ID: 965761618

View in Genome Browser
Species Human (GRCh38)
Location 3:172083684-172083706
Sequence CTGGATAATTAGAGTGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965761618 Original CRISPR CTGGATAATTAGAGTGAAGA TGG Intronic
900785897 1:4650271-4650293 GTGGGAAATTAGAGAGAAGAGGG - Intergenic
903056153 1:20637651-20637673 CTGAATAATGAGAAAGAAGATGG + Intronic
905753807 1:40489819-40489841 CTGGAGCATGAGAGTGAAGGAGG + Intronic
909923118 1:81406001-81406023 CAAGATAATTACAGTAAAGATGG - Intronic
910785340 1:90991657-90991679 CAGGAGAATAAGAGTGAAGGGGG + Intronic
911035060 1:93533831-93533853 AAGGGTAATTAGAGAGAAGAGGG - Intronic
911429071 1:97760263-97760285 CTGTATATTTGGAATGAAGATGG - Intronic
916934454 1:169613202-169613224 TTAGAAAATTAGAGTTAAGAGGG - Intronic
919076289 1:192817170-192817192 CTGTCTATTTGGAGTGAAGAGGG + Intergenic
919932764 1:202232163-202232185 CTGGTTAAAGTGAGTGAAGAGGG + Intronic
921479517 1:215647742-215647764 ATGGATACGTAGAGTCAAGACGG + Intronic
922940926 1:229464972-229464994 CTGGAAAATTACATTGAACAGGG + Intronic
923859418 1:237878053-237878075 CTGAATATTCTGAGTGAAGATGG + Exonic
1068860921 10:61846895-61846917 CTGGGTAATGAGGGTGAAGGTGG - Intergenic
1069112668 10:64466050-64466072 CTGAATATTTAGAGGCAAGAAGG + Intergenic
1071822424 10:89291964-89291986 CTGGAAATTGAGAGTAAAGAGGG - Intronic
1072981068 10:100098002-100098024 CTGGAGAATTAGAGACAATAGGG - Intergenic
1073959594 10:108911668-108911690 GCGGAGAATTAGAGGGAAGATGG - Intergenic
1074538935 10:114349064-114349086 CTGGACAGTAAGAGTGCAGAAGG + Intronic
1076088335 10:127656253-127656275 CTGGGTGATTAAAATGAAGAAGG - Intergenic
1079157793 11:17964638-17964660 CTGGAATATTAGAGTTGAGAGGG - Intronic
1079619428 11:22535170-22535192 CTGGACACTGAGAGAGAAGAAGG - Intergenic
1081235509 11:40643024-40643046 CTTGAAAAGTAGAGTGAAGAAGG + Intronic
1083150615 11:60789663-60789685 CTGCAAAATGAGAGTGAGGACGG + Intronic
1085799265 11:79573332-79573354 CTGGAAAATTACAGGTAAGAAGG + Intergenic
1087100730 11:94361650-94361672 CTGGATAAATAGCGAAAAGAAGG + Intergenic
1087119069 11:94554008-94554030 CTGGATATTTGGAATGAAGCAGG + Intronic
1088760095 11:112921279-112921301 TAGGATAATTAGAGAGAAGGAGG + Intergenic
1089061745 11:115631493-115631515 CAGGAGACTTAGAGTAAAGAAGG + Intergenic
1092071591 12:5635942-5635964 CTTGATAAGTAGAGGCAAGAAGG + Intronic
1092719229 12:11424525-11424547 ATTGAGAATTAGAGTGAAAATGG - Intronic
1093444354 12:19239208-19239230 TTTGATCATCAGAGTGAAGATGG - Intronic
1094097926 12:26728525-26728547 CTGGATAATAGGAGAGAAGGTGG + Intronic
1094769843 12:33642626-33642648 TTGGATAAGCTGAGTGAAGATGG + Intergenic
1095498043 12:42806300-42806322 CTCGATTATTAAATTGAAGAAGG + Intergenic
1099048762 12:77757423-77757445 TTGTAGAATTAGAGAGAAGAAGG - Intergenic
1101376787 12:104178164-104178186 CTGGGTAATTAGAGAGGAGCTGG - Intergenic
