ID: 965761248

View in Genome Browser
Species Human (GRCh38)
Location 3:172079342-172079364
Sequence CTTTCTCCAAAGATGGAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 303}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965761241_965761248 11 Left 965761241 3:172079308-172079330 CCTCATGCTTGTTAAATCCAGAA 0: 1
1: 0
2: 1
3: 18
4: 178
Right 965761248 3:172079342-172079364 CTTTCTCCAAAGATGGAGTTTGG 0: 1
1: 0
2: 2
3: 32
4: 303
965761244_965761248 -6 Left 965761244 3:172079325-172079347 CCAGAATGGGTCTCTCCCTTTCT 0: 1
1: 0
2: 0
3: 24
4: 258
Right 965761248 3:172079342-172079364 CTTTCTCCAAAGATGGAGTTTGG 0: 1
1: 0
2: 2
3: 32
4: 303
965761240_965761248 21 Left 965761240 3:172079298-172079320 CCTGCGTGGTCCTCATGCTTGTT 0: 1
1: 0
2: 0
3: 8
4: 128
Right 965761248 3:172079342-172079364 CTTTCTCCAAAGATGGAGTTTGG 0: 1
1: 0
2: 2
3: 32
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965761248 Original CRISPR CTTTCTCCAAAGATGGAGTT TGG Intronic
901516792 1:9753081-9753103 ATTTCTCCACAGATGGGGGTGGG + Intronic
902047166 1:13533914-13533936 CTGTCGCCAAACATGGACTTGGG + Intergenic
902283546 1:15391584-15391606 CTTTCTGCAAAGCAGGAGTGTGG - Intronic
903202898 1:21757147-21757169 CTTTTTCCAAAGATAAGGTTGGG + Intronic
903568327 1:24285462-24285484 CTCTCTCTCAAGATGGAGGTCGG - Intergenic
905649710 1:39647997-39648019 CCTTCATCAAAGAGGGAGTTTGG - Intergenic
908382647 1:63611396-63611418 CTTCCTGCAATGCTGGAGTTAGG - Intronic
909075190 1:71044606-71044628 CTTTCTTGAAAGAGTGAGTTTGG + Intronic
910293237 1:85618668-85618690 CTATCTCCAAAAATGAAGTTGGG + Intergenic
911374676 1:97037438-97037460 CTTTTTCAAAAGATGGTTTTGGG - Intergenic
913226840 1:116708063-116708085 CTTTCTCAAAAGACAGAGCTAGG + Intergenic
913321771 1:117593715-117593737 ATTTCTCCAATGATGGACGTGGG + Intergenic
913956734 1:143306145-143306167 CTTTCTCCCAGGCTGGAGTATGG + Intergenic
913980709 1:143509510-143509532 CTTTCTCCCAGGCTGGAGTATGG - Intergenic
914075071 1:144335947-144335969 CTTTCTCCCAGGCTGGAGTATGG - Intergenic
914104107 1:144630548-144630570 CTTTCTCCCAGGCTGGAGTATGG + Intergenic
915407819 1:155674787-155674809 CTTTCACCCAGGATGGAGTGCGG - Intronic
916785336 1:168083025-168083047 GTATTTCCAAATATGGAGTTAGG - Exonic
917134319 1:171774489-171774511 ATTTATCCATAGAGGGAGTTTGG - Intergenic
921151863 1:212409139-212409161 ATTTTTCCACAGATGGAGGTTGG - Intronic
922226153 1:223647560-223647582 CTTTTTCCAAAGAGGGTTTTAGG - Intronic
923394593 1:233548942-233548964 CTTTCTCCCAAGATTAATTTGGG - Intergenic
1063999243 10:11649622-11649644 CTCAGTCCAGAGATGGAGTTGGG - Intergenic
1064646382 10:17464350-17464372 TTTTTTCCACAGATGGAGTGGGG - Intergenic
1067261458 10:44696656-44696678 CTGTCTCCAAAAATGTAGTTAGG - Intergenic
1068951196 10:62779249-62779271 CCTTTTCCAAAGTTAGAGTTGGG + Intergenic
1070499109 10:77053768-77053790 CTTTCTTAAGAGATGGAGGTAGG - Intronic
1071082648 10:81830974-81830996 CTTGCTCCTAAGATGGTGGTGGG + Intergenic
1072600000 10:96916649-96916671 CTGTCTCCCAAGCTGGAGTACGG + Intronic
1073002222 10:100294278-100294300 CATTCTCCAAGGATGGAAATGGG - Intronic
