ID: 965768634

View in Genome Browser
Species Human (GRCh38)
Location 3:172157588-172157610
Sequence ATTTAGAGATGGAGAACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 528
Summary {0: 1, 1: 0, 2: 2, 3: 53, 4: 472}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965768634_965768636 13 Left 965768634 3:172157588-172157610 CCATCTGTTCTCCATCTCTAAAT 0: 1
1: 0
2: 2
3: 53
4: 472
Right 965768636 3:172157624-172157646 TCATGTAAATGAAATCTCACAGG 0: 1
1: 2
2: 16
3: 98
4: 471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965768634 Original CRISPR ATTTAGAGATGGAGAACAGA TGG (reversed) Intronic
904629281 1:31829302-31829324 TTCTAGAGAGGGAGAACAAAGGG + Intergenic
905243584 1:36596931-36596953 ATTCAGTGGTGGAGAACTGAGGG + Intergenic
905425580 1:37881235-37881257 ATTTACAGATGGAGAAACCAAGG - Intronic
905486574 1:38301545-38301567 ATTGATAGATGGAGAAATGAGGG + Intergenic
906073196 1:43032645-43032667 TTTTAGAGATGGAGTATTGACGG + Intergenic
906470218 1:46123292-46123314 ATTTAAAGATGGAGGTGAGACGG + Intronic
907307716 1:53522612-53522634 TTTTAGAGATGGAGAAACTAAGG - Intronic
908100750 1:60788570-60788592 ATTTGGGGAGTGAGAACAGAAGG - Intergenic
908579116 1:65495267-65495289 ATGTACAGATGGCCAACAGATGG + Intronic
911007236 1:93239816-93239838 ATTGAGAGATGTACTACAGAAGG + Exonic
911356885 1:96833587-96833609 ATTTAGAGATTGATGAAAGAGGG - Intergenic
911436569 1:97867121-97867143 CATTAGACATGGATAACAGAGGG + Intronic
911715428 1:101127306-101127328 ATTTAAAGATGCACAACTGAAGG + Intergenic
911866400 1:103029518-103029540 ATTTAGAGTTAGAGAAAAAAGGG + Intronic
912111698 1:106349900-106349922 ATTTTGAAATGGACAAAAGATGG + Intergenic
912198707 1:107430653-107430675 AATGAGGGATGGAGAAAAGACGG - Intronic
912477640 1:109950333-109950355 ATTTAAAAATAGATAACAGATGG + Intergenic
912618911 1:111135607-111135629 ATTTAGACATGTAAAACAAAGGG - Intronic
914429476 1:147607750-147607772 ATTAAGATATGGAAAACTGAAGG + Intronic
915627785 1:157126366-157126388 ATTTAGAGTTGCAGAGGAGAAGG - Intronic
916330437 1:163610206-163610228 ATTTAGGGATGGAAGACGGAAGG - Intergenic
917154252 1:171979075-171979097 ATTTAGAAGTGTAGAAGAGAAGG + Intronic
917216671 1:172686045-172686067 AAATAGAGGTAGAGAACAGAAGG - Intergenic
918121735 1:181546495-181546517 AATTTGAGATAGAAAACAGAAGG - Intronic
918442163 1:184578407-184578429 AATTAGAAATGGAGAAAACAAGG + Intronic
920277134 1:204814724-204814746 ATTTTCAGAGGGAGCACAGAGGG + Intergenic
920331312 1:205210856-205210878 GTTTAGAGATGGAGCAGAGGCGG - Intronic
920448131 1:206035639-206035661 AGTTAGGGATCTAGAACAGATGG - Intergenic
920598928 1:207302742-207302764 ATTTAGAAATGGGCAACAGTAGG + Intergenic
920762372 1:208797734-208797756 ATCTAGAGATGTAGAACTTAAGG - Intergenic
921273706 1:213495633-213495655 TTTTACAGATGGGGAGCAGAAGG + Intergenic
921508136 1:215999374-215999396 ACTTAGATATGGGGAAAAGAGGG + Intronic
921543386 1:216446383-216446405 AATTAGAGATGGTAAGCAGATGG - Intergenic
921834521 1:219763979-219764001 AGTGAGAGAGGGAGAATAGAAGG + Intronic
921877262 1:220212278-220212300 AATTAGTAATGGAGAACAGAGGG + Intronic
922433978 1:225584902-225584924 ATTTAGAGATGGTGATTAGGTGG - Intronic
922631206 1:227113710-227113732 ATTTAGAAATAGAAAACATAAGG + Intronic
923350770 1:233103464-233103486 TCTTAGAGATAGAGAATAGAAGG - Intronic
923732699 1:236568032-236568054 ATTGATTGATGGAGAGCAGAGGG - Intronic
923979494 1:239305329-239305351 ATCAACAGATGGAGAAAAGAAGG + Intergenic
924116971 1:240757372-240757394 ATTTAAAGATGCAAAGCAGAAGG - Intergenic
1062891363 10:1063102-1063124 ACTGAAAGATGGAGAAAAGAAGG + Intronic
1063094956 10:2900839-2900861 ACTTGGAGATGGTGAACAAAAGG - Intergenic
1063227944 10:4033860-4033882 ATTTAGAGATGGAGCACGGATGG + Intergenic
1063708509 10:8454339-8454361 ACTCACAGATGGAGAACAGCAGG - Intergenic
1064153267 10:12883123-12883145 TTTAAGAGATGAAGAACTGAAGG - Intergenic
1064298307 10:14098968-14098990 GTTTTCAGATGAAGAACAGAAGG - Intronic
1064466758 10:15590793-15590815 ATTTAGTGATGGGATACAGATGG - Intronic
1064480524 10:15736060-15736082 AGTTAGAGATGGAGGAAAGGAGG + Intergenic
1064833072 10:19493191-19493213 TTATAGAGATGGAGAGGAGAAGG - Intronic
1065067498 10:21985547-21985569 ATATAGAGATGGAAAGCAGGTGG - Intronic
1065264225 10:23958151-23958173 ATTAAGAGATGCAAAATAGAGGG + Intronic
1065833657 10:29637917-29637939 TTATAGAAATGGAGAAGAGATGG + Intronic
1066182130 10:32973348-32973370 ATTTAGATATGCAGAAAAAAAGG - Intronic
1066495579 10:35938808-35938830 ATGTAGACATGCAGAACAGAGGG + Intergenic
1067150368 10:43728010-43728032 AATCAGAAATGGGGAACAGAAGG + Intergenic
1067405268 10:46017069-46017091 ATTTAGAGATGAAGACTAAAAGG + Intronic
1068153507 10:53165913-53165935 ATTAAGAGATAGAGAAAATATGG + Intergenic
