ID: 965762308

View in Genome Browser
Species Human (GRCh38)
Location 3:172092678-172092700
Sequence CTGTGGGTGTCCTGGAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 241}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965762302_965762308 23 Left 965762302 3:172092632-172092654 CCGTAGTAATTTTGATGTAGCTT 0: 1
1: 0
2: 2
3: 19
4: 292
Right 965762308 3:172092678-172092700 CTGTGGGTGTCCTGGAAAAGAGG 0: 1
1: 0
2: 1
3: 30
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965762308 Original CRISPR CTGTGGGTGTCCTGGAAAAG AGG Intronic
901166799 1:7227245-7227267 GGGTTGGTGTCCTGTAAAAGGGG - Intronic
901258834 1:7856405-7856427 CTCGGGATGCCCTGGAAAAGGGG + Intergenic
902108872 1:14061113-14061135 CTGTGAGTGTCCAGCAAACGGGG + Intergenic
902974086 1:20076159-20076181 CTGTGCCTGGCCTGGAAATGTGG + Intronic
904282261 1:29428945-29428967 CTGTGTGTGTGTTGGAGAAGAGG - Intergenic
904943256 1:34179469-34179491 CTCTGTGTGACCTGGCAAAGAGG - Intronic
905692848 1:39955523-39955545 CTGGGGGTGCCCTGGGACAGGGG + Intronic
905871376 1:41406458-41406480 CGGTGGGTGTCCTGAAGAGGTGG + Intergenic
910948319 1:92617520-92617542 CGATGGGTGGCTTGGAAAAGAGG - Intronic
913272714 1:117109805-117109827 CAGTGGGTGAGCTGGAAAGGTGG + Intergenic
914920051 1:151840202-151840224 CTGTGTTTATCCAGGAAAAGAGG - Exonic
916255230 1:162780374-162780396 GTGGGGGTGACCAGGAAAAGAGG - Exonic
916436287 1:164780855-164780877 CTAACGGTGTCCTGGACAAGAGG - Intronic
917109366 1:171529401-171529423 CTGTGGGTATGCAGGAAAGGTGG - Intronic
920523726 1:206649470-206649492 CTGTTGGTGACCTGGACAACTGG + Intronic
920904582 1:210150131-210150153 CTCTGAGTGTCATGGGAAAGAGG - Intronic
921186997 1:212678706-212678728 CCATGGGTTTGCTGGAAAAGAGG - Intergenic
921796113 1:219346625-219346647 CTGGGGATGTCCTGGAAAGTTGG - Intergenic
922138343 1:222854901-222854923 ATTTGTGTGGCCTGGAAAAGTGG + Intergenic
923191796 1:231626967-231626989 CTGGGGGGGTCCTGGCAAGGAGG + Intronic
924155660 1:241173900-241173922 CTGAGTGTGTCCTGGAAGAATGG - Intronic
924177465 1:241406725-241406747 CTGTAGGTTTCCCAGAAAAGAGG - Intergenic
924278480 1:242411879-242411901 CTGTGGGTGTTTTGCCAAAGAGG + Intronic
1063091001 10:2866292-2866314 GTGTGGGTGTCCAGCAAGAGAGG + Intergenic
1063469169 10:6270746-6270768 CTCTGGGTGTCCTACAAAGGAGG - Intergenic
1063654264 10:7971743-7971765 CTGCTGGTGTCCTGGAAAAATGG + Intronic
1064103969 10:12485579-12485601 CTTTGGGAGTCCTGGAAGGGAGG + Intronic
1064929890 10:20613605-20613627 GTGTGGGGGTCCTGGAAGGGTGG - Intergenic
1065438380 10:25724661-25724683 TTGTTGGTGTCAGGGAAAAGAGG - Intergenic
1067083336 10:43225700-43225722 GGGTGGGTGACCAGGAAAAGTGG - Intronic
1068916436 10:62437167-62437189 CTGTGGGTGTTTTGGAAAATAGG + Intronic
1071285411 10:84139741-84139763 CTGTGGGTGACCTGGTGGAGAGG + Intronic
1072828406 10:98631910-98631932 GGGTGGGTGTCCTGGAAGTGAGG - Intronic