1073107213 10:101039089-101039111 CTATCTCCAAGGATGGGGTGGGG + Intronic
1073682498 10:105719421-105719443 ATTTTTCCACAGATGGAGGTGGG + Intergenic
1074072760 10:110089445-110089467 CTTTCTCTAAGGAAGGGGTTGGG + Intronic
1076771622 10:132669214-132669236 CTGTCTCCAAGGCTGGAGTGCGG - Intronic
1077869207 11:6247478-6247500 ATTTCACTAACGATGGAGTTAGG + Intergenic
1080165230 11:29227718-29227740 CTTTCTCGTAAGATGGAGAAAGG - Intergenic
1080214486 11:29825770-29825792 CTTTCTCCAAAGTAGGTGTGTGG - Intergenic
1080754246 11:35180317-35180339 TTTGCTGCACAGATGGAGTTGGG - Exonic
1081196745 11:40170414-40170436 CTTTCACCAAAGATGTAATTTGG - Intronic
1081212936 11:40358275-40358297 CTGTCTCAAAAAAAGGAGTTTGG - Intronic
1083512213 11:63220446-63220468 ATTTTTCCAAAGACAGAGTTTGG - Intronic
1088194346 11:107258587-107258609 CTTTGTTCAAAGAAGGAGTTGGG - Intergenic
1088346533 11:108833335-108833357 CTTTTTCCATAGATAGAGTTGGG + Intronic
1088781416 11:113137579-113137601 CTTTCTTCAAAGACTGATTTTGG + Intronic
1088900124 11:114109476-114109498 AGTTCTCCAAGGCTGGAGTTGGG + Intronic
1092546668 12:9458019-9458041 CTTTTTCCAAAGAGGGTCTTGGG + Intergenic
1092845329 12:12579608-12579630 CTTCCTCCAAAGATGCTGTTTGG - Intergenic
1093168766 12:15835732-15835754 GTTTTTCCATGGATGGAGTTGGG - Intronic
1093816426 12:23554221-23554243 CTTTCTCCAGTGATGGGGTTTGG + Intronic
1094506269 12:31064053-31064075 CTTTTTCCAAAGAGGGTCTTGGG - Intergenic
1094752597 12:33429299-33429321 TTCTCTCCAAAGGAGGAGTTAGG + Intronic
1095391148 12:41708062-41708084 CTGTCTCCCAAGCTGGAGTGCGG + Intergenic
1096187672 12:49592747-49592769 CTCTCTCCTAAGCTGGAGTGTGG - Intronic
1098045054 12:66391936-66391958 CTTTCCACAAAGATGGATTGGGG - Intronic
1098345581 12:69499534-69499556 CTTTCTCCAAAATTGGAGGGTGG - Intronic
1098970348 12:76848257-76848279 CTTACACCAAGGATGGATTTTGG + Exonic
1102927039 12:116834153-116834175 CTGTCTCCCAGGCTGGAGTTCGG + Intronic
1103602879 12:122065244-122065266 CTCTCTCCACAGGTGGGGTTGGG + Intergenic
1104257024 12:127147750-127147772 CTTTTTCCAAAGAGGGTTTTGGG + Intergenic
1104874243 12:132022029-132022051 CTTTCTGGAAAGATGCAGATGGG + Intronic
1105570576 13:21599119-21599141 GTTTCTCCACTGATGGAGGTGGG - Intronic
1108933216 13:55857839-55857861 CTATCTTCAAAGAAGGATTTGGG + Intergenic
1111740366 13:92197532-92197554 TTTTCTCCCAGGATGGAGTGTGG + Intronic
1111941985 13:94619467-94619489 GTTACTCCAAAGATGGAATAGGG + Exonic
1112581392 13:100679183-100679205 ATTTTTCCATGGATGGAGTTGGG - Intergenic
1112837449 13:103533424-103533446 CTCTCTCCAAGGCTGGGGTTAGG + Intergenic
1113261249 13:108566066-108566088 CTTTCTCAAAAGATAGAGGAGGG - Intergenic
1114793913 14:25690402-25690424 CTGTGTCAAAAGATGGTGTTAGG + Intergenic
1116587647 14:46729506-46729528 CCTTCTCCAAATACTGAGTTTGG + Intergenic
1117756281 14:58977708-58977730 CCTTCCCTGAAGATGGAGTTGGG + Intergenic
1118703064 14:68453560-68453582 CTTTCTCCAAAGATAAATTATGG - Intronic
1120775670 14:88434647-88434669 CTGTCGCCCAAGATGGAGTGCGG - Intronic
1120806277 14:88754387-88754409 ATTTGTCCAAAGGTGGAGGTGGG - Intronic
1121734067 14:96205748-96205770 CTTTATGCAAAGATAGAGGTAGG + Intronic