1069694893 10:70379474-70379496 AATTGGAGATGGAGAAAGGAGGG - Intronic
1070341662 10:75503804-75503826 CCTGAGAGAGGGAGAACAGATGG + Intronic
1072121237 10:92407126-92407148 ACTTAGATATGGAGGAGAGAAGG + Intergenic
1072304521 10:94094614-94094636 GATTAGACATGGAGACCAGAGGG + Intronic
1072362625 10:94674581-94674603 AGTTAGAGATGCAGGGCAGAAGG - Intergenic
1072611986 10:97023609-97023631 ACTTAGAGATGGACAAGACATGG + Intronic
1072940344 10:99758190-99758212 AAATAGTGATGGAGAACAGCTGG - Intergenic
1074599026 10:114894990-114895012 ATTAGGAAATGGAGAACAGCAGG - Intronic
1075188090 10:120281519-120281541 ATTTATAAGTGGAGAACACATGG + Intergenic
1076077358 10:127545075-127545097 ACTGAGAGATGGAGAGGAGAGGG - Intergenic
1077470658 11:2758848-2758870 CTGTAGGGATGGAGATCAGATGG + Intronic
1077925052 11:6673359-6673381 ATTTTTAAATGGAGAAAAGAGGG - Intergenic
1078624416 11:12940867-12940889 CTTTAGAGATGGAGGATGGAAGG + Intronic
1078861260 11:15249362-15249384 TTTTAGAGAAGGAGAAGATAGGG + Intergenic
1079401785 11:20111766-20111788 ATTTATAGATGGAGAACCCAAGG - Intronic
1079549436 11:21675394-21675416 ATTTAGAGATGAACTACAGGAGG + Intergenic
1079789578 11:24719290-24719312 AATTAGAATTGGAGAAGAGATGG + Intronic
1079961184 11:26925931-26925953 ATGAAGACATGGAGAAAAGAAGG - Intergenic
1080010674 11:27455862-27455884 TTTTAGAGATGGAGAAACCATGG - Intronic
1080368518 11:31608095-31608117 ATAATGAGATGGAGAACGGAGGG + Intronic
1080963335 11:37185710-37185732 ATTCACAGATGTAGAACACAAGG + Intergenic
1081219552 11:40443162-40443184 TTTTATAAATGGAGAAAAGAAGG + Intronic
1081341136 11:41929128-41929150 ATTGAGGGATCGAGAATAGAAGG - Intergenic
1081561718 11:44223584-44223606 TTATAGAAATGGAGGACAGATGG + Intronic
1082690340 11:56294513-56294535 ATTGAGAGAGAGAGAATAGAAGG - Intergenic
1085374578 11:76047540-76047562 ATTTAGAGAAGGACAAGGGAAGG + Intronic
1086092166 11:83015715-83015737 ATTTAGAGATTGAGGGAAGAAGG + Intronic
1086743390 11:90395765-90395787 CTTTAGGGATGGAGAACAGCTGG + Intergenic
1088159517 11:106853241-106853263 ATTTTCAGAAGGAGAAGAGATGG - Intronic
1088245843 11:107817336-107817358 CATTAGAGATGGAGATAAGAGGG + Intronic
1088282490 11:108149871-108149893 ATTTTGAGATGGCTATCAGAGGG + Intergenic
1088295789 11:108292519-108292541 AATTAGAGATGCTGAACAAAAGG + Intronic
1088952562 11:114586424-114586446 ATTTTTAAATGGAGAGCAGAAGG - Intronic
1089223550 11:116896161-116896183 ATTTAGTGATGGAGTATAAATGG - Intronic
1089501428 11:118933880-118933902 CTTGACAGATGGAGAACACAAGG - Intronic
1089829340 11:121311705-121311727 ATTTACAGATGGAGAAACCAGGG - Intergenic
1090443181 11:126741180-126741202 AAGTGGAAATGGAGAACAGAAGG - Intronic
1090846728 11:130535832-130535854 ATTTACAGATAGGAAACAGAAGG - Intergenic
1092032107 12:5294854-5294876 ATTTGGAGATGAAGGACAGATGG - Intergenic
1092292199 12:7167876-7167898 TCTAAGAGATGGAGAAGAGATGG + Intergenic
1093744224 12:22721542-22721564 ATTGAGTGAGGGAGAAGAGATGG + Intergenic
1093833268 12:23792900-23792922 ACTTAGTGACAGAGAACAGAAGG - Intronic
1094718654 12:33038740-33038762 CTTTGGAGATGGAGAAAGGAAGG - Intergenic
1095568766 12:43657602-43657624 ATTTATAAATGGAGAAAAGGAGG - Intergenic
1095852346 12:46824715-46824737 ATATAGAGATGGAAAACAAGTGG + Intronic
1096795686 12:54076218-54076240 ATTCAGGGAGGGAGAACTGAGGG - Intergenic
1097035372 12:56120397-56120419 CTTTAGAGATGGAGAATCTAAGG - Intronic
1097347638 12:58512106-58512128 ATTTAGAGATGCACAGCACATGG + Intergenic
1097519758 12:60652289-60652311 ACTTTAAAATGGAGAACAGAGGG + Intergenic
1099598119 12:84694719-84694741 ATTGAGAGAGGGAGAAAAGTTGG - Intergenic
1099610349 12:84859912-84859934 CTTTAAAGATGGAGAATGGATGG + Exonic
1100246419 12:92762326-92762348 ATTTGGAGGTGGAGGAGAGAGGG + Intronic
1100316040 12:93445341-93445363 AATCAGAGATGTAGATCAGAGGG + Intergenic
1100523860 12:95402112-95402134 CTCAAGAGAAGGAGAACAGATGG + Intergenic
1100848341 12:98683083-98683105 ATTTTCAAAGGGAGAACAGAGGG - Intronic
1101000514 12:100353046-100353068 ATTTTGAGATGGGGAGCACATGG + Intergenic
1101642470 12:106597569-106597591 TTTTACAGATGAAGAACCGAAGG + Intronic
1104070864 12:125344365-125344387 ATTTAGAAATTAAGAACAGCAGG + Intronic
1104760376 12:131294500-131294522 ATGGAGAGATGGACAACAGATGG + Intergenic
1104760388 12:131294636-131294658 ATGGAGAGATGGACAACAGACGG + Intergenic
1104819391 12:131666147-131666169 ATGGAGAGATGGACAACAGATGG - Intergenic
1105257587 13:18754456-18754478 ATTTAATCATGGAGAACAGTGGG - Intergenic
1106209212 13:27625351-27625373 AGCTAGTGATGGAGAAGAGAAGG + Intronic
1106300957 13:28465045-28465067 AATTAGAGAAAGAGAACAGATGG + Intronic
1106777465 13:33022137-33022159 ATTTTGAGTTGAAGAAAAGAAGG + Intronic
1107110624 13:36693674-36693696 AATTAGATTTGGAGAACAGAAGG + Intronic