1074109263 10:110410909-110410931 CTGTGTCTGTCCTAGCAAAGAGG + Intergenic
1076904071 10:133353617-133353639 CCGTTGGTGTCCTGGGAGAGCGG - Intergenic
1077146341 11:1047940-1047962 CTGAGGGTTTCCAGGACAAGGGG - Intergenic
1077897668 11:6465684-6465706 CTGTGGGCGCCATGGCAAAGAGG - Exonic
1078470443 11:11581841-11581863 CTGTGGGTCTCAAAGAAAAGAGG - Intronic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1080609510 11:33891940-33891962 CTCTGGGTGTCCTGGCAGAGAGG - Exonic
1081398838 11:42618696-42618718 GTGTAGGTATCCTGGAGAAGCGG - Intergenic
1082757084 11:57088043-57088065 CTGTGCCTGTTCTGGAGAAGAGG - Intergenic
1083758870 11:64805188-64805210 CTCTGGGTGCCCTGGACGAGGGG + Exonic
1084350689 11:68597020-68597042 CTGAGGGTGGGCTGGAAAACAGG - Intronic
1084387321 11:68852085-68852107 CTGTGGGAGACATGGAAATGGGG - Intergenic
1085032340 11:73280398-73280420 CTCTGGATGTGCTTGAAAAGAGG - Intronic
1085985226 11:81778948-81778970 ATGTGGGCTTCCTGGAAAAACGG + Intergenic
1088682105 11:112252262-112252284 TTGTGGGTTCCCTAGAAAAGAGG - Intronic
1089989021 11:122840837-122840859 CTGGGAGTGGCCTTGAAAAGAGG - Intronic
1091263178 11:134250052-134250074 GTCTGGGTGTCCTGGCAAAGGGG - Intronic
1093296496 12:17398431-17398453 CTGTGAGTTTCCTAGAAAATGGG - Intergenic
1094027265 12:25971930-25971952 CTTTGGGTCTCCTGGAAAGCAGG + Intronic
1097185773 12:57195564-57195586 CTGTGGTTCTCCTGGTAGAGTGG - Intronic
1097193472 12:57231422-57231444 CTGTGGGAGTCCAGGGGAAGGGG + Intronic
1099365091 12:81758747-81758769 CTGCGGCTGTTCTGGCAAAGGGG - Intronic
1101086124 12:101238852-101238874 CAGTGGTTGTCCTGGAATGGGGG + Intergenic
1101878580 12:108611169-108611191 CTGTGTGTGTGCTAGAAAAGAGG + Intergenic
1107732786 13:43365431-43365453 CTGAGGGTGTCCTGACAAAGTGG + Intronic
1111076863 13:83248573-83248595 CTGTGGGTGATCTGGAGCAGTGG - Intergenic
1111642096 13:90981486-90981508 GTGTGGGTGTGCTGGAGAGGGGG - Intergenic
1115442625 14:33453762-33453784 CTGTGGGTCTCCAGGTAAGGAGG - Intronic
1118496372 14:66311776-66311798 ATGTGTTTGTCCTGAAAAAGAGG - Intergenic
1119527449 14:75333833-75333855 CTGTGGGTGACCTGGGGAGGAGG + Intergenic
1120322376 14:82980705-82980727 CTGTGGGTTTCAGGGAAAGGGGG + Intergenic
1120363564 14:83537270-83537292 GTGTGTGTGTCATGGACAAGTGG + Intergenic
1121441972 14:93955226-93955248 GCGTGGGTGTCCTGGGAATGAGG - Intronic
1121528569 14:94637421-94637443 CGGTGGGTGTCCTGGAATTGCGG - Intergenic
1121528574 14:94637441-94637463 GGGTGGGTGTCCTGGAATTGCGG - Intergenic
1121528592 14:94637501-94637523 GGGTGGGTGTCCTGGAATTGGGG - Intergenic
1121528599 14:94637521-94637543 GGGTGGGTGTCCTGGAATTGGGG - Intergenic
1121528622 14:94637581-94637603 CGGTGGGTGTCCTGGAATTGGGG - Intergenic
1121528629 14:94637601-94637623 CGGTGGGTGTCCTGGAATTGCGG - Intergenic
1121528652 14:94637681-94637703 CAGTGGGTGTCCTGGAATTAGGG - Intergenic