1101507008 12:105356237-105356259 CTGGAGAATTGTAGTGTAGATGG + Intronic
1103405082 12:120669262-120669284 TTGGATTATTAGAGTGAATTTGG - Intergenic
1105617770 13:22035567-22035589 CTGGGAAATCAGAGTGAAGAAGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1110901031 13:80824859-80824881 CTGGAGACTCAGAGTGGAGAGGG - Intergenic
1111797251 13:92938194-92938216 CTGGATAATTTTTCTGAAGATGG - Intergenic
1112239357 13:97665669-97665691 CTGGAGAACAAGAGTGAAGAGGG + Intergenic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113116965 13:106884764-106884786 ATGGGTAATGAGAGTGAAGTCGG - Intergenic
1114639444 14:24209522-24209544 ATGAATAATTAGAGCAAAGAAGG - Intronic
1115619289 14:35125191-35125213 TTGGATGATTAGAGTGGACAGGG + Intronic
1116067266 14:40000698-40000720 CTGCATAACTACAGTGAACATGG + Intergenic
1117245981 14:53887119-53887141 TTGGATAAGTACAGAGAAGAGGG + Intergenic
1120061670 14:79990587-79990609 CTTGACAAATACAGTGAAGATGG - Intergenic
1121772547 14:96561342-96561364 CTGGATAATTTGGGAGAAGGGGG - Intronic
1123437144 15:20262879-20262901 CTGGAACATTACAGTGAAGATGG - Intergenic
1124806915 15:32893455-32893477 CTGCTTAATTAGAGTTAAAAAGG + Intronic
1126367488 15:47910809-47910831 GTGGATAATGAGAGAGTAGAGGG - Intergenic
1130818126 15:87462654-87462676 CTGGATAATTGGAGGGTATATGG + Intergenic
1134031725 16:10997367-10997389 ATGTATAATTCGAGTCAAGATGG + Intronic
1135671818 16:24382044-24382066 CTGGATAAGTTGTTTGAAGAGGG + Intergenic
1136847426 16:33587953-33587975 CTGGAACATTACAGTGAAGATGG + Intergenic
1137329855 16:47482446-47482468 CTGTATAATTAAAATGAATATGG - Intronic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1141355172 16:83338803-83338825 CTGGATAATAAGGAAGAAGAGGG + Intronic
1203109134 16_KI270728v1_random:1436608-1436630 CTGGAACATTACAGTGAAGATGG + Intergenic
1150336387 17:64333597-64333619 CTGGATACTTAGAGTTAAAATGG + Intronic
1154382682 18:13866927-13866949 CTGGATAATTAGAAAGATGGTGG - Intergenic
1158018443 18:52811484-52811506 TTGGAAAATTATATTGAAGAGGG + Intronic
1158719530 18:59911912-59911934 CTTGCTAAGTAGAGTTAAGAGGG - Intergenic
1159680560 18:71346098-71346120 ATGTATAATTGGAGTGAAGATGG - Intergenic
1160172906 18:76569279-76569301 CTGGCTAATTTTAGTAAAGACGG + Intergenic
1160237867 18:77099988-77100010 CTGCACAATTAGAGTAGAGAAGG - Intronic
1161408198 19:4102133-4102155 GAGGATACTAAGAGTGAAGAGGG + Intronic
1161651866 19:5490657-5490679 CTGGGTGATTAGAGAAAAGAGGG - Intergenic
1164946223 19:32295288-32295310 CTGGACCATGAGAGTGCAGAAGG - Intergenic
1165033128 19:33012693-33012715 CTGGAACATTACAGTGAAGATGG - Exonic
1165328739 19:35129191-35129213 TTGGATAACTTGAATGAAGAGGG + Intronic
1166569642 19:43785301-43785323 CTGGTGAAGGAGAGTGAAGAGGG + Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
925945839 2:8862683-8862705 CTGGATAGTTGGACTGAAGGAGG + Exonic
926368520 2:12156202-12156224 CTGAATTTTTAGAGTAAAGATGG + Intergenic
