ID: 965768058

View in Genome Browser
Species Human (GRCh38)
Location 3:172152553-172152575
Sequence CTTCCCATGGAGAATGTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 265}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965768058_965768063 17 Left 965768058 3:172152553-172152575 CCACTCACATTCTCCATGGGAAG 0: 1
1: 0
2: 1
3: 26
4: 265
Right 965768063 3:172152593-172152615 TTCTTCAAACCTGGTATTTTTGG 0: 1
1: 1
2: 3
3: 16
4: 314
965768058_965768064 25 Left 965768058 3:172152553-172152575 CCACTCACATTCTCCATGGGAAG 0: 1
1: 0
2: 1
3: 26
4: 265
Right 965768064 3:172152601-172152623 ACCTGGTATTTTTGGAGAGAAGG 0: 1
1: 0
2: 4
3: 31
4: 466
965768058_965768062 8 Left 965768058 3:172152553-172152575 CCACTCACATTCTCCATGGGAAG 0: 1
1: 0
2: 1
3: 26
4: 265
Right 965768062 3:172152584-172152606 TTTTTTTTTTTCTTCAAACCTGG 0: 1
1: 7
2: 140
3: 2534
4: 28674

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965768058 Original CRISPR CTTCCCATGGAGAATGTGAG TGG (reversed) Intronic
903319059 1:22530887-22530909 CTTCCCAGGGAGCAAGTGTGGGG + Exonic
903736984 1:25536208-25536230 CTTCACATGGAGCATGTGTGGGG - Intergenic
904634326 1:31867923-31867945 ATTCCCATGGAGACTGTGCAAGG - Intergenic
907421955 1:54353615-54353637 ACTTCCATGGAGCATGTGAGAGG - Intronic
907482095 1:54752227-54752249 CCACCAATGGAGAATCTGAGAGG + Intergenic
908723916 1:67155279-67155301 CTTCTCATGGAGTATCTTAGTGG + Intronic
908982597 1:69976816-69976838 CTCTCCAAGGGGAATGTGAGGGG - Intronic
909303248 1:74039480-74039502 CTTCTCATGGAGTATCTTAGTGG - Intronic
911289845 1:96044083-96044105 TTTCCAATGGATGATGTGAGGGG + Intergenic
911508711 1:98785394-98785416 CTTCTCATGGAGTATCTTAGTGG - Intergenic
911874631 1:103144210-103144232 CTTTCCAAGGCAAATGTGAGAGG - Intergenic
913074751 1:115332560-115332582 CTTCCAAGGGAGAACGTGAGGGG + Intronic
914400773 1:147317955-147317977 CTTCTCATGGAGTATCTTAGTGG - Intergenic
914772467 1:150701382-150701404 CTTCCCATTGAGAATAGGGGTGG + Intronic
915061193 1:153187188-153187210 CTTCTCAAGGAGAATCTTAGAGG + Intergenic
916848857 1:168682748-168682770 CTTCTCATGGAGTATCTTAGTGG + Intergenic
917060396 1:171031766-171031788 CTTCTCATGGAGTATCTTAGTGG + Intronic
917269800 1:173259993-173260015 CTTCTCATGGAGTATCTTAGTGG - Intergenic
917295525 1:173515141-173515163 CTTCTCATGGAGTATCTTAGTGG + Intronic
918797647 1:188924157-188924179 ATTTCTATGGAGAATGTCAGTGG - Intergenic
920502828 1:206496298-206496320 CTTCCCAGGGAGAAAGGCAGTGG - Exonic
921543795 1:216450491-216450513 GTTTGCGTGGAGAATGTGAGAGG - Intergenic
924429733 1:243986696-243986718 CTTTCCAGTGAAAATGTGAGAGG - Intergenic
1063425492 10:5947096-5947118 CTCCCCATGCAGAATGGGACAGG + Intronic