1121528680 14:94637781-94637803 CAGTGGGTGTCCTGGAATTAGGG - Intergenic
1121528724 14:94637941-94637963 CGGTGGGTGTCCTGGAATTGGGG - Intergenic
1121528762 14:94638124-94638146 CGGTGGGTGTCCTGGAATTGTGG - Intergenic
1122340266 14:101023469-101023491 CTTCGGGTGTCATGGAGAAGTGG - Intergenic
1122904771 14:104796550-104796572 CTGTGAGTGTCCAGGAGAAAGGG - Intergenic
1123824356 15:24066730-24066752 CTGTGTGTGTCCTGTGAAGGGGG + Intergenic
1124180420 15:27467991-27468013 CTGTGGATACCCTGGAGAAGGGG - Intronic
1124634241 15:31354732-31354754 ATGTGGGTGTCCTGAAGATGTGG - Intronic
1125808034 15:42511345-42511367 CAGTGAGTGTCCTGGACAACTGG + Intronic
1126066856 15:44832443-44832465 CTGTCCGTGGCCTGGACAAGTGG - Intergenic
1126706674 15:51412628-51412650 CTATGGGTGTCATAGTAAAGTGG + Intergenic
1128142236 15:65310324-65310346 CTGGGGCTGCTCTGGAAAAGGGG + Intergenic
1130287454 15:82567796-82567818 CTGTGGGGGACCTGGAAACAAGG - Intronic
1130929330 15:88411509-88411531 GGGTGGGTGTCCAGGAAAAGAGG - Intergenic
1132213312 15:100042717-100042739 CTGTGGATCCCCTGGACAAGGGG + Intronic
1133876280 16:9737823-9737845 GTGTGAGTGTGCTGGCAAAGAGG - Intergenic
1134870061 16:17644506-17644528 CATTGGGTGGCCTGGAAAAGGGG + Intergenic
1136312394 16:29421589-29421611 ATGTGGATGCCCTGGAAAACAGG - Intergenic
1136415906 16:30103544-30103566 TTATGGGTCTCATGGAAAAGTGG + Intergenic
1136555967 16:31008121-31008143 GTGTGGGGGACCTGGAAACGGGG - Intronic
1138199131 16:55076085-55076107 ATGAGGGTGTCCAGGAAGAGAGG + Intergenic
1140566502 16:76049035-76049057 ATGTGTGTGTGCTGGCAAAGGGG + Intergenic
1142210362 16:88805657-88805679 CTGTGGCTGTCCTGGAGTTGGGG + Intronic
1142741334 17:1933434-1933456 CTCTGGGGGTCCAGGGAAAGTGG + Intergenic
1142803986 17:2362097-2362119 CTGAGGGTTTCCTGCAAAGGCGG - Exonic
1142957976 17:3534181-3534203 GTGTGGGTGTCCTGGAAAACGGG - Intronic
1143336785 17:6177508-6177530 CTGTGTGTGAACTGGAGAAGCGG + Intergenic
1143445727 17:7007994-7008016 CTGTGGGCAGCCTGGAAGAGGGG - Intronic
1143592019 17:7890877-7890899 CTGTGTGCGGCCTGGAATAGGGG + Intronic
1144358761 17:14470854-14470876 CTGTGAGTGTCCTGTAAAACAGG - Intergenic
1145304369 17:21665077-21665099 CTCTAGGTGCCTTGGAAAAGTGG + Intergenic
1145310766 17:21700069-21700091 CTGAGGCTGTGCTGGGAAAGGGG - Intronic
1145775353 17:27524146-27524168 TTGTGGGAGTCCTGGGAAGGAGG + Intronic
1146949037 17:36893062-36893084 CTGTGGGTGGGATGGAAGAGAGG - Intergenic
1148258424 17:46157129-46157151 TTGTGGCAGTCCTAGAAAAGGGG - Intronic
1148732422 17:49845596-49845618 CTTTAGCTTTCCTGGAAAAGGGG - Intronic
1151732087 17:75917665-75917687 TTGCGGGTGCCCTGGAGAAGAGG + Intronic
1159247158 18:65821823-65821845 CTTTAGGTTTCATGGAAAAGTGG - Intronic
1160097724 18:75890510-75890532 CTGTGTGTGTCTTAGAAAGGTGG - Intergenic
1162191410 19:8949887-8949909 CTCTGGGAGGCCTGGATAAGAGG + Exonic