1107204279 13:37763206-37763228 ATTTAGAGATGGAGAAGATGAGG + Intronic
1107258839 13:38466127-38466149 ATTTAGAACTCGAGAACAGATGG + Intergenic
1107654468 13:42577182-42577204 GTTTAAAGGTGGAGAAAAGAAGG + Intronic
1107950179 13:45454357-45454379 AGTTGGAAATGGAGAACAGGAGG + Intergenic
1108104718 13:46996747-46996769 ACTGACAGATGGATAACAGAGGG + Intergenic
1108625940 13:52228831-52228853 GGTTACAGATGGAGGACAGAGGG + Intergenic
1108660126 13:52577649-52577671 GGTTACAGATGGAGGACAGAGGG - Intergenic
1108986498 13:56595892-56595914 TTTGAGAGTTGCAGAACAGATGG - Intergenic
1110254486 13:73417536-73417558 GTTTACAGATGGAGAAATGAAGG - Intergenic
1110280307 13:73685296-73685318 TTATAGAGATGGAGAAAGGATGG - Intergenic
1111149952 13:84238579-84238601 AAGAAGAGATGCAGAACAGATGG + Intergenic
1111285343 13:86084036-86084058 CCATAGAGATGGAAAACAGATGG + Intergenic
1112124848 13:96453790-96453812 ATTCAGAGTTGGCGAAAAGAAGG - Intronic
1112215216 13:97423485-97423507 ATTTAGAACTGGAGTCCAGAGGG - Intergenic
1112247029 13:97744713-97744735 CTTTTGTGATGCAGAACAGATGG - Intergenic
1112358970 13:98699293-98699315 ATGTGGAGAAGGGGAACAGAGGG - Intronic
1113131097 13:107037661-107037683 ATTGAAAGATGTAGAACAAATGG - Intergenic
1113859658 13:113472999-113473021 ATAGAGAGATGGGGGACAGAGGG - Intronic
1116497933 14:45585575-45585597 AGTTACAGAAGGAGAAGAGATGG - Intergenic
1118716937 14:68566769-68566791 ATTTGGTGTTGGAGAACACAAGG - Intronic
1118829212 14:69413864-69413886 ATATATAGATGGAGAATCGAAGG - Intronic
1119206720 14:72799883-72799905 GTTTAGAGATGAAGGAGAGATGG + Intronic
1119731082 14:76951440-76951462 ATTTTCAGTTGGAAAACAGATGG + Intergenic
1120453233 14:84698180-84698202 ATTTAGTGATTTAGAACATAGGG - Intergenic
1120599781 14:86488495-86488517 TTTTACAGAGGGAGAAAAGAAGG - Intergenic
1120860095 14:89247276-89247298 AGCTAGGGATGGAGAAGAGAGGG - Intronic
1121171882 14:91861497-91861519 ACTTTGGGATGGAGAACAGACGG + Intronic
1121741733 14:96257580-96257602 ATTGAGAGTTTGAGAAGAGATGG - Intronic
1122882940 14:104698146-104698168 CTTTCCAGATGGAGAGCAGAGGG + Intronic
1124116678 15:26849868-26849890 ATTTAGAGATGGAAGACCAAAGG + Intronic
1125116027 15:36092851-36092873 TTTTAGAGATGGAGAAATCATGG - Intergenic
1125160565 15:36639022-36639044 TTTTAGAGATGGGGAAATGAAGG - Intronic
1125478012 15:40060674-40060696 ATTTAGAGATCAAGAAGAGGAGG + Intergenic
1125649466 15:41302941-41302963 ATTTAAAGATGCAAAGCAGAAGG + Intergenic
1126222698 15:46232677-46232699 GCTTTGAGATGGAAAACAGAAGG - Intergenic
1127450316 15:59110060-59110082 AGTTAGAGAAGAAGAAAAGAAGG + Intronic
1128850956 15:70955157-70955179 ATTCATAGATGTAGAACACATGG + Intronic
1129136006 15:73552251-73552273 AATTATAGATGGAGAAGGGAGGG - Intronic
1129252982 15:74318883-74318905 ATCCAGAGAGGGAGGACAGAAGG + Intronic
1129890754 15:79070206-79070228 CTTTGGAGATGGAGAGCACATGG + Intronic
1130109490 15:80953042-80953064 AGTCAGAGATGGATAAGAGAAGG + Intronic
1130375061 15:83321820-83321842 TTTTACAGATGGAGAACTGGGGG + Intergenic
1130911006 15:88270713-88270735 ATATAGAGATGGGTAACAGTGGG - Intergenic
1131653567 15:94429620-94429642 ATTTAGAGTTTGAGAAGATAGGG - Intronic
1131835096 15:96382622-96382644 ATTTATAGATGAAGAAAATAAGG - Intergenic
1131996680 15:98139890-98139912 ATTTGGAGTTGGAAAAAAGATGG - Intergenic
1132275570 15:100560435-100560457 ATTTGGAGATGGACAATATATGG + Intronic
1135019650 16:18952776-18952798 ATTTAGAAAGGGAGAAAAGATGG - Intergenic
1135840277 16:25869887-25869909 TTTTAGAGATGAAGAAAATAAGG + Intronic
1136003784 16:27314708-27314730 ATTGAGAGATGGAGAGCAGCTGG - Intronic
1136987731 16:35126524-35126546 GGTTGGAGATGGAGGACAGATGG + Intergenic
1137066962 16:35856845-35856867 ATTCAGAGACTGAGAACAAAGGG + Intergenic
1137353996 16:47740619-47740641 AATTAGAGATCAATAACAGAAGG + Intergenic
1137457485 16:48629160-48629182 ATTTTGAGATGAAGAAAATAAGG + Intergenic
1137801243 16:51263956-51263978 ATTCAGAGATGAACAACAGTGGG - Intergenic
1137964645 16:52918319-52918341 CCTCAAAGATGGAGAACAGATGG - Intergenic
1139346110 16:66304971-66304993 ATTTACAGATGAAGAAATGAGGG - Intergenic
1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG + Intergenic
1141348496 16:83270978-83271000 AATGAGAGAGGGAGAAAAGAAGG - Intronic
1141530436 16:84642930-84642952 ATTTAGAGATGGAGAAACTGAGG + Intergenic
1142754842 17:2010109-2010131 ATTAACAGTTGAAGAACAGAGGG - Intronic
1143336729 17:6177040-6177062 ATTCAGTGATGGAGATCTGAGGG + Intergenic
1143903390 17:10191256-10191278 GTTTAGAGGTTGGGAACAGAAGG + Intronic
1144333853 17:14251049-14251071 ATTTAGAGATATATACCAGAAGG - Intergenic
1145103309 17:20094508-20094530 ATATAGAGATGAAAAACAGCAGG - Intronic
1149053745 17:52337735-52337757 TTTTATAGAAGGAGAACAGAGGG + Intergenic
1149368848 17:55972654-55972676 AAAAAGAGTTGGAGAACAGAAGG + Intergenic