1063612673 10:7576381-7576403 CTTCCTGTGGAGGAGGTGAGTGG + Intronic
1064338764 10:14467982-14468004 CCTCCCAGGGAGACTCTGAGAGG + Intergenic
1068380991 10:56253950-56253972 CTTCTCATGGAGTATCTTAGTGG + Intergenic
1070932608 10:80272001-80272023 CTTCCCATGGAGGGAGGGAGTGG - Exonic
1071489149 10:86124136-86124158 CTTCCCATGGAGTCAGAGAGTGG + Intronic
1072266094 10:93729388-93729410 CTGGCCAAGGAGAATGTGACTGG + Intergenic
1073192872 10:101664457-101664479 CTCCTCATGGAAAATATGAGGGG - Intronic
1074060474 10:109960880-109960902 CTGCCCAGGGAGAAGGGGAGGGG + Intergenic
1074528159 10:114278935-114278957 CCTGCCATGGAGATTGTGACAGG + Intronic
1075670514 10:124261070-124261092 TGTCCCATTGCGAATGTGAGTGG - Intergenic
1075963527 10:126589360-126589382 CTTCTCATGGAGTATCTTAGTGG - Intronic
1076410465 10:130245323-130245345 CTCCACATGGAGGAGGTGAGGGG - Intergenic
1077544135 11:3161690-3161712 CTTCCTATGGAGAAAGCGATTGG - Intronic
1078321762 11:10341264-10341286 CTTCTCATGGAGTATGTTTGTGG - Intronic
1079426233 11:20344327-20344349 CTTCTCATGGAGTATCTGAGTGG - Intergenic
1079580189 11:22054634-22054656 CTTCTCATGGAGTATGTTACTGG + Intergenic
1081339980 11:41916555-41916577 CTTCTCATGGAGTATCTTAGTGG + Intergenic
1083521986 11:63322212-63322234 CTTCTCATGGAGTATCTTAGTGG - Intronic
1084687353 11:70704391-70704413 CTTCCCATGGGGAAGGGAAGCGG - Intronic
1086561416 11:88174080-88174102 GTTCCCATGGAGAATCCCAGAGG + Intronic
1088106774 11:106215415-106215437 CTTTCCAAAGAGAATGTCAGAGG + Intergenic
1090116955 11:123983621-123983643 CTTCTCATGGAGTATCTTAGTGG + Intergenic
1091130546 11:133143371-133143393 CACCCCATAGAGAATGGGAGAGG - Intronic
1091271080 11:134312385-134312407 CTTCCCATAAACAATGGGAGCGG + Exonic
1095632411 12:44393985-44394007 CATCCCCAGGAGAATGTTAGAGG + Intergenic
1096937957 12:55304760-55304782 CTTCTCATGGAGTATCTTAGTGG - Intergenic
1097148416 12:56957875-56957897 TTTGCCATGGAGAGTGTGTGTGG - Exonic
1097583108 12:61482388-61482410 CTTCTCATGGAGTATCTGACTGG - Intergenic
1097654238 12:62341868-62341890 CTTCTCATGGAGTATCTTAGTGG + Intronic
1097780632 12:63699946-63699968 GTTGCAAAGGAGAATGTGAGGGG - Intergenic
1098694811 12:73538892-73538914 CTTCTCATGGAGTATCTTAGTGG - Intergenic
1098714420 12:73811692-73811714 CTTACTATTGAGACTGTGAGAGG - Intergenic
1099039350 12:77631681-77631703 CTTCACATGGATTATGTCAGAGG + Intergenic
1101563450 12:105882068-105882090 CTGTCCATGGAGATTGTGGGAGG - Intergenic
1104300434 12:127560007-127560029 CTTACGCTGCAGAATGTGAGAGG - Intergenic
1106750104 13:32754598-32754620 CTTACGCTGGAAAATGTGAGGGG + Intronic
1107607503 13:42074935-42074957 TTTCACATGGAGCATGAGAGTGG + Intronic
1107811058 13:44200069-44200091 CCTCCTCTGTAGAATGTGAGTGG - Intergenic