1162302164 19:9850161-9850183 CTGTGGGTCTGATGGAGAAGTGG + Intergenic
1163667047 19:18608074-18608096 CTAAGGGACTCCTGGAAAAGGGG - Intronic
1164611297 19:29634107-29634129 CTGTGGGTGGACTGGCAAATTGG + Intergenic
1166347223 19:42174188-42174210 CTCTGCGTGTCCTGGGTAAGAGG - Intronic
1167429593 19:49446894-49446916 CTGTGGGCCTCCTGGCAGAGAGG + Intronic
1167454623 19:49591749-49591771 CTGAGGGTGGCCTAGAGAAGGGG + Intronic
1168162586 19:54521527-54521549 GTGTGGTTCTCCTGGAAAATGGG - Intergenic
925303875 2:2835699-2835721 CTCTGTGGGTCCTGGAAATGGGG + Intergenic
925388822 2:3482145-3482167 CTGTGTGGGTCCAGGACAAGAGG - Intronic
926104426 2:10141551-10141573 CTGTGGTTGTGCTGGAATGGAGG + Exonic
926206436 2:10837229-10837251 CTGGTGGTGTCCTGGGTAAGGGG - Intronic
926979966 2:18558879-18558901 CATTGGTTCTCCTGGAAAAGTGG - Intronic
928001088 2:27523539-27523561 CTGCGGATGCCCTGGAAACGGGG - Exonic
928286317 2:29992991-29993013 CGGTGGGGATCCAGGAAAAGTGG + Intergenic
929946456 2:46376000-46376022 CTGTGGATGTCTTGGAACAGTGG + Intronic
931565901 2:63615380-63615402 CTGTGCATGTGCTGAAAAAGGGG - Intronic
933017554 2:77148257-77148279 CCTTGGGTGTCTTGCAAAAGGGG + Intronic
935786901 2:106557725-106557747 CATAGGGGGTCCTGGAAAAGGGG - Intergenic
936622867 2:114118433-114118455 ATGTGGATGTCCTGGGAGAGTGG + Intergenic
936892956 2:117393395-117393417 CTGTGGGTGTCTCTGGAAAGAGG - Intergenic
937903779 2:127041775-127041797 CCGTGGCTGTCTAGGAAAAGAGG + Intergenic
939136999 2:138308788-138308810 TTGTGGGTGTCATGGGAGAGGGG - Intergenic
944436553 2:199696136-199696158 ATGTGTGTGCCCTGGAAAAGTGG - Intergenic
947358089 2:229317919-229317941 TTGTGGCTGTCCTGGAAACCTGG + Intergenic
947388887 2:229620138-229620160 CTGTGGGTGTCGCGGAAGAACGG + Intronic
947849387 2:233273157-233273179 CGCTGGGTGTCCCAGAAAAGGGG - Intronic
948014075 2:234673567-234673589 CTGTGAGGGTACTGGAACAGAGG + Intergenic
948043425 2:234923390-234923412 CAGTGGGTGTGCTGGAAAGGTGG + Intergenic
948444801 2:238024124-238024146 ATGTGTGTGGCCTAGAAAAGAGG + Intronic
948951464 2:241254943-241254965 CTGTGGATGCCCTTGAAAACTGG - Intronic
1169198127 20:3694162-3694184 GTGTGTGTGTCCTTTAAAAGAGG - Intronic
1169711900 20:8574113-8574135 CTGTGGTTGGCCTGGCATAGTGG + Intronic
1170324786 20:15144809-15144831 CGGTTGCTGTCCTGGAAGAGTGG + Intronic
1170930612 20:20766998-20767020 CTGTGGGGGTCTGGGGAAAGGGG - Intergenic
1171557694 20:26092912-26092934 TTGTGGGTGTCCTGGAGGACAGG - Intergenic
1173225543 20:41160412-41160434 CTTTGGGTGTCCTGGAGGTGAGG + Intronic
1175983614 20:62753519-62753541 TTTTGGGTGTCTTGGAGAAGCGG - Intronic
1176655698 21:9587506-9587528 CTCTAGGTGTCTTGGAAAAGTGG + Intergenic
1177101624 21:16904240-16904262 CTTTTAGTGACCTGGAAAAGAGG - Intergenic
1178341706 21:31791092-31791114 CTGTGGGTGTCCAGTAAATGTGG - Intergenic