1202939140 14_KI270725v1_random:127821-127843 CTTTCTCCCAGGCTGGAGTGCGG + Intergenic
1123394004 15:19908455-19908477 CTTTCTCCCAGGCTGGAGTGTGG - Intergenic
1124876398 15:33599016-33599038 CTGTCTCCCAGGCTGGAGTTCGG - Intronic
1125416869 15:39462974-39462996 CTTTCTAAAAATATGAAGTTAGG + Intergenic
1125889219 15:43253284-43253306 CTTTCTCAAAACATGCAATTTGG + Intronic
1125973104 15:43928283-43928305 CTTTCTCCAAGGCTGGGGTGGGG + Intronic
1126140895 15:45437761-45437783 CTTTCTTAAAACATTGAGTTTGG - Intronic
1127018450 15:54716541-54716563 AGTTCTCCAAAAATGGATTTGGG - Intergenic
1127897522 15:63315515-63315537 CTTTTTCCAAAGAGGGTTTTAGG + Intergenic
1129025702 15:72571732-72571754 CTTTCTCAAAAAGTTGAGTTAGG + Intronic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1129639854 15:77364160-77364182 CTTTCGCCCAAGCTGGAGTGCGG - Intronic
1130726519 15:86444818-86444840 CTTTTTCCCAAGATGGAATGTGG - Intronic
1131360795 15:91788910-91788932 ATTTCTCCAAAGATGGAGTGAGG + Intergenic
1132909636 16:2302520-2302542 TTTTCACCAAAGTTGGAGTGTGG + Intronic
1133609041 16:7415992-7416014 ATCTCTGCAAAGATGAAGTTCGG - Intronic
1134598674 16:15516086-15516108 CTGTCACCCAAGATGGAGTGTGG - Intronic
1134662601 16:15995702-15995724 CTTTCACCTAGGCTGGAGTTCGG + Intronic
1135088796 16:19495800-19495822 CTGTCTCCCAAGCTGGAGTGCGG - Intronic
1135135010 16:19880969-19880991 CCTTCTCTAAAGATGGCGGTAGG + Intronic
1136700015 16:32126340-32126362 CTTTCTCCCAGGCTGGAGTGCGG - Intergenic
1136767636 16:32801116-32801138 CTTTCTCCCAGGCTGGAGTGCGG + Intergenic
1136800514 16:33069581-33069603 CTTTCTCCCAGGCTGGAGTGCGG - Intergenic
1136958403 16:34813289-34813311 CTTTCTCCCAGGCTGGAGTGCGG - Intergenic
1137266118 16:46870372-46870394 CTGTCACCCAAGCTGGAGTTCGG - Intergenic
1137501080 16:49012252-49012274 CTGTCTCCATTGATAGAGTTTGG - Intergenic
1137692284 16:50437318-50437340 CTGTCACCAAGGATGGAGTGCGG - Intergenic
1137815118 16:51391645-51391667 GTTTCTCCTAGGATAGAGTTAGG - Intergenic
1138122199 16:54409764-54409786 CTTCCTCCATGGATGGGGTTAGG - Intergenic
1138230628 16:55333146-55333168 CTTTAGCCATAGAAGGAGTTTGG - Intergenic
1139372521 16:66477770-66477792 CTCTTTCCCATGATGGAGTTGGG - Intronic
1142326624 16:89419758-89419780 CGTTTTGCAAAGATGGAGTGAGG + Intronic
1203070029 16_KI270728v1_random:1063149-1063171 CTTTCTCCCAGGCTGGAGTGCGG + Intergenic
1144267977 17:13589760-13589782 TTTTTTCAAAACATGGAGTTAGG + Intronic
1144994032 17:19254502-19254524 CTGTCCCCCAAGATGGAGTGCGG - Intronic
1148318344 17:46724667-46724689 CTTTCACAAAAGTTAGAGTTGGG - Intronic
1148672773 17:49424336-49424358 CTTCCTCCAAAGATAGTGATTGG - Intronic
1148792424 17:50180871-50180893 CTTTCTCCAATGACAGAGCTGGG - Intergenic
1148861466 17:50606549-50606571 GTTTCTGCAAATATGGAGTGAGG - Intronic
1148998424 17:51732711-51732733 CATTCTCCAAAGAAGAAATTTGG - Intronic
1149412950 17:56427762-56427784 CTTTCTCCCCATATGGATTTGGG + Intronic
1151598594 17:75092988-75093010 CTTTCTCCAAAGCTGCTGGTTGG + Intronic
1151615338 17:75206481-75206503 CTTTTTCCAAAGATGGTTTTGGG + Intronic