1108113644 13:47104153-47104175 CTTCTCATGGAGTATCTTAGTGG - Intergenic
1108719153 13:53112488-53112510 ATGCCCATGGCTAATGTGAGAGG + Intergenic
1109053402 13:57513913-57513935 GTTCTCATGGAGAATTTTAGAGG - Intergenic
1111305814 13:86411019-86411041 CTTCTCATGGAGTATCTTAGTGG - Intergenic
1111798890 13:92958408-92958430 ATTTCCATGAAGAATGTCAGTGG + Intergenic
1112143767 13:96674864-96674886 CTTTCTCTTGAGAATGTGAGAGG - Intronic
1114944442 14:27662057-27662079 ATTTCAATGGAGAATGTGATTGG - Intergenic
1115924383 14:38414128-38414150 CTTCTCATGGAGTATTTTAGTGG - Intergenic
1115927387 14:38450334-38450356 CTTCCCATGGAGTATCTTAGTGG - Intergenic
1116769326 14:49108987-49109009 GTGCCCATGAAGACTGTGAGTGG + Intergenic
1116807460 14:49507911-49507933 CTGGCCATGGAGAATGGTAGGGG + Intergenic
1117747467 14:58885183-58885205 CCTCTCATGAAGAATGTGGGAGG - Intergenic
1117945338 14:61013873-61013895 CTTCTCGTGGAGTATGTTAGTGG + Intronic
1118895355 14:69941191-69941213 CTGCCCATGGAGAATATCAGTGG - Intronic
1120700771 14:87696672-87696694 CTTACCATGGAGAAGTTGATAGG - Intergenic
1121782193 14:96629103-96629125 CATCCTAAGGAGAGTGTGAGGGG + Intergenic
1123202555 14:106680330-106680352 ATTCCCATGGAGGATTTGTGGGG - Intergenic
1124110103 15:26777250-26777272 CTTCGCAAAGAAAATGTGAGTGG - Intronic
1125286332 15:38096585-38096607 CTTCTCATGGAGTATCTTAGTGG - Intergenic
1126069215 15:44851098-44851120 CTTCCCATGTGGCATTTGAGGGG + Intergenic
1126089598 15:45039674-45039696 CTTCCCATGTGGCATTTGAGGGG - Intronic
1127042514 15:54992236-54992258 CTTCTCATGGAGTATCTTAGTGG - Intergenic
1128609799 15:69064532-69064554 CTCACCATGGAGAGTGTGTGTGG + Intergenic
1129202073 15:74008897-74008919 CATTCCACGGAGAATTTGAGGGG + Intronic
1129523450 15:76199877-76199899 CTTCCCAGGAGGGATGTGAGGGG + Intronic
1131369464 15:91867680-91867702 CTTCCCAAGGAGAACAGGAGGGG - Intronic
1131889091 15:96952583-96952605 CTTCCCAAGAAGAATGGGAGAGG - Intergenic
1131902887 15:97108054-97108076 CTTCTCATGGAGTATCTTAGTGG - Intergenic
1132895439 16:2226988-2227010 CGTGCCCTGGAGCATGTGAGTGG - Intronic
1132936527 16:2484061-2484083 CCTCCCATGCAGAATGTCAGGGG - Intronic
1133394964 16:5439455-5439477 CTTCCAATGGGAAATGAGAGAGG + Intergenic
1134846855 16:17447638-17447660 CATCCCAGGGAGAAGGAGAGAGG + Intronic
1135868781 16:26129595-26129617 CTTCTCATGGGGAGTTTGAGAGG - Intronic
1140907318 16:79419930-79419952 CTCTCCATGGAAAGTGTGAGTGG - Intergenic
1140916706 16:79500304-79500326 CATCCCATGAAGAATGTTGGTGG - Intergenic
1141818236 16:86427260-86427282 CTTCCCAAGGTGAGTGTGTGGGG + Intergenic
1142008141 16:87700094-87700116 TGTCCCATGAAGACTGTGAGGGG - Intronic
1142911748 17:3099180-3099202 CTTCTCATGGAGTATTTTAGTGG - Intergenic