926517154 2:13861898-13861920 AAGGATAATTAGAGGCAAGAGGG + Intergenic
926606052 2:14899426-14899448 CTGGTTAAATAAAATGAAGAAGG + Intergenic
926664517 2:15505891-15505913 CTGGACAAGAAGAGTGAAAAAGG + Intronic
927999153 2:27507771-27507793 CTGGATGGTGAGAGGGAAGATGG + Exonic
930457466 2:51623802-51623824 CTGGATAATGAAAGAAAAGAAGG - Intergenic
930732432 2:54741133-54741155 CTGGACAATAAGAATGAGGAGGG - Intronic
931322602 2:61185768-61185790 CTGAATAATTGGAGGGGAGATGG + Intronic
937631971 2:124111749-124111771 CTGTATGATTAACGTGAAGAAGG - Intronic
938602198 2:132853893-132853915 CTGTGTATTTAAAGTGAAGAAGG - Intronic
939622693 2:144439466-144439488 CAGAATAATTAGAGTTAATATGG + Intronic
939689804 2:145243884-145243906 CTGCATATTTAGGGTGAAGGTGG + Intergenic
940419342 2:153461181-153461203 TTGGCAAATTAGAGAGAAGAGGG + Intergenic
940664792 2:156595048-156595070 CTGGAAAATGAGGGTAAAGATGG + Intronic
941169672 2:162121246-162121268 CAGGATCAATAGACTGAAGACGG + Intergenic
941203936 2:162548151-162548173 CTGGAAAATTAGTGAGAATAGGG + Intronic
943236853 2:185332753-185332775 GTGGAAAAGTAGACTGAAGAAGG + Intergenic
943942412 2:194015344-194015366 CTGGAAAATTGGAGAGAAGGTGG - Intergenic
944906152 2:204264221-204264243 CTGGGTAATTAGAGTCAGCAGGG - Intergenic
946261406 2:218494829-218494851 CTGGATAATTACTGTAAATACGG + Intronic
946613174 2:221481059-221481081 CTGGAGAGTTAGAGAGGAGAAGG - Intronic
1170646987 20:18206613-18206635 ATGAATTATTAGAGTGAGGAGGG + Intergenic
1173336495 20:42116321-42116343 CAGGATGATTAGTGAGAAGAGGG - Intronic
1173664190 20:44753439-44753461 CTGGAGAAGGAGAGTGGAGATGG + Intronic
1173803240 20:45908066-45908088 CTTGAGAATTAGACTGGAGAGGG - Intronic
1174222633 20:48969300-48969322 CTGGATCATTGGACTGAAGGTGG - Intronic
1174897519 20:54466747-54466769 CTGGATAAAATGTGTGAAGAGGG - Intergenic
1185236825 22:49718747-49718769 CTGGAGAATGAGAGAGGAGAGGG - Intergenic
949311337 3:2701909-2701931 CTAGATAATTTAAGTGAAAAAGG + Intronic
950162578 3:10771473-10771495 CTGGATAAGAAGACTGAAGCTGG - Intergenic
950698995 3:14727128-14727150 CTGGACATTCAGACTGAAGATGG - Intronic
951806492 3:26649928-26649950 CTGGATAAGTAGAGGGAAAGAGG - Intronic
951830884 3:26925750-26925772 CTGGAGAAAGAAAGTGAAGATGG + Intergenic
953712954 3:45290464-45290486 CTGGGTAGTGAGAGTGAGGAAGG + Intergenic
954386925 3:50249026-50249048 CTGGCCACTGAGAGTGAAGAGGG - Intronic
958781515 3:98548828-98548850 AAGGAAAATTAGAGTTAAGATGG - Intronic
958928729 3:100186868-100186890 CTTAATAATTAGACTGAATATGG - Intronic
958989990 3:100831705-100831727 CTGGATGAGTAGAGGGATGAGGG - Intronic
959363094 3:105419965-105419987 CTGGATATATAGATGGAAGACGG + Intronic
961500392 3:127328464-127328486 CTGGAAAATTGGAGGAAAGAGGG + Intergenic
962012471 3:131405816-131405838 TTGGTTTATTAGAGAGAAGAGGG - Intergenic
962193260 3:133333331-133333353 ATGGATAAGCAGAGTAAAGAAGG - Intronic