1151652552 17:75479051-75479073 CTTTCCCAAAGCATGGAGTTAGG - Intronic
1152171845 17:78755872-78755894 CTTTCTCCCAGGCTGGAGTGTGG - Intronic
1152753256 17:82076201-82076223 CTGTCTCCCAGGCTGGAGTTCGG - Intergenic
1153469823 18:5431363-5431385 CTTCTTCAAATGATGGAGTTTGG + Intronic
1154404166 18:14073035-14073057 TTTCCTCCAAATATGGATTTAGG - Intronic
1154517129 18:15183920-15183942 CTTTCTCCCAGGCTGGAGTGCGG + Intergenic
1155642561 18:28037004-28037026 CTTTCTCTAAAGAAGGAACTTGG + Intronic
1156103441 18:33626916-33626938 CTTCCTCCAATGAAGGATTTGGG + Intronic
1156366050 18:36428392-36428414 CTTCCTCCAAAGATGGAGGAAGG - Intronic
1156752405 18:40474930-40474952 TTTTCTCGAGAGATGGAGTTAGG - Intergenic
1159310763 18:66705642-66705664 TTTTCTTCAAAGATAAAGTTAGG - Intergenic
1159955643 18:74516647-74516669 CTTGGTCCAAAGTTGGTGTTTGG - Intronic
1160098597 18:75899704-75899726 ACTTCTACAATGATGGAGTTTGG + Intergenic
1160105767 18:75974494-75974516 CTTTCTTCACAAATGGTGTTTGG - Intergenic
1160369851 18:78363035-78363057 CTTTGCTAAAAGATGGAGTTGGG - Intergenic
1160614100 18:80110522-80110544 CTTTATCAAAAGAGGGGGTTTGG + Intronic
1161126228 19:2559524-2559546 TTTTCTCTCAAGATGGAGTTTGG + Intronic
1164788969 19:30959817-30959839 CTTTCTCCTAAGCTCGAGCTGGG - Intergenic
1167055625 19:47110305-47110327 CTTTCTTCAAAGATGAAGGCTGG + Intronic
1168032703 19:53693672-53693694 CTGTCACCCAAGATGGAGTGTGG + Intergenic
1168392106 19:56017848-56017870 CTGTCTCCCAGGATGGAGTGCGG + Intronic
1168607556 19:57771834-57771856 TTTTTTCCCAAGATGGAGTCTGG + Intronic
930057804 2:47265334-47265356 CTTTCAACAAAGACGGCGTTCGG - Intergenic
931313402 2:61103977-61103999 CTTTTTCAAAAGATACAGTTAGG + Exonic
931856501 2:66307456-66307478 CTTTATCCAAAGCTGGAGAAAGG + Intergenic
932155286 2:69411627-69411649 CTATCACCCAAGATGGAGTGTGG + Intronic
932711152 2:74064434-74064456 CTGTCTCCCAGGCTGGAGTTCGG + Intronic
933249375 2:80011759-80011781 CTTTCAACAAATATGGATTTAGG + Intronic
935448532 2:103182986-103183008 ATATCTCCAAAGCTGGAATTGGG + Intergenic
935712999 2:105915930-105915952 CTTTTTCCAAAGATGATTTTGGG + Intergenic
935920588 2:108009110-108009132 CTTCCTGCAAAGGTGGACTTTGG - Intronic
936122487 2:109758885-109758907 CTTTTTCCAAAGAGGGTTTTGGG + Intergenic
936222206 2:110612587-110612609 CTTTTTCCAAAGAGGGTTTTGGG - Intergenic
938128648 2:128692428-128692450 CTCTTTAAAAAGATGGAGTTAGG + Intergenic
938170346 2:129070219-129070241 CTCTAGCCAAAGATGGAGTGAGG + Intergenic
939259102 2:139783947-139783969 TTTTATCCTTAGATGGAGTTGGG + Intergenic
940439128 2:153693588-153693610 CTTTTTCCAAAGAAGGTTTTGGG + Intergenic
941495788 2:166200670-166200692 CTGTCGCCAAAGCTGGAGTGCGG + Intronic
942408240 2:175678558-175678580 CTTTTTCCAAGGAAGGTGTTGGG - Intergenic
944097585 2:195986141-195986163 TTTCCTCCCAAGATGGAGTTTGG - Intronic
944683043 2:202094329-202094351 ATTTCCCCAAAGATGGGGGTTGG - Intronic
947898426 2:233697601-233697623 CCTTCTACAAAGTTTGAGTTTGG + Intronic
948342303 2:237263729-237263751 CTTTCTCCAACAAGGGACTTGGG - Intergenic
948672912 2:239579918-239579940 CTTTCTCCACTGATAGGGTTTGG - Intronic