1144359894 17:14482049-14482071 CTACCCTTGGAGAATGGGAAAGG + Intergenic
1146615746 17:34356205-34356227 CTTCCCATGGTGAATGGCTGGGG + Intergenic
1147020479 17:37527998-37528020 CTTCCCATGAAGACTCTGTGAGG - Intronic
1156850939 18:41725504-41725526 GTCTCCATGGAGAATGTAAGAGG - Intergenic
1157387242 18:47267903-47267925 CTCCCCAAGTAGAATGTAAGGGG - Intergenic
1157707922 18:49823640-49823662 CTTTCCATGAAGCATGTCAGTGG - Exonic
1158311740 18:56166703-56166725 CATTCCATGGAGGAGGTGAGAGG - Intergenic
1158728997 18:60002489-60002511 CTTCTCATGGAGTATCTTAGTGG + Intergenic
1159672586 18:71240073-71240095 TTTCCCATAGAAAATGTTAGAGG - Intergenic
1159736643 18:72107531-72107553 CTTACAATGGTGAATGTGTGGGG - Intergenic
1160382294 18:78469364-78469386 ATTACCCTGGATAATGTGAGTGG - Intergenic
1161401834 19:4069269-4069291 CTCACCATGGAGAATCCGAGTGG - Intergenic
1162309561 19:9897798-9897820 CTTCCCATGGAGCATGGAAGGGG + Intronic
1162857891 19:13483056-13483078 CATCCCATGGTGTATGAGAGAGG - Intronic
1165262572 19:34633168-34633190 CTTCTCTTGGAAAATGTGAATGG + Intronic
1165981321 19:39726775-39726797 CCTCCTATGGAGATTGAGAGTGG + Intergenic
1168523253 19:57069183-57069205 CCTCCCATGGAGAAGGGGAGCGG - Intergenic
1168697176 19:58410129-58410151 CTTCGCATGGGGAAAATGAGGGG - Intronic
925156072 2:1649707-1649729 ATTCCCCTGGAGGATGTGTGAGG + Intronic
929028708 2:37630157-37630179 CTCCCCATGGTGAAAGTGTGTGG + Intergenic
929948287 2:46387140-46387162 CTTCCCAGGTAGACTGTGATTGG + Intergenic
933218656 2:79661971-79661993 TTAACCATGGAGAATGTGAAGGG + Intronic
935951388 2:108332413-108332435 TTTCCCAAGGAGAATTTGATGGG - Intergenic
936051267 2:109225509-109225531 CTCCACATGGTGAGTGTGAGTGG - Intronic
937022210 2:118668197-118668219 TTTGCCTTGGAGAAAGTGAGTGG - Intergenic
938379976 2:130831178-130831200 CCTCCCATGGTGACTGTGAGGGG - Intergenic
939544937 2:143540866-143540888 CTTCCCAAGGAGAATCTTTGTGG + Intronic
939747980 2:146001819-146001841 CTTCCCATCGACAATGTATGAGG - Intergenic
942377707 2:175354251-175354273 GGGCCCAAGGAGAATGTGAGAGG - Intergenic
942989328 2:182180574-182180596 CTTCTCATGGAGTATCTTAGTGG + Intronic
944373849 2:199016692-199016714 CTTCCTATGGAGAATGCGCAGGG + Intergenic
947169654 2:227298543-227298565 TTTCCCCTGGAGCATGTGATGGG - Intronic
948231196 2:236350834-236350856 CTTCCCCTGGGGAAGCTGAGGGG + Intronic
948679140 2:239620485-239620507 TGTCACATGGAGAATGAGAGCGG - Intergenic
1169652474 20:7884912-7884934 CATCCCATGGACATTGTGGGTGG - Intronic
1169802592 20:9525892-9525914 CTTCCTAGGCAGAATGGGAGAGG - Intronic
1172850103 20:37955617-37955639 GTTTCCCTGGAGAATTTGAGGGG + Intergenic
1175133716 20:56807896-56807918 CATCCCGTGGAGAAGGTAAGAGG - Intergenic
1176987441 21:15454339-15454361 CTTCTCATGGAGTATGTTACTGG + Intergenic