965148317 3:164936065-164936087 GTGCATAATAAGAATGAAGAAGG - Intergenic
965216674 3:165873010-165873032 TTGGATACTGAAAGTGAAGAAGG - Intergenic
965264904 3:166531061-166531083 AAGGAGAATTAGAGTGAAGAGGG + Intergenic
965761618 3:172083684-172083706 CTGGATAATTAGAGTGAAGATGG + Intronic
967157697 3:186708559-186708581 CTGTAGAATTAGAGTCATGAGGG - Intergenic
967331009 3:188289742-188289764 CTGGATGTTTAGAGAGAAAATGG + Intronic
967699804 3:192578699-192578721 TTTGATAATTTGAGTGAAAAAGG - Intronic
968952946 4:3703981-3704003 TGGGATAATTACAGGGAAGAGGG - Intergenic
970548015 4:17149208-17149230 CTGTATCAGTAGAGTGAAAATGG + Intergenic
972256437 4:37360804-37360826 CTGCATATTTATAGGGAAGAGGG + Intronic
972379494 4:38505898-38505920 CTGGAATATTAGAATGTAGAGGG - Intergenic
975989214 4:80239774-80239796 GTGGAAAATGAGAGGGAAGAAGG - Intergenic
976294552 4:83456421-83456443 CTGGATAATCTTAGTGAGGAAGG + Intronic
978660097 4:111115780-111115802 CCAGATAATTAGAGCGAGGAAGG + Intergenic
979711402 4:123784070-123784092 CAGGATAATTAAAGTAGAGAGGG - Intergenic
980105542 4:128584848-128584870 TTGGAGAATTAGACTGAGGATGG + Intergenic
980789670 4:137603746-137603768 CTTGATCAATAGAGTGAAAATGG + Intergenic
981342365 4:143636248-143636270 CTGGGAAATGAGAGTAAAGAGGG + Intronic
981891575 4:149744707-149744729 CTGGAGACTTAAAGTGGAGAGGG - Intergenic
982297771 4:153847469-153847491 CTTGATAAAGAGAGTGAAGGTGG + Intergenic
982903447 4:161037882-161037904 CTGGAGAAATAGAGTGAAGGAGG + Intergenic
983128226 4:163981284-163981306 CTGGATAACGAAAGTGAAGCAGG - Intronic
983990322 4:174110856-174110878 CTGTATAATAAGAATGAAAAAGG - Intergenic
984536370 4:180980769-180980791 CTGGAAAATTGGAGTGATGGAGG + Intergenic
989953668 5:50331233-50331255 CTTGATAAGTTGAGAGAAGAAGG + Intergenic
990864095 5:60361469-60361491 CTGATTTATTAGAGTGGAGAAGG - Intronic
991613311 5:68470346-68470368 CTGGATGATTTAAATGAAGACGG - Intergenic
993132123 5:83912101-83912123 CTGAATAATTAGAAGGAAAAAGG - Intergenic
996481607 5:123982130-123982152 CTGGGTAATTATAGAGAAAAGGG + Intergenic
1001298398 5:170515454-170515476 CTGGAAAATTAGAGTTATGTTGG + Intronic
1002110636 5:176908404-176908426 CAAGATAAATAGAGGGAAGAGGG + Intronic
1004231809 6:13840759-13840781 CTTGATAATTTGACTGAAGCCGG + Intergenic
1007650793 6:43419625-43419647 CTGGAAAATTAGGTGGAAGAAGG + Intergenic
1010034363 6:71306351-71306373 TTGGATAACTAGAATGCAGAAGG - Exonic
1010557100 6:77295974-77295996 ATGGATAATTACAGTAAAGTAGG - Intergenic
1010804392 6:80217841-80217863 CTTGGTAACTAGAGCGAAGAAGG + Intronic
1012822005 6:104096855-104096877 CTGGCTAATTAAGGTGAAAATGG + Intergenic
1014016019 6:116531063-116531085 CAGGATAATTAGATAGAACATGG - Intronic
1014681413 6:124435160-124435182 CTGGATAACTAGAAGGAATATGG + Intronic
1015890795 6:137967913-137967935 CTGGAGCATCAGAGTGATGATGG - Intergenic
