9:101373281-101373303 CATGATCACATTATTTTTTATGG - Intronic
1060132177 9:121113649-121113671 AATGATCACATGAACTTGAGAGG + Exonic
1060619561 9:125051579-125051601 AATGATCACATTATGGATTTGGG - Intronic
1186135999 X:6521512-6521534 AATCATTACATGTTGTTTAGTGG - Intergenic
1186834381 X:13422836-13422858 TGTGCTCACTTGATGTTTTGGGG - Intergenic
1186840669 X:13481892-13481914 AATGATCACATGAGGATAGGTGG - Intergenic
1187189759 X:17022931-17022953 AATGGTCAGATGATGATTGGTGG + Intronic
1187268844 X:17761687-17761709 AATGATCACCAGATGTACTGAGG - Intergenic
1187287008 X:17915351-17915373 AATGCCCACTTAATGTTTTGTGG - Intergenic
1187326548 X:18295500-18295522 CATGAACACATGCTGCTTTGGGG + Intronic
1188531779 X:31149252-31149274 TATGGACACTTGATGTTTTGCGG - Intronic
1189576459 X:42359009-42359031 AATGATGCCATGATCTTTTCTGG + Intergenic
1189671492 X:43414980-43415002 TATGTTCAAATGATGTTATGAGG + Intergenic
1190361868 X:49657090-49657112 AATTATCACAATATCTTTTGAGG + Intergenic
1191831280 X:65419107-65419129 AATAATCACAGGATGGTTTTGGG - Intronic
1193386207 X:80874341-80874363 ATAGAGAACATGATGTTTTGGGG + Intergenic
1194927908 X:99848845-99848867 AAAGTTCTCATGATATTTTGGGG - Intergenic
1195779773 X:108449231-108449253 AATAAACTCATGATGTTTTGGGG + Intronic
1196294588 X:113983430-113983452 AATGATCACAGGATGCTTCAAGG - Intergenic
1196387931 X:115178487-115178509 ACTGAAAACATGATGGTTTGTGG - Intronic
1198649143 X:138841786-138841808 AATTTTCACATAATATTTTGGGG - Intronic
1199022475 X:142898090-142898112 GATTATGAAATGATGTTTTGGGG - Intergenic
1199048635 X:143208166-143208188 AATGATTCCATGAAGTTCTGTGG - Intergenic