1177068868 21:16476460-16476482 TTTCCCTTGCAGAATGTCAGAGG - Intergenic
1177511195 21:22090506-22090528 CTTCTCATGGAGTATCTTAGCGG + Intergenic
1178423178 21:32458212-32458234 GTTCCCCAGGAGAATGAGAGGGG + Intronic
1178937434 21:36875421-36875443 CTTCCAGAGGAGAGTGTGAGTGG - Intronic
1180785186 22:18543256-18543278 CTTCCCATGGAGGCGGTGAGGGG + Intergenic
1181128769 22:20717297-20717319 CTTCCCATGGAGGCGGTGGGGGG + Intronic
1181242089 22:21482609-21482631 CTTCCCATGGAGGCGGTGAGGGG + Intergenic
1182457858 22:30463353-30463375 CCTCCCATGGCCAAAGTGAGGGG - Intronic
1183090533 22:35519086-35519108 CTTCCCACAGAGAATGAGAGAGG - Intergenic
1184287228 22:43478509-43478531 CTTCCCATGGGGAAAGCCAGAGG + Intronic
1184769581 22:46589479-46589501 CTGCCCAGGGAGAAGGTGAGTGG + Intronic
949119752 3:372095-372117 CTTCTCATGGAGTATCTTAGTGG + Intronic
951436121 3:22666790-22666812 ATTCCCATGGGAAATGTCAGTGG + Intergenic
952607811 3:35171444-35171466 CTTCTCATGGAGTATATTAGTGG + Intergenic
952646291 3:35663305-35663327 ATTTCCAAGGAGAATGTTAGGGG - Intronic
954522065 3:51237358-51237380 CTACCCATGGGGAATGCTAGAGG + Intronic
955066864 3:55540954-55540976 CTCCCTATGAAGAAAGTGAGAGG + Intronic
955595502 3:60586004-60586026 CTTCTCATGGAGAATCTCATTGG + Intronic
955831959 3:63014530-63014552 CTTCTCATGGAGTATCTTAGCGG + Intergenic
956147523 3:66206120-66206142 CTTCCCATGGTGCAAGAGAGAGG + Intronic
956256625 3:67290202-67290224 CATCCCATGGAGAATATGGATGG - Intergenic
956313552 3:67908897-67908919 CTTCCCATGGAGAGAGGGATGGG - Intergenic
956595752 3:70965282-70965304 CTGCCCATGCTGAATGTGAATGG - Intronic
956701761 3:71965161-71965183 CTCCCCATGGAGGATGGAAGGGG - Intergenic
957233146 3:77547114-77547136 CTTTCCATAGAGACTCTGAGAGG - Intronic
958817360 3:98930313-98930335 CTTCTCATGGAGTATCTGACTGG - Intergenic
959366590 3:105467451-105467473 TCACTCATGGAGAATGTGAGAGG + Intronic
960737149 3:120793263-120793285 CTTCCTATGGTGAACATGAGTGG + Intergenic
961388571 3:126538336-126538358 CATCCCAGGCAGAAAGTGAGTGG + Intronic
961404958 3:126672321-126672343 ATTCCCAGGGTGAATGTGAATGG + Intergenic
962309776 3:134317204-134317226 TTTCTCATGGAGGAAGTGAGAGG - Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
962947448 3:140184892-140184914 CTTCCCATGGTGTATATGTGCGG - Intronic
962982846 3:140506454-140506476 CATCCCAAAGAGAAGGTGAGGGG - Intronic
963620776 3:147602806-147602828 CTTGCACAGGAGAATGTGAGAGG + Intergenic
963703203 3:148652764-148652786 TTTACAATGGAGAATGTGACAGG - Intergenic
965009026 3:163062689-163062711 CTTCCCAGGGAAACAGTGAGTGG + Intergenic
965113712 3:164459868-164459890 GTTCCCATAGAGTATGTGACTGG + Intergenic
965590810 3:170358261-170358283 CTTCCCAGGGAGAGGGTGCGCGG + Intronic