1149959339 17:61090551-61090573 TTTTAGAGATTAAGAACATAGGG + Intronic
1149964190 17:61145517-61145539 CTTTGGAGATGAAAAACAGACGG + Intronic
1150960651 17:69908744-69908766 ACTTAGAGATGAAGAAATGAAGG + Intergenic
1152380444 17:79939652-79939674 ATTTAGAGATGGACAGAAAAGGG - Exonic
1152502367 17:80720988-80721010 AATTAGAGATGGAAAACAAGGGG - Intronic
1153370485 18:4309898-4309920 CTCTAGAGGTGGAGAAGAGATGG - Intronic
1153391642 18:4568572-4568594 ATTTCCACATGGAGAAGAGAGGG - Intergenic
1153928644 18:9858784-9858806 ATTTTGAGAAGCAGAAAAGATGG + Intronic
1154054516 18:11000245-11000267 ATTTAGAGGTGGGGCACAGTGGG - Intronic
1155435020 18:25803504-25803526 AGTTGGATATTGAGAACAGAAGG - Intergenic
1156284518 18:35678225-35678247 ACTTAGAAATGGAGAAAATAGGG - Intronic
1156518716 18:37703139-37703161 ATTTAGATATGCAGAAAAAAAGG - Intergenic
1157224905 18:45853858-45853880 ATTTAAAGAAGGAAAAGAGAGGG - Intronic
1157437552 18:47683643-47683665 ATCTAGAGAGAGACAACAGAAGG - Intergenic
1157461645 18:47902282-47902304 ATTTAGCGATAGAGAACAATGGG - Intronic
1158032396 18:52982165-52982187 ATTTACAGAGGGAGGATAGAGGG + Intronic
1158251093 18:55488441-55488463 ATTAGGAGATGGAGAAGAGAGGG + Intronic
1158263697 18:55636875-55636897 ATTTTGAGATGGAAAAAAGGAGG - Intronic
1158387846 18:57014948-57014970 CAGTAGAGATGGAGAACAGCTGG - Intronic
1159617964 18:70603480-70603502 GTTTAGAGATAGAGAAAAAAAGG - Intergenic
1159621999 18:70649768-70649790 ATTTACAGATAGAGAAGCGAAGG + Intronic
1160905355 19:1449486-1449508 ATTGAGAGACAGAGAACAGAGGG + Intronic
1161329203 19:3678369-3678391 ATGGAGGGATGGAGAATAGATGG + Intronic
1161596883 19:5155041-5155063 CTTTCGAGATGGAGAAAAGAGGG - Intergenic
1163350620 19:16774396-16774418 ATTTAGAGATGGGGGATAGATGG - Intronic
1164822579 19:31261592-31261614 ACTTTGAGATGGAGAACACTTGG - Intergenic
1166627281 19:44370032-44370054 ATTTAAAGATCAAGAACAAATGG - Intronic
925491353 2:4397631-4397653 ATTTAGAACAGTAGAACAGAAGG - Intergenic
925590559 2:5505336-5505358 AGTTATAGATGGAGAAGAGGAGG + Intergenic
925606164 2:5662515-5662537 AGGAAGAGATGGAGCACAGAAGG - Intergenic
925839321 2:7976674-7976696 TTTTACAGATGGAGAAAATAAGG - Intergenic
926567926 2:14497973-14497995 ATTTTGGGATGGAAAATAGAAGG + Intergenic
926666664 2:15531895-15531917 AATCAGAGATGGAGAATGGAAGG - Intronic
927144676 2:20155071-20155093 ATTTAGAGGTTGAGAAGAGCAGG + Intergenic
928359742 2:30653425-30653447 ATTCAGTGATGGAGAAAAGCTGG + Intergenic
928360724 2:30660192-30660214 ATTTAGTGATGGAAAAGATAGGG + Intergenic
928932972 2:36644662-36644684 TTATGGAGATGGAGAATAGAAGG + Intronic
929172955 2:38949577-38949599 ATTGCAAGATGGAGAAGAGAGGG + Intronic
929768327 2:44869613-44869635 ATTTAGATAGGCAGAGCAGAGGG - Intergenic
930696760 2:54419674-54419696 ATTTAGAGAAGCAGAACATTTGG - Intergenic
930836119 2:55795061-55795083 TTTAAGAGATACAGAACAGAAGG - Intergenic
931115112 2:59157582-59157604 GTTAAGAGATGGAGAACAAATGG - Intergenic
931193492 2:60027997-60028019 CTTTAGGGATGGAAAACAGTGGG - Intergenic
931891238 2:66674881-66674903 TTTTACAGAGGAAGAACAGAGGG + Intergenic
932103165 2:68919399-68919421 ATATAGAGATGGAAAACAAGTGG + Intergenic
932822092 2:74910356-74910378 AATTAGAAATGAATAACAGAGGG - Intergenic
932891734 2:75602800-75602822 CTGTACAGCTGGAGAACAGAGGG + Intergenic
933134790 2:78719781-78719803 ATTTAAAGAGGGGAAACAGAAGG + Intergenic
933199287 2:79430668-79430690 TTTTATATATGGAGAACACAAGG + Intronic
934516546 2:94991662-94991684 ATGTAGAGGTTGTGAACAGAGGG - Intergenic
936970345 2:118170784-118170806 TTTTAAAGATGTAGAAGAGAGGG - Intergenic
937259691 2:120577430-120577452 ATTTAGGGATGGTGAGTAGAAGG - Intergenic
937661828 2:124438891-124438913 ATTTACAGATGAAGAACTGCTGG + Intronic
938645744 2:133328283-133328305 ATTTTCAGATGGAGAATAGAGGG + Intronic
940622670 2:156132162-156132184 ATTTAGAGAAAGATAGCAGAGGG - Intergenic
941443965 2:165577635-165577657 ATTTGGTGTTGGAGAACAGTTGG - Intronic
941689574 2:168485474-168485496 ATAAATAGATGGAGAACAGAAGG - Intronic
941962537 2:171268258-171268280 ATTTAGAGGTAGGGAAGAGAAGG - Intergenic
941987860 2:171525672-171525694 ATTTGGAGATGAAGAAGAGAAGG + Intronic
942078356 2:172378065-172378087 ATTAGGAAATGGAGGACAGATGG + Intergenic
942991282 2:182206537-182206559 ATGAAGAGGTGGAGCACAGAGGG - Intronic
943157999 2:184209342-184209364 AATTATAGAATGAGAACAGAGGG - Intergenic
944245762 2:197529262-197529284 ATTTAGAAATGAAGATCAGCTGG - Intronic
944359943 2:198842171-198842193 GTTTAGAGATGGAGAACCAGTGG + Intergenic
945593643 2:211765729-211765751 ATTTAGAAATGTAGAAGTGATGG + Intronic
945795591 2:214358763-214358785 AGTTAGAAAGGGAGAACAGGAGG + Intronic
946171327 2:217897730-217897752 ATGTAGAGGTGGTGAGCAGATGG + Intronic