1179884542 21:44307961-44307983 CAGGGCGTGTCCTGGAAAAGGGG + Intronic
1179967709 21:44816958-44816980 CTGGGGGTGTGATGGAAAGGGGG + Intronic
1180244114 21:46534865-46534887 CTGTGGTTGTGCTGGCCAAGAGG + Intronic
1182436873 22:30336587-30336609 CTGTTGGGGTCCTGGAATAAGGG - Intronic
1183078486 22:35441599-35441621 CAGTGGGTGTCCTGGCAGTGGGG + Intergenic
1183524502 22:38315513-38315535 GTGTGGGTTTCCTGCAAACGTGG - Intronic
1184048830 22:41989484-41989506 CTGTGGGTGTCCTGGAGTGGTGG + Intronic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
950148006 3:10665479-10665501 CTGTGGGGTTCCTGGAATAGGGG + Intronic
951539102 3:23765499-23765521 ATGTTGGTGTCTTGGAAAGGTGG - Intergenic
953927181 3:46988424-46988446 CAGTGGGGTGCCTGGAAAAGTGG + Intronic
954039620 3:47875051-47875073 CCGTGGGTGACCTGGAAAACTGG + Intronic
954713303 3:52515411-52515433 CTGGGTGTGTCCTGGAAACGGGG - Exonic
956103906 3:65796795-65796817 CTGTTGCTGTCATGGGAAAGCGG + Intronic
956621466 3:71225239-71225261 CTGTGGCTATCCAGGCAAAGGGG - Intronic
956755417 3:72381161-72381183 CTGTGTGTTTCTTGGAAGAGAGG - Intronic
957686059 3:83504066-83504088 CTGTGGGCCTCCTGGAATATTGG - Intergenic
958606219 3:96361657-96361679 CTGTGGGATTCCAGGAACAGTGG + Intergenic
961422280 3:126815903-126815925 CTGTGAGTGTTCTGCAAATGGGG - Intronic
962253452 3:133853693-133853715 TTGGGAGTGTCCTGGAAAAATGG + Intronic
963261946 3:143201809-143201831 CTCTAGGGGTCCTGGGAAAGGGG + Intergenic
963942642 3:151110388-151110410 CTGTGGTTTTCCTCTAAAAGGGG + Intronic
965176748 3:165344793-165344815 GTGTGTGTGTCTTGGAAAAAGGG + Intergenic
965375586 3:167919457-167919479 CTGTAGGTGTCCCAGAAATGGGG - Intergenic
965762308 3:172092678-172092700 CTGTGGGTGTCCTGGAAAAGAGG + Intronic
966649483 3:182283360-182283382 CTGTGGATGTTCAAGAAAAGGGG - Intergenic
969059880 4:4426071-4426093 GGGTAGGTGTCCTGGAGAAGTGG - Intronic
971968471 4:33592789-33592811 CTGTGTGTCTCCTGGAAAGATGG - Intergenic
979940713 4:126758826-126758848 CAGTGGGTGTCCTGGCACTGGGG + Intergenic
982677753 4:158395631-158395653 TTGGGGGTGTCTTGAAAAAGAGG - Intronic
983642808 4:169958892-169958914 CTGAGGGTGACCTGGCACAGTGG - Intergenic
984014114 4:174405553-174405575 CTAAGAGTGTTCTGGAAAAGGGG + Intergenic
985538509 5:477221-477243 CTGGGGGTGGCATGGAAGAGGGG - Intronic
986499504 5:8384414-8384436 CTTGGGGTGTTCTGGAAAGGGGG - Intergenic
986783294 5:11086299-11086321 CCATGTGTGTCCTGGAGAAGAGG + Intronic
991642626 5:68770028-68770050 CTCTGGGTATCCTGAACAAGAGG + Intergenic
992341889 5:75832522-75832544 GTCTGGGTGGCCTGGAAACGTGG + Intergenic
992686995 5:79208831-79208853 CTGTGCTTCTTCTGGAAAAGAGG + Intronic
994970474 5:106730763-106730785 CTGTGTGTGTACAGGTAAAGCGG - Intergenic
996307160 5:122060404-122060426 GTGTGGGTGTGATGGGAAAGTGG - Intronic
997021440 5:130007507-130007529 CTGTGTGCTTCCTGGAGAAGGGG + Intronic