965768058 3:172152553-172152575 CTTCCCATGGAGAATGTGAGTGG - Intronic
968232243 3:197010909-197010931 CTTCCCCTGGGGAATGTGGGTGG + Intronic
969074733 4:4568934-4568956 CTTCTGATGGACACTGTGAGAGG + Intergenic
970503180 4:16699560-16699582 ATTCACATGGAGAATATGTGAGG + Intronic
970584727 4:17504179-17504201 CTTCCCCTGGAGGACGTGAGGGG - Intronic
971516811 4:27497466-27497488 CTTCTCATGGAGTATCTTAGTGG - Intergenic
973854604 4:54998337-54998359 CTTTCCATGGAGTATTTGATAGG - Intergenic
975570861 4:75816358-75816380 CTTCCTATGTAGAATAAGAGTGG + Intergenic
977462140 4:97338495-97338517 CTTCTCGTGGAGTATCTGAGTGG - Intronic
978973260 4:114836605-114836627 CTTCTCATGGAGTATCTTAGTGG + Intronic
979022273 4:115518542-115518564 CTTCCCTTGGAAAATGTAAGTGG + Intergenic
980184808 4:129447715-129447737 CTTCTCATGGAGTATCTTAGTGG - Intergenic
980787236 4:137571574-137571596 CTTCTCATGGAGTATCTTAGTGG + Intergenic
982528399 4:156507247-156507269 CTTCTCATGGAGCATCTTAGTGG - Intergenic
982799011 4:159679689-159679711 CTTCTCATTGAGAATCTGATAGG - Intergenic
983036694 4:162875467-162875489 CTTGCCAAGGAGAATGGGAAAGG + Intergenic
984206527 4:176793000-176793022 CTTCCGAGGGAGAGTGAGAGGGG - Intergenic
984841665 4:184073769-184073791 GATCCCCTGGAGAATGTGTGTGG - Intergenic
989348044 5:40452401-40452423 CTTCTCATGGAGTATCTTAGGGG + Intergenic
989649993 5:43677227-43677249 ATTTTCAAGGAGAATGTGAGGGG + Intronic
990940564 5:61199308-61199330 CTTCCCATGGAGTATCTTAATGG + Intergenic
991592334 5:68266029-68266051 CTGACCAAGGAGAAAGTGAGTGG - Intronic
993587159 5:89745702-89745724 CTTCTCATGGAGTATCTTAGTGG + Intergenic
993869257 5:93232025-93232047 CTTTCCAGGGAGGATGTTAGTGG - Intergenic
994220196 5:97186627-97186649 CTTCCCTTTGAGAGTGTGAGAGG - Intergenic
994642133 5:102422777-102422799 CTTCTCATGGAGTATCTTAGTGG - Intronic
994751121 5:103738143-103738165 CTTCTCATGCAGAATGTGATTGG + Intergenic
995959994 5:117828428-117828450 CTTCTCATGGAGTATCTTAGTGG + Intergenic
996592440 5:125162344-125162366 CTTCTCATGGAGTATCTTAGTGG - Intergenic
996965686 5:129305199-129305221 CTTCTCATGGAGTATCTTAGTGG + Intergenic
997067685 5:130581256-130581278 CTTCTCATGGAGTATCTTAGTGG - Intergenic
998755457 5:145374469-145374491 CTTCTCATGGAGTATCTTAGTGG + Intergenic
1004020448 6:11771462-11771484 CTCCCCATGGAGCCTGGGAGAGG - Intronic
1004259384 6:14095063-14095085 CTCCCCATGGAGCATGTCAGAGG - Intergenic
1004760281 6:18658048-18658070 CTTCTCATGAAGAATCTTAGTGG - Intergenic
1004780727 6:18905661-18905683 CTTCCCAGGGAGAAAGCTAGAGG - Intergenic
1004991031 6:21138980-21139002 CTTTCAAGAGAGAATGTGAGAGG + Intronic
1005413274 6:25573490-25573512 CTTCCCCTGGAGACTGAGGGAGG + Intronic