946629002 2:221646033-221646055 ATTTAGATAGTGAAAACAGAAGG - Intergenic
946634753 2:221712330-221712352 ATTTAGAAATGGAAAAAAGAAGG + Intergenic
947045056 2:225972309-225972331 ATTTAGAGTTGGAGAAACAAAGG - Intergenic
947130040 2:226912687-226912709 ACTTAGAGCTGGAGAAGGGATGG + Intronic
1168894836 20:1317042-1317064 TTATAGAGATGGAAAACAGAGGG + Intronic
1169280108 20:4259866-4259888 ATTTAGATATCATGAACAGAAGG - Intergenic
1170140601 20:13122110-13122132 TTTTAGAGATGGAGGAAAGGTGG - Intronic
1170283783 20:14682347-14682369 ATTATGAGATGGGAAACAGAGGG - Intronic
1170349585 20:15424287-15424309 ATTTTGAGGTGGTAAACAGATGG - Intronic
1171384396 20:24759215-24759237 AATTAGAAATCGATAACAGAAGG + Intergenic
1171989071 20:31681728-31681750 TTTTATAGATGGGAAACAGAGGG - Intronic
1173485373 20:43437219-43437241 ACTTAGAGGTGGAAATCAGAGGG + Intergenic
1173614550 20:44394324-44394346 ATGGGGAGATGGAGATCAGAGGG - Intronic
1174050630 20:47765027-47765049 ATTTGGAGGTGGAGAGAAGATGG - Intronic
1174405734 20:50302065-50302087 ATTTATACATGAAGAAGAGAAGG - Intergenic
1174666671 20:52264619-52264641 ATTCAGAGATGAAAAACAGTAGG - Intergenic
1174872302 20:54194404-54194426 ATATAGTTATAGAGAACAGAGGG + Intergenic
1174937906 20:54892758-54892780 TTACAGACATGGAGAACAGAAGG - Intergenic
1175028692 20:55930677-55930699 TTTTAGACATGGAGACCAGAAGG - Intergenic
1175030972 20:55953621-55953643 ATTAAGAGATGAAGAAAAGATGG - Intergenic
1175635255 20:60577435-60577457 AGTTACAGATGGAGAATAAATGG + Intergenic
1176909585 21:14548145-14548167 ATTCATAGATGAAGAAAAGAGGG - Intronic
1178005556 21:28216159-28216181 TTTTAGATATTGAGAGCAGAAGG + Intergenic
1178525278 21:33323658-33323680 ATATAGAGATGGAATAGAGATGG + Intergenic
1179115182 21:38484494-38484516 ATTTAAAGTTGGAGAAATGAAGG - Intronic
1181357215 22:22305762-22305784 GTTTTGAGATAGAGAACAGAGGG + Intergenic
1181908734 22:26220833-26220855 ATTGAGAGAAGGAGAAAGGAAGG + Intronic
1182992410 22:34780863-34780885 ATCTAGTCATGGAGAATAGAGGG + Intergenic
950904715 3:16527626-16527648 ATTTAGAGATAGAGAAAAAGAGG + Intergenic
951106724 3:18752767-18752789 ACTTAGAGAAGAAGAACAGAGGG - Intergenic
951658697 3:25038013-25038035 ATTTAGACATGGAGAAAATGAGG + Intergenic
951801890 3:26605013-26605035 ATTTATAGATGAAAAACAGAAGG - Intergenic
952167644 3:30768531-30768553 ATTTTGAGAAGGAGAAGAGGGGG + Intronic
952468657 3:33619908-33619930 AGTTAAAGATGGGGAAAAGAAGG - Intronic
953117348 3:40006253-40006275 GTTTAGAGAAGGAAAATAGAAGG + Intronic
953509992 3:43525803-43525825 ATTTTGATATTGAAAACAGAAGG - Intronic
953850701 3:46463853-46463875 ATTTGGAGCAGGAGACCAGAAGG + Intronic
953931011 3:47005653-47005675 GTGTAGGGATGGAGAGCAGATGG + Intronic
954606910 3:51918657-51918679 AATCAGGAATGGAGAACAGAAGG + Intergenic
954854573 3:53632754-53632776 AGAGAGAGATGGAGAACAGCTGG + Intronic
956381434 3:68668457-68668479 ATTTACAGAGGGAGATCAAAAGG - Intergenic
958129992 3:89406171-89406193 ATTAGGAGATGGAGAGGAGAAGG + Intronic
958886332 3:99731822-99731844 ATTCAGATATGGAGGTCAGATGG + Intronic
959331531 3:105012151-105012173 ATTTATAGATAAAGAACAGGAGG + Intergenic
960203427 3:114866269-114866291 ATTTAGAGATGAAGAAACTAAGG + Intronic
960789002 3:121405945-121405967 ATTTAGAGATGGCTGACAGTAGG - Intronic
961079948 3:124017840-124017862 AATTAGAGATGTGGAAAAGATGG - Intergenic
962284659 3:134075842-134075864 ATTTGGAGATGGAGAAGCGAGGG - Intronic
962350946 3:134655226-134655248 AGTTGGAGATGGAGTATAGAAGG + Intronic
962619461 3:137162828-137162850 AATAAGAGATGCAGCACAGAAGG + Intergenic
963404960 3:144852356-144852378 ATTTAGAGAGTGAGAACAGCAGG - Intergenic
963568133 3:146957717-146957739 ATTTATAGATGGAGGAGAAAAGG + Intergenic
963785681 3:149532103-149532125 CTTTACAAATGAAGAACAGAGGG - Intronic
964180155 3:153874022-153874044 CTCTGGAGATAGAGAACAGAAGG + Intergenic
964345264 3:155748812-155748834 ATTTATAGACAAAGAACAGATGG + Intergenic
964775539 3:160272551-160272573 ATTTAGCAATAGAGATCAGAAGG - Intronic
965150187 3:164963126-164963148 ATTTATTTAAGGAGAACAGATGG + Intergenic
965255500 3:166403103-166403125 TTTTAGAGATGGAGCCAAGATGG - Intergenic
965465277 3:169022178-169022200 ATAAAGAGATGGTGAACAGATGG + Intergenic
965575640 3:170215320-170215342 AATTAGACATTGATAACAGAAGG + Intergenic
965768634 3:172157588-172157610 ATTTAGAGATGGAGAACAGATGG - Intronic
965835757 3:172850370-172850392 ATTGAGAAATGGAGAGAAGAAGG + Intergenic
966024774 3:175263739-175263761 ATGGAGAGATGAAGAAAAGAAGG + Intronic
966247311 3:177823853-177823875 ATTTATAGCTGAAGAACTGAGGG + Intergenic
966557522 3:181280083-181280105 ATTTAGAGATGTGGAAAGGATGG + Intergenic
969271067 4:6102698-6102720 CTTTAGAGAGGGAGAAAAAAGGG - Intronic
969693699 4:8723315-8723337 ATTTAGGGTTGGAGAACAGGTGG - Intergenic