997332429 5:133074667-133074689 TTTTGAGTGTTCTGGAAAAGGGG + Intronic
999149120 5:149415071-149415093 CTGTGAGGGTCCTGGAGCAGTGG + Intergenic
1001020130 5:168175723-168175745 CTGGGGTTATGCTGGAAAAGAGG + Intronic
1001964393 5:175900256-175900278 CGGTGGTTGCCCTGGAAACGTGG - Intergenic
1003837102 6:10083610-10083632 TTGGGGTTGTCCTGGACAAGTGG - Intronic
1005530957 6:26705329-26705351 TAGTGGGTGTCCTGGAACACAGG - Intergenic
1005539839 6:26796307-26796329 TAGTGGGTGTCCTGGAACACAGG + Intergenic
1005675358 6:28148854-28148876 CTGTGGGAGTCCTGGAAGCTTGG + Intronic
1005922763 6:30416254-30416276 CTGTGGGTGTCCTGCCCAATGGG + Intergenic
1007503035 6:42313142-42313164 AAGTGGGTGTCCTGGAAGTGTGG - Intronic
1008778466 6:55070733-55070755 CTGTGGATTTCCTGAAAAACAGG + Intergenic
1009010657 6:57838448-57838470 TAGTGGGTGTCCTGGAACACAGG + Intergenic
1010812864 6:80319581-80319603 CTCTGGTTGTACTGCAAAAGTGG + Intronic
1011614844 6:89188265-89188287 CTGTGGGTGGCCGGGGTAAGAGG - Intronic
1011625742 6:89282190-89282212 CTGTGGGTGTGGTGGAGGAGGGG - Intronic
1016292346 6:142539074-142539096 CTGATGGTGCCCTGGAACAGAGG + Intergenic
1017821323 6:158050914-158050936 CATTGGGTGTCATGGAAAGGTGG - Intronic
1019674178 7:2301505-2301527 CTCTGGGTGCCCTGGTAAGGGGG - Intronic
1019778337 7:2925523-2925545 CTGGGGGAGCCCTGGAAGAGAGG + Intronic
1019800423 7:3084369-3084391 GTGTGGGTGTCCCGGGATAGGGG + Intergenic
1020074431 7:5248477-5248499 CTGTGGCTGTCCGGGAGACGGGG - Intergenic
1020123751 7:5520759-5520781 CTGTGGGTGTCTGGGGACAGCGG + Intergenic
1020706053 7:11545623-11545645 CTGAGGGGCTCCTGGGAAAGGGG + Intronic
1024244200 7:47457091-47457113 CTGGAGGTGTGCTGGTAAAGGGG + Intronic
1024902349 7:54334216-54334238 CTATGTGGGTTCTGGAAAAGAGG - Intergenic
1024987157 7:55205351-55205373 CTGTGGGGGTCCTGGTAGTGTGG - Exonic
1025282387 7:57637691-57637713 CTCTAGGTGCCTTGGAAAAGTGG + Intergenic
1025302343 7:57827828-57827850 CTCTAGGTGCCTTGGAAAAGTGG - Intergenic
1026589295 7:71681518-71681540 CTGTGGGTATCCTAGGAAGGTGG - Intronic
1026679248 7:72452850-72452872 CTGTGGGTATCCTGGAGCTGAGG - Intergenic
1027573743 7:79905728-79905750 CTGTGGCTCTCCTGGTAGAGGGG + Intergenic
1027789778 7:82624911-82624933 CTGTGGGGGTCCAGGAAAACAGG - Intergenic
1028456034 7:91039180-91039202 CGGTGGGGGCCCAGGAAAAGAGG - Intronic
1029495393 7:100893609-100893631 ATGTGGGTCTCCTGGATCAGAGG - Exonic
1032435387 7:131896674-131896696 CTGCAGGGGTCCCGGAAAAGAGG + Intergenic
1032451873 7:132038439-132038461 CTGTGGCTGGGCAGGAAAAGTGG - Intergenic
1033547844 7:142418171-142418193 GTGTGGCTGTGCAGGAAAAGTGG + Intergenic