1006028662 6:31163283-31163305 CTTTCCAGGGAGAATGTGCTTGG + Exonic
1010943437 6:81947221-81947243 CTCCTCATTTAGAATGTGAGCGG - Intergenic
1012258996 6:97065866-97065888 CTTCCCAGGGAGACAGTGTGAGG + Intronic
1014057877 6:117037544-117037566 CTTTCCTTTGAGACTGTGAGGGG - Intergenic
1014064831 6:117112196-117112218 CTTCCCATGGAGTATCATAGTGG - Intergenic
1014367379 6:120561693-120561715 CTTCCCATGGAGTATCTTAATGG + Intergenic
1015659966 6:135564731-135564753 CTTCTCATGGAGTATCTTAGTGG + Intergenic
1019541518 7:1553792-1553814 CCTCCCATGTATAAAGTGAGGGG + Intronic
1020525441 7:9252480-9252502 CTTCTCATGGAGTATCTTAGTGG - Intergenic
1021811312 7:24404261-24404283 GTTCCCCTGGAGAATGTGAGTGG - Intergenic
1022939216 7:35215992-35216014 GTTGCAAAGGAGAATGTGAGGGG - Intronic
1023779171 7:43640122-43640144 CTTCCCGTGGGGGAAGTGAGTGG + Intronic
1024370375 7:48576398-48576420 CTTCACATGGAGAATCTGGTAGG - Intronic
1025525794 7:61808420-61808442 CTGCTTATGGAGAATCTGAGAGG - Intergenic
1025549185 7:62221153-62221175 CTGCTTATGGAGAATCTGAGAGG - Intergenic
1027815328 7:82961414-82961436 CTCCCCATGGGGAATGTTAGCGG + Intronic
1028442678 7:90881589-90881611 CTTCTCATGGAGTATCTTAGTGG - Intronic
1028779359 7:94718578-94718600 CTTCTCATGGAGTATCTTAGTGG + Intergenic
1028991888 7:97057844-97057866 CTTCTCATGGAGTATCTCAGTGG - Intergenic
1029877867 7:103772882-103772904 CTTCCAATTGAGATTGTGAAGGG + Intronic
1030128182 7:106174707-106174729 CTTCTCATGGAAAATGGCAGTGG - Intergenic
1030759458 7:113332315-113332337 CTTCTCATGGAGCATCTTAGTGG - Intergenic
1032846186 7:135753922-135753944 ATTCTCATGTAGAAAGTGAGAGG + Intergenic
1033956567 7:146856736-146856758 TGTCCCATGAAGAATGTAAGTGG + Intronic
1035160311 7:156945089-156945111 CTTCCCATGGACAATGCGGGAGG - Intergenic
1035998142 8:4572606-4572628 CTTCTCAAGGAGTATCTGAGCGG + Intronic
1038073855 8:24047672-24047694 CTTCTCATGGAGCATCTTAGTGG - Intergenic
1039242418 8:35571387-35571409 CTTCTCATGTAGCAAGTGAGAGG + Intronic
1039265325 8:35817352-35817374 CTTCTCATGGAGTATCTTAGTGG - Intergenic
1041446151 8:57953243-57953265 CTTCCCAAGGACACTATGAGGGG - Intergenic
1041586397 8:59525188-59525210 GTTGCCATGCAGAATGTGAGTGG - Intergenic
1043547789 8:81334805-81334827 TTGCTCATGCAGAATGTGAGAGG - Intergenic
1044100562 8:88131787-88131809 ATTCCAATGAAGAAAGTGAGAGG - Intronic
1044377962 8:91498840-91498862 CTTCTCATGGAGTATCTGAGTGG + Intergenic
1044477263 8:92642571-92642593 CATCCTATCGAGAATGTGGGAGG - Intergenic
1045385460 8:101667586-101667608 ATGCCCATGGAGAAGGAGAGGGG - Exonic
1049058011 8:140254312-140254334 CTCCCCAGGGAGGATGTGACTGG - Intronic
1051520379 9:17980880-17980902 CTGCCCATGCAGAAGGTGAAGGG + Intergenic
1052271120 9:26628955-26628977 TTTTCCATGGAGAATGATAGTGG + Intergenic