970615177 4:17762051-17762073 ATTTGCAGAGGGAGAAGAGAAGG - Intronic
970751652 4:19371239-19371261 ATATACTGAAGGAGAACAGACGG - Intergenic
970965276 4:21921282-21921304 ATTTAGAGATAGAGCAAGGAAGG - Intronic
972047778 4:34690477-34690499 ATTTAGTGATGGACAAGATATGG + Intergenic
972410070 4:38784673-38784695 GTTTGGAGATGGAGGAGAGATGG - Intergenic
972980113 4:44688001-44688023 ATTTAGATATGCAGGACAGGTGG + Exonic
973076914 4:45940492-45940514 ATTAAGAGATGGAGTAGAGATGG - Intergenic
973122975 4:46545723-46545745 AGTGAGAGATGGAAAGCAGAGGG - Intergenic
973325316 4:48854691-48854713 ATTTAGAGAAGGGGGTCAGAAGG - Intronic
973985958 4:56353187-56353209 ATTTACAGATGAAGAAAATAAGG - Intronic
973987741 4:56371978-56372000 CTTGAGAGCTGAAGAACAGAAGG + Intronic
975484384 4:74918087-74918109 ATTTAGAGATGGTTTAGAGATGG + Intergenic
975919560 4:79368710-79368732 ATTTAGAAATGTAGAACTCAGGG + Intergenic
976264234 4:83174992-83175014 ATTTAGAGAAAAAGCACAGAGGG - Intergenic
976391826 4:84513548-84513570 GTTTAGGGTAGGAGAACAGAGGG + Intergenic
976625084 4:87171785-87171807 ATTTAATGATGGAGTAAAGAAGG - Intronic
976628707 4:87215195-87215217 AATTAGATATGGAAAACAAAAGG - Intronic
976954394 4:90877683-90877705 ATTAAGGAATGGAGAATAGAAGG + Intronic
977983131 4:103349586-103349608 ATTTTGAGATGAAGAGCATAGGG - Intergenic
978646385 4:110937146-110937168 AATTGGAAAAGGAGAACAGAAGG + Intergenic
978881391 4:113707428-113707450 AAATAGAGATGGAGAACAGCTGG - Intronic
979627044 4:122856878-122856900 TTATAGAAATGGAGAACAGATGG - Intronic
980048136 4:128011770-128011792 ATTTAGAAATGGTTAACTGAAGG - Intronic
980759519 4:137211775-137211797 ATTTCTAGAGGGATAACAGATGG + Intergenic
981563486 4:146073289-146073311 ATCTAGAGATGGGGAACATCAGG - Intergenic
983099752 4:163610574-163610596 ATTTAGGGAATGACAACAGATGG + Intronic
984139650 4:175987724-175987746 ATCTAGAAGTTGAGAACAGATGG + Intronic
985203501 4:187507421-187507443 ATTTACAGAAGGAGATCAGTTGG + Intergenic
985395802 4:189542318-189542340 TTTTATATATGGAGAAAAGAAGG - Intergenic
985804335 5:2030556-2030578 ATCTACAGGTGGAGAACTGAGGG + Intergenic
986158555 5:5201385-5201407 ATTTTAAAATGAAGAACAGAGGG + Intronic
986283536 5:6343450-6343472 ATTTGGAGAGGGAGATCAGCCGG - Intergenic
986307022 5:6523473-6523495 AATTTGAAATGGAGAAAAGAGGG - Intergenic
986833833 5:11611847-11611869 AGTGAGAGATGCAGAAGAGAAGG - Intronic
987772452 5:22323889-22323911 ATTTACAGATGAAGAAATGAAGG - Intronic
987840595 5:23218513-23218535 ATTTGGAGATGGAGCACCTAAGG - Intergenic
988341898 5:29983376-29983398 ATTGGGAGCTGGAAAACAGATGG - Intergenic
988482883 5:31644298-31644320 CTTTAGAAATAGAGAAAAGATGG + Intronic
989017007 5:36948574-36948596 ATTCAAAGATGGAGAAAATAAGG + Intronic
989411978 5:41130275-41130297 ATTTAGAGATGAAGAACCTGAGG - Intergenic
989473154 5:41844503-41844525 ATTTAGAAATTGGGAAGAGAAGG - Intronic
989688507 5:44115147-44115169 AATAAGAGATGGAGAAAAGCAGG + Intergenic
989717902 5:44486361-44486383 AGTTAAAGATGGATACCAGATGG + Intergenic
990173411 5:53080702-53080724 TTTTACAGATGGGAAACAGATGG + Intronic
990382792 5:55232958-55232980 TTTTACAGATGGAGAAAAGTGGG - Intronic
990705661 5:58526600-58526622 AGTTAGAGATGGAAAAGAGATGG - Intergenic
990791630 5:59487158-59487180 ATTTCTAGATTGAAAACAGAAGG + Intronic
991288990 5:65012756-65012778 CTTCAGAGATGGAGAACAGCTGG - Intronic
991554858 5:67883779-67883801 ACTTAGAGATGGTCTACAGAAGG - Intergenic
992145146 5:73839420-73839442 ATTTAGAGATAGAGCAGTGAAGG - Intronic
992395779 5:76368412-76368434 ATGTAGAGTTGGAGGAGAGAAGG + Intergenic
992582760 5:78198609-78198631 ATTTAGAGATGGATAAAAGTTGG - Intronic
993586094 5:89730224-89730246 ATTTAGAGATGTACACTAGAGGG - Intergenic
993594628 5:89837455-89837477 ATTTTAAGATGGAAAACATATGG + Intergenic
993875376 5:93300333-93300355 TTTTTGAGATGGAGAGCAAAAGG - Intergenic
993928117 5:93897941-93897963 ATTAAGAAATGGGGAAGAGATGG - Intronic
993990970 5:94658737-94658759 ATTTCCAGATGGAGAAGTGATGG - Intronic
994595182 5:101823556-101823578 AATTAGAGAAGGATAAGAGAGGG + Intergenic
995400553 5:111736172-111736194 ACTTGAAGATGGAGAACAGCTGG - Intronic
997404593 5:133635109-133635131 ACTTAGACATAAAGAACAGATGG - Intergenic
998350249 5:141495570-141495592 AGACAGAGATGGAGAAGAGAGGG - Intronic
998765975 5:145487720-145487742 TTTTAGAGATGGAGGAAGGAAGG + Intronic
999875634 5:155802789-155802811 TTTTAGAGTTGGAGAAGAGATGG + Intergenic
1000128096 5:158267307-158267329 ATTTACAGACAGAAAACAGAAGG - Intergenic
1000656603 5:163886734-163886756 TTTTAGAGATGAAGAAATGAAGG - Intergenic
1001622713 5:173102104-173102126 ATCTAGAGCTGAAGAACACAAGG - Intronic
1002061393 5:176627937-176627959 CTTGAGAAATGGGGAACAGATGG + Intronic
1003542878 6:7033488-7033510 ATTTAGAGATGGAGAGAGGAGGG - Intergenic