1169414248 20:5402479-5402501 CAATCTCCAAAGGTGGAGCTGGG - Intergenic
1169805038 20:9550470-9550492 CTTATTCCCAAGATGGAGTGTGG - Intronic
1170300427 20:14877978-14878000 CTGGCTCCATAGAAGGAGTTAGG + Intronic
1170357651 20:15509681-15509703 CTCACTCCAAAGAGGAAGTTTGG + Intronic
1172480936 20:35271027-35271049 CTTTTTTTTAAGATGGAGTTTGG - Intronic
1174213267 20:48896772-48896794 CTGTCTCCCAAGCTGGAGTGTGG - Intergenic
1174550149 20:51356296-51356318 CTTACTCCACAGCTGGTGTTGGG + Intergenic
1174670546 20:52303655-52303677 CTCTCTCCAAAAATGGACTGGGG - Intergenic
1176065073 20:63190245-63190267 CCTTCTCCAAAGATGGTGGCAGG - Intergenic
1176230923 20:64032537-64032559 CCTTCTCCAAACAAGGAGTTAGG - Intronic
1176979917 21:15369768-15369790 CTTTCTCCAAAGATAGTGTCAGG - Intergenic
1178073131 21:28991252-28991274 CTGTCTCCAAACCTGGAGTGTGG - Intronic
1178415932 21:32405116-32405138 ATTTTTCCAAAGATGGGGGTTGG + Intergenic
1179996072 21:44975010-44975032 GTTTCATCAAAGATGGAGTTTGG + Intronic
1180266865 22:10536294-10536316 CTTTCTCCCAGGCTGGAGTGCGG - Intergenic
1181751746 22:24993705-24993727 CTATCACCAAACATGGAGTATGG + Intronic
1184142728 22:42587685-42587707 CTGGCTCCACAGATGGAGATGGG + Intronic
950673222 3:14539613-14539635 ATTCCTCCAAAGAGGGAGCTTGG - Intronic
951553621 3:23899024-23899046 ATTTTTCCACAGATGGAGATGGG - Intronic
952976319 3:38699288-38699310 CTTTGTTCATAGTTGGAGTTGGG - Intronic
953369011 3:42371547-42371569 CCTTGTCCAAAGATGAAGTTGGG + Intergenic
955157504 3:56431240-56431262 GTTTTTCCAAAAATGGAGCTAGG - Intronic
955485015 3:59426427-59426449 CTGTCTTCAAAGATGGAGAAAGG - Intergenic
956335819 3:68162270-68162292 ATTTTTCCACAGATGGGGTTGGG + Intronic
956827451 3:73011442-73011464 CTTTCGCCCAAGCTGGAGTGTGG - Intronic
957148101 3:76449894-76449916 CTTGCTGCAAATATAGAGTTGGG + Intronic
957724208 3:84044035-84044057 ATTTATCCATAGATGGAGGTTGG + Intergenic
958417993 3:93899220-93899242 TTTTCTCAAAATATGGAGTAGGG - Intronic
958489938 3:94759687-94759709 GTTTGGCCAAAGATGGAATTGGG + Intergenic
959243863 3:103837388-103837410 CTTTTTCCAAAGAGGGTTTTGGG + Intergenic
959378408 3:105612932-105612954 GTTTCTCCAGAGATGGGGCTGGG - Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960175124 3:114508588-114508610 CTATATCTAAAGATGGACTTTGG + Intronic
961208797 3:125109416-125109438 CTTCCTCCAAAAATGCAGTTTGG - Intronic
961599007 3:128044268-128044290 CTTTAGGCAAAGATGGATTTAGG - Intergenic
961804097 3:129476415-129476437 TTTTCACCAAGGATGGAGTGCGG + Exonic
962154862 3:132935342-132935364 GTTTTTCCAAGGATGGGGTTGGG - Intergenic
962367001 3:134793474-134793496 CGAACTCCAAGGATGGAGTTTGG + Intronic
963187414 3:142434718-142434740 CTGTCTCCCACGCTGGAGTTTGG - Intronic
964320595 3:155492736-155492758 CGATCTCCAAACATGGAGTCTGG + Exonic
965423048 3:168486472-168486494 TTTTGTCCCAAGATGAAGTTTGG - Intergenic
965761248 3:172079342-172079364 CTTTCTCCAAAGATGGAGTTTGG + Intronic
966482058 3:180421408-180421430 CTGGCTTCAAAGATGGAGTAAGG + Intergenic
970264836 4:14270722-14270744 CTATCTCCAAAGATGCAACTTGG - Intergenic
970328846 4:14957769-14957791 CTTTCTCCACAGAAGGAGGAAGG + Intergenic