1035391690 7:158508592-158508614 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391703 7:158508649-158508671 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391715 7:158508706-158508728 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391727 7:158508763-158508785 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391739 7:158508820-158508842 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391752 7:158508877-158508899 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391763 7:158508934-158508956 CTGTGGGTGTCAGGGCAACGTGG + Intronic
1035966919 8:4202871-4202893 TAGAGGGTGTCCTGGAGAAGGGG + Intronic
1036942985 8:13069122-13069144 CTGGAGGTGTCGTGGAGAAGTGG - Intergenic
1037027392 8:14055973-14055995 CAAAGTGTGTCCTGGAAAAGAGG - Intergenic
1038894409 8:31765728-31765750 CTTTCTGTGTCATGGAAAAGAGG + Intronic
1041234014 8:55780609-55780631 TTGTGGGTTTACTGGAAAACAGG - Intronic
1041261005 8:56020499-56020521 CTGTGGCTGGGCTGCAAAAGGGG - Intergenic
1042503086 8:69530859-69530881 CTGTTGGTGTCCTGCACAAGTGG + Intronic
1042734583 8:71974131-71974153 CTGTTGGTATTCTTGAAAAGGGG + Intronic
1045329352 8:101142192-101142214 TTCTGGGTGTCCTGACAAAGTGG + Intergenic
1047287612 8:123501715-123501737 CTTTGGGTGACCTGGAAAGGGGG - Exonic
1048727282 8:137400791-137400813 GTGTGGGTGTGCTGGCAAATTGG - Intergenic
1049865492 8:144932900-144932922 GTGTGGGTGTCGAGGAAGAGGGG - Intronic
1054109792 9:61096173-61096195 CTGTGGGGATTCTGGAAAGGAGG + Intergenic
1054611065 9:67234952-67234974 CTGTGGGGATTCTGGAAAGGAGG - Intergenic
1056502448 9:87223291-87223313 CTGTGGGAGGCTTGGAAATGGGG + Intergenic
1057024363 9:91724263-91724285 CTGTGGATGTCCTTGAAGCGGGG + Exonic
1057208010 9:93184771-93184793 CTCTGGGGGCCCTGGGAAAGGGG - Intergenic
1058687719 9:107492170-107492192 CTTTGGCTTTCCTGAAAAAGTGG - Intergenic
1061518448 9:131103171-131103193 CTGTAGGTGACCAGGAAAGGCGG + Intronic
1061912666 9:133733321-133733343 CCATGGGTGTCCTGGCAAACTGG - Intronic
1062328278 9:136023160-136023182 CTCTGGGTCTCCTGGAAACCCGG + Intronic
1203633413 Un_KI270750v1:90967-90989 CTCTAGGTGTCTTGGAAAAGTGG + Intergenic
1185680345 X:1883898-1883920 GTGTGGATTTCCTGCAAAAGTGG - Intergenic
1190430094 X:50370605-50370627 TTGCTGGAGTCCTGGAAAAGTGG + Intronic
1194339534 X:92692065-92692087 CTGTGTGTTCTCTGGAAAAGAGG + Intergenic
1194589961 X:95787947-95787969 CTGTTGCTGTCCTGGAATTGGGG - Intergenic
1194669509 X:96713404-96713426 CTGTGGGTGTGTGGGAATAGAGG - Intronic
1195255340 X:103084321-103084343 CAGTGAGTGTCCTGGCAAAGTGG - Exonic
1195800219 X:108700585-108700607 CTGTATGTATACTGGAAAAGAGG + Intergenic
1197551911 X:127901843-127901865 CTGTGTGTGTCGTGTAAAAGGGG - Intergenic
1198546849 X:137701521-137701543 CAGTGTTTGTCCTGGAAAGGGGG + Intergenic
1199077034 X:143536117-143536139 CTGTGGGTGTCAGGGGAAGGGGG - Intergenic
1199211270 X:145214443-145214465 CTGTAGGTCACCTGGAAAACTGG - Intergenic
1199912239 X:152299312-152299334 CTGGGGATCTCCTTGAAAAGAGG + Intronic
1200647918 Y:5808846-5808868 CTGTGTGTTCTCTGGAAAAGAGG + Intergenic