1004042755 6:11997460-11997482 AGTTAGAGGTTGATAACAGAGGG + Intergenic
1004349464 6:14878453-14878475 ACTTAGAAATGGAGAAGAAATGG + Intergenic
1005450643 6:25968400-25968422 ATTTACAGATGGAGAAACCAAGG - Intronic
1005698819 6:28379000-28379022 ATTTAGGGATGTACAGCAGAGGG + Exonic
1005800578 6:29418274-29418296 ATTTAGAAATGTACAACAGAGGG + Intronic
1005928859 6:30466068-30466090 CCCTAGGGATGGAGAACAGAAGG + Intergenic
1007252580 6:40505966-40505988 ATATTGAGATGGGGAACAGTGGG - Intronic
1007265469 6:40592427-40592449 TTTTAGAGATGGAGAAAATGAGG - Intergenic
1007703336 6:43776884-43776906 TTTTACAGATGGGGAACAGGAGG - Intronic
1008120638 6:47612816-47612838 TCATAGAGATAGAGAACAGAAGG + Intronic
1008408089 6:51141536-51141558 ATTAATAGATGGAAAATAGAGGG - Intergenic
1010187730 6:73162553-73162575 ATGTGTAGTTGGAGAACAGAGGG + Intronic
1010329938 6:74611511-74611533 ACTTAAAGATGGAAAACACAAGG + Intergenic
1010761116 6:79724471-79724493 ATCTGGAGATGGAGCAGAGAAGG - Intergenic
1011092413 6:83620260-83620282 AAGAAGAGATGGAGATCAGAAGG - Intronic
1011917622 6:92527643-92527665 ATTTCAAGAGGGAGAAGAGATGG + Intergenic
1012088667 6:94862868-94862890 ATTAAGAGAAGCAGAACACAAGG - Intergenic
1013115643 6:107101902-107101924 GTTCTGAGATGCAGAACAGATGG + Intronic
1013209533 6:107974304-107974326 TGTAAGAGATGGAAAACAGATGG - Intergenic
1013815945 6:114097692-114097714 ATTTAGGGAATGAGAAAAGAAGG + Intronic
1013830539 6:114267519-114267541 AATCAGATATGGAGAACACAAGG + Intronic
1013964002 6:115934073-115934095 ATTTAGAGAGAGAGAAAGGAGGG + Exonic
1014681684 6:124438841-124438863 ATTTACAGAGGAAAAACAGATGG - Intronic
1014690338 6:124555524-124555546 ATTTAGAGAAAGGGAACATAAGG - Intronic
1015104960 6:129525358-129525380 AGATGGAGATGGAGGACAGAAGG + Intergenic
1015689387 6:135904505-135904527 ATTTGGAAATGGAGAAAGGATGG - Intronic
1016400561 6:143675603-143675625 GTTTAGAAATAGAGAACAAAGGG + Intronic
1016592267 6:145759506-145759528 ATACAGAGATAGAGAACAGTGGG - Intergenic
1016856272 6:148673554-148673576 TTTTAGAGATAGAGAAAAAAAGG - Intergenic
1017219732 6:151951944-151951966 ATTTAGAGATGGTGAAGAAGAGG - Intronic
1017307324 6:152934259-152934281 TTAAAGAAATGGAGAACAGAAGG + Intergenic
1017393100 6:153962818-153962840 ATTGAGGGATAGAGAAAAGAGGG - Intergenic
1018624295 6:165762901-165762923 ATGTAGAGATAGAGAATAGGAGG + Intronic
1019026215 6:168965164-168965186 ATTTATGAATGGAAAACAGAAGG - Intergenic
1019264951 7:109902-109924 ACATGGAGATGGAGAACACAGGG + Intergenic
1019275174 7:172411-172433 AGTGAGATCTGGAGAACAGAGGG + Intergenic
1019327600 7:445986-446008 ATGGAGAGATGGAGAAAAGAAGG + Intergenic
1019819504 7:3231423-3231445 ACTGAGAGATGGAGAGAAGAAGG - Intergenic
1020359898 7:7316617-7316639 AGCTATAGATGGGGAACAGAGGG + Intergenic
1020783639 7:12546722-12546744 TTTGATAGATGGAAAACAGAGGG + Intergenic
1020949949 7:14663042-14663064 ATTTACAAATGGAATACAGAGGG + Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1023156870 7:37260299-37260321 TTTTAGAGAGGGAGAAGATAGGG + Intronic
1023361126 7:39416020-39416042 ATTTGCAGATGGAGAAATGAAGG - Intronic
1024346947 7:48322882-48322904 CTATAGTGATAGAGAACAGATGG - Intronic
1026618646 7:71930826-71930848 TTTTAAAGATGGAGAAGAGAAGG - Intronic
1026670835 7:72389282-72389304 ATTCAAAGTTGGAGAAGAGAAGG - Intronic
1026926753 7:74199531-74199553 GTTTACAGATGGGGAACAGTAGG - Intergenic
1027351391 7:77315332-77315354 ATTTAGAGATGAAGAAATGGAGG - Intronic
1027426623 7:78067934-78067956 ATGAATAGATGGAGCACAGAGGG + Intronic
1027703213 7:81494996-81495018 TTTTCTAGATGGAGAACAGTGGG - Intergenic
1027940033 7:84666282-84666304 ATTTACAGGTGGAGAACTGCAGG + Intergenic
1028368193 7:90059618-90059640 TTTTATAGTTGGAGAATAGAAGG - Intergenic
1028447632 7:90943245-90943267 ACGTAGAGATGGAGAAGAGGTGG + Intronic
1028859179 7:95628515-95628537 GTTAAGAGCTGGAGAATAGAGGG - Intergenic
1029950051 7:104574399-104574421 TTTTAGAGAAGTAGAATAGAGGG + Intronic
1031080819 7:117255355-117255377 ACTTTTAGATGTAGAACAGAGGG + Intergenic
1032193411 7:129777103-129777125 CCTTAGAGCTGGAGAACAGATGG + Intergenic
1032431462 7:131865283-131865305 GTCTAGAGATGGAGAACATCTGG - Intergenic
1032773746 7:135088973-135088995 AGTTAGAGAAGGAGAAGAGAAGG - Intronic
1032918372 7:136517620-136517642 TTTCAGAAATAGAGAACAGATGG - Intergenic
1032998881 7:137480937-137480959 AGGTAGGGATGGAGAACAGAAGG - Intronic
1033232392 7:139610876-139610898 ATTTAGAAATGGATACCACATGG + Intronic
1033415623 7:141158938-141158960 AATTAGAGATGGAGAGGACAAGG + Intronic
1034296262 7:149975222-149975244 ATTTAGAAATCAATAACAGATGG + Intergenic
1035918170 8:3648051-3648073 GGTTGGAGATGGAGGACAGATGG + Intronic
1036726029 8:11221909-11221931 ATTCATAGAAGGAGAAGAGAAGG + Intergenic
1038507251 8:28095161-28095183 ATTTGGACATGCAAAACAGAAGG - Intronic