970970735 4:21980404-21980426 CTTTCTCCATATATGGATTTTGG + Intergenic
972775084 4:42232968-42232990 CTGTCTCCCAGGATGGAGTGCGG + Intergenic
972920512 4:43934994-43935016 GTTTCTCCAAAGAAGAATTTTGG - Intergenic
973654233 4:53029212-53029234 ATTTTTCCAAAGATGAAGATTGG - Intronic
975143917 4:70946758-70946780 CTTTTTCCAAAGAGGGTTTTGGG + Intronic
975978852 4:80132112-80132134 CTTCCCCAAAAGAAGGAGTTCGG + Intergenic
977124612 4:93149668-93149690 CTGTCACCAAAGCTGGAGTATGG + Intronic
977491965 4:97725683-97725705 CTTTCTGGAAACATGGATTTTGG - Intronic
977595965 4:98881095-98881117 CTTCCTCCAAAGATAGTGATTGG - Exonic
978023569 4:103844420-103844442 CTTTCTCAAAGCATGGTGTTTGG + Intergenic
978235169 4:106449342-106449364 CTTACTCCAAATATTGTGTTTGG - Intergenic
978914235 4:114104392-114104414 TTTTCTCCAAATATATAGTTAGG + Intergenic
979202382 4:117993899-117993921 CTTTTTCCAAAGGAGAAGTTTGG + Intergenic
979384926 4:120053641-120053663 CTTCCTCCTAGGTTGGAGTTGGG + Intergenic
979581060 4:122361267-122361289 CTTTCTACAAAGTTCGGGTTTGG + Intronic
980002316 4:127504889-127504911 CACTCTCCAAACATGTAGTTAGG - Intergenic
980795174 4:137673366-137673388 CTTTTTCCAATGAGGGTGTTGGG - Intergenic
981091646 4:140738505-140738527 CTTTTTCCAAAGATGGTTTTGGG - Intronic
981646534 4:147004937-147004959 CTTTCACCCAAGCTGGAGTGAGG + Intergenic
981782013 4:148441867-148441889 CTTTACCCAAAGATGAATTTCGG - Intronic
983035278 4:162857358-162857380 CTTTTTCCAAAAATAGAGATGGG + Intergenic
984376996 4:178944738-178944760 CTTTCTCCAAAGAGGATTTTAGG + Intergenic
984518323 4:180769738-180769760 TTTTCTCCAAAGATGATTTTGGG + Intergenic
988968146 5:36440458-36440480 CTTGCTCCTAAGATGAAGTGGGG + Intergenic
989472487 5:41836558-41836580 CTTTTTCCACAGATGGGGGTTGG + Intronic
990306075 5:54495026-54495048 CTTTCTCAACAGATGGAGTAGGG + Intergenic
990431478 5:55738801-55738823 TTTTTTCCAAAGAAGGAATTAGG - Intronic
990516416 5:56534878-56534900 CATTCTCCAGAGATGGAGGGTGG - Intronic
990695027 5:58406697-58406719 CTTTCTCCAAACATTGTTTTAGG + Intergenic
991509512 5:67361234-67361256 CTTTCTCAAGAGAAGGAGTGAGG - Intergenic
991949157 5:71931256-71931278 CTGTCTCCAAAGATGAATTTGGG + Intergenic
992212967 5:74498386-74498408 CTCTCTCCAGAGATGGATGTTGG - Intergenic
992256688 5:74928459-74928481 CGTTTTCCAAAGATGATGTTAGG + Intergenic
992392950 5:76346121-76346143 ATGTCTCCAAATGTGGAGTTGGG + Intronic
993254978 5:85579203-85579225 CTTTATCCAGAGAAGGAGTAGGG - Intergenic
993681111 5:90879207-90879229 ATTTCTGGAAAGATGGTGTTAGG - Intronic
993855615 5:93070909-93070931 CGTTTTCCAAAAATGGACTTAGG + Intergenic
996282925 5:121753859-121753881 CTTTCTCCAAAGATGATTTTGGG + Intergenic
999193734 5:149767811-149767833 GTTTTTCCACAGATGGGGTTGGG + Intronic
1002908217 6:1468175-1468197 CTTCCTCCAAAGATGGTTTGGGG + Intergenic
1004102749 6:12631404-12631426 CTGTCTCCCAAGCTGGAGTGTGG + Intergenic
1004639747 6:17503737-17503759 CTTTCTCCAAATATGGTACTGGG + Intronic
1005283288 6:24298053-24298075 ATTTCTCCACAGACGGAGTGGGG + Intronic
1007723470 6:43900133-43900155 CTTTCTCCAAAGGTGGAAAATGG - Intergenic