1052420965 9:28242626-28242648 CTTCTCATGGAGTATCTTAGTGG - Intronic
1054783745 9:69190372-69190394 CTTCCCCTGAAGTATGTGATTGG + Intronic
1054884750 9:70184370-70184392 CTTCTCATGGAGTATCTTAGTGG + Intronic
1055276090 9:74618403-74618425 CTTCTCATGAGGTATGTGAGTGG - Intronic
1056379404 9:86043609-86043631 CTTCCCAGGGATAATGTTCGTGG - Intronic
1056548906 9:87635487-87635509 CTTCCCAGGAAGAAGGTGAGGGG - Intronic
1060320940 9:122560816-122560838 CTTCTCATGGAGTATCTTAGTGG + Intergenic
1060385334 9:123221284-123221306 CCACCCGTGGAGGATGTGAGTGG - Intronic
1060929574 9:127480243-127480265 CTTCCCATCTATAAAGTGAGTGG + Intronic
1061485704 9:130919568-130919590 CCTCACATGGAGAACGTCAGAGG - Intronic
1062182828 9:135199968-135199990 CTTCCTCTGGAGAATCTGAGTGG - Intergenic
1186148852 X:6653208-6653230 CTTCCCATGGAAACACTGAGTGG + Intergenic
1186574092 X:10746991-10747013 GTTGCTATGGAGAAGGTGAGAGG + Intronic
1187269638 X:17768198-17768220 CTTCCAGGGGAAAATGTGAGGGG + Intergenic
1188092335 X:25978414-25978436 CTTCTCATGGAGTATCTTAGTGG - Intergenic
1188884514 X:35532723-35532745 CTTCTCATGGAGTATCTTAGTGG - Intergenic
1188915281 X:35903339-35903361 CTTCTCATGGAGTATCTTAGTGG + Intergenic
1189939929 X:46111283-46111305 CTTCTCATGGAGTATCTTAGTGG + Intergenic
1190924412 X:54889135-54889157 CTTCTCATGGAGTATCTTAGTGG - Intergenic
1191005188 X:55703398-55703420 CTTCAGATGGAGACTCTGAGTGG - Intergenic
1191776123 X:64815405-64815427 CTTCTCATGGAGTATCTTAGTGG - Intergenic
1192007486 X:67232729-67232751 AGTCCCAGGAAGAATGTGAGGGG + Intergenic
1192303141 X:69927639-69927661 CTTCTCATGGAGTATCTTAGTGG + Intronic
1192437793 X:71153582-71153604 CTCCCCATCGAGAAGGGGAGGGG - Intronic
1192930102 X:75797963-75797985 CTTCTCATGGAGTATCTTAGTGG + Intergenic
1194286960 X:92021673-92021695 CTTCTCATGGAGTATCTTAGTGG - Intronic
1194405877 X:93495122-93495144 CTTCCCATGGAGTATCTTACTGG - Intergenic
1194708308 X:97201819-97201841 CTTCTCATGGAGTATCTTAGTGG - Intronic
1195458800 X:105100419-105100441 CTTCTCAGGGATAAAGTGAGAGG + Intronic
1195686199 X:107588565-107588587 CTTCTCATGGAGTATCTTAGTGG + Intronic
1196054637 X:111341527-111341549 CTTCTCATGGAGTATCTTAGTGG - Intronic
1196559066 X:117124327-117124349 CTTCTCATGGAGTATCTTAGTGG - Intergenic
1196607136 X:117670187-117670209 CTTCTCATGGAGTATCTTAGTGG + Intergenic
1196988628 X:121302799-121302821 ATTACCATGGAGAATTTCAGTGG + Intergenic
1198166081 X:134058665-134058687 CTTCCTATGTTGAATGGGAGTGG + Intergenic
1198362680 X:135911201-135911223 CTCCTCATGGACACTGTGAGTGG - Exonic
1199723124 X:150557514-150557536 CTTGCCTTGGAGCAGGTGAGAGG - Intergenic
1200604503 Y:5246233-5246255 CTTCTCATGGAGTATCTTAGTGG - Intronic