1038756273 8:30343613-30343635 TTTTAGAAATGGAGGACAAATGG - Intergenic
1039742184 8:40393091-40393113 ATAGAAAGATCGAGAACAGAAGG + Intergenic
1040937226 8:52794424-52794446 ATGAAGAAATGGAGACCAGAAGG + Intergenic
1040945302 8:52877903-52877925 ATTTAAAGATAGAGAACAAAGGG + Intergenic
1041493446 8:58460612-58460634 ATTTAGCCAAGGAAAACAGAAGG - Intergenic
1042257562 8:66821150-66821172 AATTAGAGATGGCCCACAGATGG - Intronic
1042287736 8:67132686-67132708 ATATAGGGAATGAGAACAGAGGG + Intronic
1042649014 8:71019190-71019212 TTTTATAGATGGAGAAAATAAGG + Intergenic
1043260896 8:78194411-78194433 ATTTAGAGATTTATATCAGATGG + Intergenic
1043264286 8:78243682-78243704 ATATAGAGAAGCAGAACATATGG - Intergenic
1043333543 8:79146308-79146330 ATGTAGAGGTGGAGAAAAGGCGG + Intergenic
1044998664 8:97861178-97861200 ATTTTCAGATGGAGACCAAAAGG - Intergenic
1045174315 8:99704996-99705018 ATGTAGAGGGGAAGAACAGATGG + Intronic
1046307897 8:112394499-112394521 GTTTAGAGAGGCAGAGCAGAGGG - Intronic
1046653537 8:116868017-116868039 AATTAGAAATGTAGAACAGGTGG - Intronic
1047544481 8:125802679-125802701 ATGTAGTGATGCTGAACAGATGG + Intergenic
1047704998 8:127489108-127489130 ATTGAAAGGTGGAGAAAAGAAGG - Intergenic
1047712203 8:127563824-127563846 GTTTAGAGATTGTGAATAGAAGG + Intergenic
1047961225 8:130013414-130013436 GTTTAGAGATGAGGAAAAGAGGG + Intronic
1051775797 9:20632377-20632399 ATTTAGAAATGGAGAAGCAAGGG + Intergenic
1052251899 9:26408457-26408479 CTTGAGACAAGGAGAACAGATGG - Intergenic
1052757800 9:32558450-32558472 ATTCACAGATGGAGAACTTAAGG + Intronic
1053109462 9:35445129-35445151 ATTTAGAGATGGAGAATGTGGGG - Intergenic
1053238878 9:36479948-36479970 ATTTACAGATAGAGAAAAGTTGG - Intronic
1053362255 9:37497027-37497049 ATTTATAGATGGAGAAACCAGGG + Intronic
1054462038 9:65470552-65470574 ATTGAGAGATGGGGAATGGATGG + Intergenic
1056180520 9:84078153-84078175 ATATGGAGATGGAGAGTAGAAGG + Intergenic
1057951427 9:99371764-99371786 ATTTAGCAATGAAGAACTGAGGG - Intergenic
1057964955 9:99493674-99493696 ATTCAGAGCTGGAGGACAGGTGG - Intergenic
1058153228 9:101484892-101484914 ATTTAGTGAAGGAGAAAAGAAGG + Intronic
1058859671 9:109103693-109103715 ACTCAGAGATAGAGAGCAGAAGG + Intronic
1058890196 9:109354797-109354819 AATGAGGGATGGAGAACAGCTGG - Intergenic
1058978317 9:110145656-110145678 ATTTAGATAAAGAGAACACAGGG - Intronic
1058993983 9:110281559-110281581 ATTTAAAGTTGGAGATCAAATGG - Intergenic
1059158461 9:112011330-112011352 ATTTGGAGGTGGGGAAGAGAAGG - Intergenic
1059668230 9:116469605-116469627 CTTTAGAGATGAAGAAATGAAGG - Intronic
1060056778 9:120420899-120420921 GTTGAGAGAGGCAGAACAGAAGG + Intronic
1061628028 9:131853554-131853576 TTACAGAGATGGTGAACAGATGG + Intergenic
1061647021 9:132012064-132012086 ATTAACAAATGGTGAACAGATGG + Intronic
1185936159 X:4258662-4258684 ATGTAGAGAAGGAGAGCTGATGG - Intergenic
1186238655 X:7542605-7542627 ATTTAAAGAAGAAAAACAGAAGG + Intergenic
1186264130 X:7813295-7813317 TGTTAGAGATGGAAAACAGGTGG + Intergenic
1186591076 X:10930651-10930673 ATTTAGAGATGAGGAAATGAAGG + Intergenic
1186976841 X:14916923-14916945 ATGTAGAAAAGGAGAATAGAAGG + Intronic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1187831977 X:23391546-23391568 ATTTGGGGAGGGAAAACAGAGGG + Intronic
1188083544 X:25875363-25875385 GATTAGAGATGGAAATCAGAAGG + Intergenic
1188279988 X:28255345-28255367 ATTTAGGGAATGAGAAAAGAAGG - Intergenic
1188629750 X:32339868-32339890 AATTAGAGAAGGAGAATATAGGG + Intronic
1189025717 X:37391603-37391625 ATTTAGAATTGTAGAACTGAAGG + Intronic
1189100828 X:38187773-38187795 ATTTAGCTATGGAGGAGAGAAGG - Intronic
1189159112 X:38792460-38792482 ATTTAAAGATTGGGTACAGAAGG + Intergenic
1190076675 X:47322096-47322118 ATTTAGAGGTGGAGAGCAGGTGG + Intergenic
1191958248 X:66669822-66669844 AGTTGGACATGGAGAACACATGG - Intergenic
1193427228 X:81354798-81354820 ACTTAGAGTTGAAGAATAGAAGG + Intergenic
1194213700 X:91101060-91101082 ATGTGGAGATGGAGAACATTTGG - Intergenic
1194706044 X:97177109-97177131 ATTTATAGATGTAGAACCCATGG + Intronic
1195712281 X:107783156-107783178 ATATGGAGATGGGGAACTGAGGG + Intronic
1195937372 X:110138540-110138562 ATTTAGAGATGAGGGACATAGGG + Intronic
1196293410 X:113970688-113970710 ATTTAGAAATCAACAACAGAAGG - Intergenic
1196821615 X:119705773-119705795 ATTAAGAGATGGAAAATAGGAGG + Intergenic
1197680539 X:129378807-129378829 AATTGGGGATGGAGAGCAGAGGG + Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1199675085 X:150181915-150181937 TTTTAGCGATGGAGAAATGAAGG - Intergenic
1199852373 X:151734668-151734690 ATTTAGAGTTGGAGAAGAAGAGG + Intergenic
1200314668 X:155119498-155119520 CTTTTGAAATGAAGAACAGAGGG - Intronic
1201720473 Y:17090723-17090745 ATGTAGAGATGGAGAGCTGATGG - Intergenic