1007811827 6:44491752-44491774 CCTTCTCCAGAGATGGGGGTGGG - Intergenic
1008247906 6:49201897-49201919 CTTTTTCCAAAAAAGGATTTGGG + Intergenic
1008707830 6:54184561-54184583 GTTTCTCCAAAGCTGGCTTTGGG + Intronic
1009402127 6:63269505-63269527 CTTTATCCAATGATGGACCTAGG - Intergenic
1009486727 6:64233770-64233792 CTTTCTCCAGTGATCAAGTTTGG - Intronic
1010161778 6:72865069-72865091 CTAACTCCAAAGATGCAGTAAGG - Intronic
1011046790 6:83093278-83093300 CTCTCTCCAAAGATAGGCTTTGG + Intronic
1011575093 6:88789023-88789045 CTTTCTCCTAAGCTGGTTTTTGG + Intronic
1015360733 6:132336307-132336329 CTTTTTCCAGAGATGGATTACGG - Intronic
1015646838 6:135400907-135400929 CTTTCTCCAAAGATGATTTTGGG - Intronic
1016156290 6:140812940-140812962 TTTTCTCCAATGATGGAATTTGG - Intergenic
1016368780 6:143348651-143348673 CTATCTCCAAAAAAGGAATTGGG + Intergenic
1017181583 6:151557919-151557941 TTTTCAGCAGAGATGGAGTTTGG - Intronic
1017598782 6:156058958-156058980 CTTTCCCCAAAGGTGGATTAAGG - Intergenic
1019615621 7:1958564-1958586 CTTTTTTCAGAGATGCAGTTAGG - Intronic
1019887258 7:3916083-3916105 CTTTTTCCAAAGAGGGTTTTTGG + Intronic
1021976055 7:26012185-26012207 CTATTTCCAGAGGTGGAGTTTGG + Intergenic
1023187534 7:37547814-37547836 CTTTTTCCAAAGGTGGTTTTGGG + Intergenic
1023282727 7:38588129-38588151 CTTTTTCTAGAGATGGGGTTTGG + Intronic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1025223915 7:57140105-57140127 CTCTCTCCACAGTTGGAATTGGG + Intergenic
1025562731 7:62389523-62389545 CTTTCTCCCAGGCTGGAGTGCGG - Intergenic
1026149563 7:67776416-67776438 ATTTTTCCAAGGATGGGGTTGGG + Intergenic
1026185602 7:68080541-68080563 TTTTTTTTAAAGATGGAGTTTGG - Intergenic
1026546146 7:71324234-71324256 CTCACTCCGAAGATGGTGTTAGG + Intronic
1027187895 7:75982641-75982663 CTATCTCCATAGATAGACTTGGG + Intronic
1027232286 7:76279813-76279835 GTTTTTCCAAAAGTGGAGTTAGG - Intronic
1029542564 7:101192770-101192792 CTTTTTCAAAAGACGGATTTTGG + Intergenic
1029734592 7:102458530-102458552 CTGTCTCCCAAGCTGGAGTACGG - Intronic
1031240768 7:119236546-119236568 CTTTTTCCAGAGATGGAGGAAGG - Intergenic
1031875241 7:127132197-127132219 GTTTCTCAGAAGATGAAGTTGGG + Intronic
1033443363 7:141399662-141399684 ATTTCTCCAAAGATGGTTTATGG + Intronic
1033449767 7:141451969-141451991 GTTTCACGAAAGATGGAGCTAGG - Intronic
1033685460 7:143636260-143636282 CTCACTTTAAAGATGGAGTTTGG - Intronic
1033688630 7:143715478-143715500 CTCACTTTAAAGATGGAGTTTGG - Intronic
1033699154 7:143821360-143821382 CTCACTTTAAAGATGGAGTTTGG + Intergenic
1034778921 7:153859334-153859356 CTTTCTCTCAAGCTGGAGTCGGG + Intergenic
1034888118 7:154814555-154814577 TTTTCTTTAAAGATGGAATTGGG - Intronic
1035433949 7:158843841-158843863 CTTTTTCCAAAGAGGGTTTTGGG + Intergenic
1036130378 8:6104199-6104221 CTGTCTCCCAAGCTGGAGTGCGG - Intergenic
1038459789 8:27706186-27706208 CTGTCACCAAAGCTGGAGTGCGG + Intergenic
1039204128 8:35130790-35130812 CTTTTTCAAAAAATGGAGCTGGG - Intergenic
1040969142 8:53114859-53114881 CTTTCTCCAAAGATGGTTTGGGG + Intergenic
1041337696 8:56806439-56806461 CTTTCTCCAAAGAGGGTTTTGGG + Intergenic
1044801058 8:95957001-95957023 CTATCTCCAATGTTGGAGATGGG + Intergenic