1016269819 6:142275736-142275758 CTGGATAATGTAAGTGAAAAGGG + Intergenic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1018843552 6:167537316-167537338 TTTCATAATTAGAGAGAAGAAGG - Intergenic
1018903954 6:168064495-168064517 CAGGATACTTAGAGAGAAGCAGG + Intronic
1021474064 7:21040894-21040916 CTGGGTAATTAGACTGTAGTAGG - Intergenic
1022892137 7:34712307-34712329 ATGGAAAAGTAGAGTGGAGAAGG - Intronic
1022999785 7:35796860-35796882 ATGGAAAATTAGAGTTGAGAAGG + Intergenic
1023090014 7:36608827-36608849 CTGGACACTTTGAGAGAAGAGGG - Intronic
1024244258 7:47457273-47457295 CTGGGTAATTCCACTGAAGATGG + Intronic
1025092302 7:56074252-56074274 CTGGAGAATAAGAGTCAAGCAGG - Intronic
1027181086 7:75939906-75939928 CTATATAATAAGAGTAAAGAGGG - Intronic
1031466893 7:122124066-122124088 CAGTATAATTAGAGTGTATATGG - Intronic
1031644338 7:124204826-124204848 ATGCATATTTAGAGTCAAGAAGG + Intergenic
1033540708 7:142353286-142353308 CTGGATCGTCAGAGTGGAGACGG - Intergenic
1033551967 7:142455563-142455585 CTGGATCTTCAGAGTGGAGACGG - Intergenic
1033556505 7:142492601-142492623 CTGGATCGTCAGAGTGGAGATGG - Intergenic
1035843589 8:2839309-2839331 CTGGATAATGAGAGAAAAAAGGG + Intergenic
1035944959 8:3952240-3952262 CAGGAGAATAAGAGTGAGGAAGG - Intronic
1037372554 8:18195266-18195288 CTGGTTAGTGAGAGTGAAGGAGG + Intronic
1037517998 8:19652938-19652960 CTGGAAAATTTGAGGGTAGAGGG - Intronic
1043779712 8:84316138-84316160 CTGGGAAATCAGAGTAAAGATGG - Intronic
1044249540 8:89989778-89989800 CAGGAAAATAAGGGTGAAGAAGG - Intronic
1047195457 8:122717114-122717136 CTGGATTTTTAGAGAGAAGTCGG - Intergenic
1047464595 8:125100010-125100032 GTGGATAATTGGAGTGGAGGTGG + Intronic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048247278 8:132820439-132820461 CTGGAAACTTAGAGTCTAGAAGG + Intronic
1049209321 8:141378248-141378270 CTGAACAATTAGAGAGCAGAGGG - Intergenic
1052742324 9:32404915-32404937 CTGGATAATTCTAATGCAGATGG + Intronic
1055680568 9:78710937-78710959 CTGTATCAGTAGAGTTAAGATGG + Intergenic
1056737798 9:89224634-89224656 TTGGCTAACTAGAGTCAAGATGG - Intergenic
1058805744 9:108589800-108589822 ATGGAGAACAAGAGTGAAGAAGG + Intergenic
1060328277 9:122640157-122640179 GTGGATAATAATAGTAAAGAAGG - Intergenic
1187912111 X:24120594-24120616 CTGGATAATTAGAGGGACAGAGG - Intergenic
1188684623 X:33054539-33054561 CTGATTAATTAGTGTGACGAAGG + Intronic
1195266143 X:103182015-103182037 CTGTAAAATTAGAATGAAAAAGG - Intergenic
1195836651 X:109123072-109123094 CTTGATAATAAGATTAAAGAAGG + Intergenic
1196157664 X:112448828-112448850 CTGGAAAATTGCAGTAAAGATGG + Intergenic
1196477667 X:116107675-116107697 ATGGATAATTCTAGAGAAGAGGG + Intergenic
1198413375 X:136394288-136394310 CTGGATATTTCCAGTGAAGATGG - Intronic
1198662096 X:138980758-138980780 CTGGATGATAAGAATGAATAGGG + Intronic
1198926758 X:141805571-141805593 CTGGATTATTAGAATGATAAAGG - Intergenic
1199549547 X:149043774-149043796 CTGGATAATTACAGTGCTGTAGG + Intergenic