1045046281 8:98282103-98282125 CCTACTCCAGGGATGGAGTTAGG + Intronic
1045229783 8:100292963-100292985 ATTTTTCCACAGATGGAGGTGGG + Intronic
1045290321 8:100827326-100827348 GCTTCTCCAAAGACGGAGTTTGG + Intergenic
1045594003 8:103632455-103632477 CTTTCGCCCAGGATGGAGTGAGG + Intronic
1046446128 8:114322130-114322152 CTTTCTAGAAAGATGTTGTTAGG - Intergenic
1046476373 8:114749930-114749952 CTTTTTCCAAAGATGGTTTTGGG - Intergenic
1047023900 8:120806927-120806949 CTTTCTCCAAGGGTGGAAGTGGG - Intronic
1047559921 8:125975791-125975813 CTTTCTCCACAGATGGGGATGGG + Intergenic
1047921649 8:129640630-129640652 CTATCTCTAAAGATGGTATTAGG + Intergenic
1048892178 8:138957994-138958016 CTTTCTCCAAAGATAATTTTGGG - Intergenic
1048949602 8:139484730-139484752 ATTTTTCCAAAAATGTAGTTAGG + Intergenic
1051244394 9:15094767-15094789 CCTTCTCAATAGACGGAGTTTGG + Intergenic
1051381568 9:16464055-16464077 CTGTCTCCTAGGCTGGAGTTCGG - Intronic
1052890921 9:33699328-33699350 CTTTCTCCATCAATGGAATTAGG - Intergenic
1055793376 9:79947553-79947575 ATCTCTACACAGATGGAGTTTGG - Intergenic
1057172735 9:92973507-92973529 CTTTGTTCAAGGATGCAGTTGGG + Intronic
1058723327 9:107778577-107778599 CCTTCTCCAAAGATGGAACCAGG + Intergenic
1058892587 9:109373786-109373808 CATTCCCCAAAGTTGGAGGTGGG + Intergenic
1059008059 9:110425548-110425570 CCTTCTACAAAGATGGAGTTTGG - Intronic
1059981555 9:119777947-119777969 CTTTTTCTAAAGCTGGAATTAGG - Intergenic
1060303750 9:122392281-122392303 CTCTCCCCAAAGATAGAGTTTGG - Exonic
1062731514 9:138112804-138112826 GTCTCTCACAAGATGGAGTTGGG - Intronic
1062731523 9:138112848-138112870 GTCTCTCACAAGATGGAGTTGGG - Intronic
1062731590 9:138113150-138113172 CGTTCCCATAAGATGGAGTTGGG - Intronic
1203614015 Un_KI270749v1:37242-37264 CTTTCTCCCAGGCTGGAGTGTGG - Intergenic
1185692545 X:2168086-2168108 CTGTCACCAAAGTTGGAGTGCGG - Intergenic
1189307010 X:39994527-39994549 CTTCCTACCAAGATGGAGGTGGG + Intergenic
1189863856 X:45302354-45302376 GTTTCTCCCAAAAAGGAGTTTGG - Intergenic
1192083732 X:68073289-68073311 CTTTCTCCACAGATCTATTTAGG - Exonic
1192185911 X:68946755-68946777 CTTTCTCCCAACATGGAGGCAGG - Intergenic
1192522741 X:71815994-71816016 CTCTTTCCAGAGCTGGAGTTTGG - Intergenic
1193265411 X:79463199-79463221 CTTTCACCAGAGCTGGGGTTGGG + Intergenic
1193324410 X:80162594-80162616 ATTTCTCCACAGATGGAGTGGGG - Intergenic
1193429241 X:81380205-81380227 CATGCTCCAAAGACAGAGTTGGG + Intergenic
1193900733 X:87173638-87173660 ACTTCTCCAAACATTGAGTTGGG + Intergenic
1195143182 X:101985094-101985116 ATTTCTCCAAAAATGGTGATTGG - Intergenic
1195160241 X:102163677-102163699 TTATCCCCAAAGTTGGAGTTGGG - Intergenic
1198534115 X:137569609-137569631 CTTTCTCCGCGGATGGAGTGAGG - Intronic
1199146901 X:144379531-144379553 TTTTTTCAAAACATGGAGTTTGG - Intergenic
1199381346 X:147176274-147176296 CTTTCTCCAAAGATGAATTGAGG + Intergenic
1199446627 X:147930941-147930963 TTTTCTCCTAAAATGCAGTTTGG - Intronic
1200755913 Y:6989916-6989938 CTTTCTCCAAAATTGAATTTAGG + Intronic
1201424891 Y:13838147-13838169 CATTCTTCAAAAATGGAGTCTGG + Intergenic