ID: 965769780

View in Genome Browser
Species Human (GRCh38)
Location 3:172169605-172169627
Sequence CTGTAAGAAGGTTTCTCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965769780_965769788 30 Left 965769780 3:172169605-172169627 CCGGCAGAGAAACCTTCTTACAG 0: 1
1: 0
2: 2
3: 10
4: 137
Right 965769788 3:172169658-172169680 AAGAGTGGGCTGCATTGAGCTGG 0: 1
1: 0
2: 0
3: 14
4: 208
965769780_965769785 16 Left 965769780 3:172169605-172169627 CCGGCAGAGAAACCTTCTTACAG 0: 1
1: 0
2: 2
3: 10
4: 137
Right 965769785 3:172169644-172169666 ACCCACACTTTTCAAAGAGTGGG 0: 1
1: 0
2: 2
3: 14
4: 161
965769780_965769784 15 Left 965769780 3:172169605-172169627 CCGGCAGAGAAACCTTCTTACAG 0: 1
1: 0
2: 2
3: 10
4: 137
Right 965769784 3:172169643-172169665 TACCCACACTTTTCAAAGAGTGG 0: 1
1: 0
2: 0
3: 14
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965769780 Original CRISPR CTGTAAGAAGGTTTCTCTGC CGG (reversed) Intronic
900173049 1:1279696-1279718 GTTTAAAAAGGTTTGTCTGCTGG - Intergenic
901089908 1:6634331-6634353 TTTTAAAAAGGTTTCTCTGACGG - Exonic
904532862 1:31180774-31180796 GTGTAGGAAGGCTTCTCTGTGGG + Exonic
908354283 1:63316502-63316524 CTGTGGGAAGGATTCTCTGCGGG - Intergenic
909002206 1:70232246-70232268 ATGCAAGGATGTTTCTCTGCAGG + Exonic
913158590 1:116124575-116124597 CTTTAAGAAAGTTACTGTGCTGG + Intronic
913278314 1:117160433-117160455 CTGTAAGAAGGTCTACCTGTAGG - Intronic
913290689 1:117269004-117269026 CTGGAAGGATGTTTATCTGCTGG - Intergenic
913645660 1:120851421-120851443 CCGCCAGAAGGGTTCTCTGCAGG - Intergenic
914081052 1:144412105-144412127 CCGCCAGAAGGGTTCTCTGCAGG + Intergenic
914175967 1:145280639-145280661 CCGCCAGAAGGGTTCTCTGCAGG + Intergenic
914530687 1:148522121-148522143 CCGCCAGAAGGGTTCTCTGCAGG + Intergenic
915580271 1:156809154-156809176 GTGCAAGAAGGTCTCCCTGCAGG - Intronic
917000059 1:170347736-170347758 CTATATGAAGGTCTCTTTGCTGG - Intergenic
917367106 1:174244217-174244239 CAGTAAGAATGTTTGTCAGCTGG - Intronic
918709890 1:187713805-187713827 CTTTAAGAAAGTTTCTCAGCTGG - Intergenic
920701244 1:208219424-208219446 CTGAGAAAAGCTTTCTCTGCCGG - Intronic
921148004 1:212377775-212377797 CTGCAAGCTGGTTTCTTTGCTGG + Intronic
922082385 1:222309603-222309625 CTGGAAGAAGGTTTCACAGACGG - Intergenic
1070186815 10:74071860-74071882 CTGGAAATAGGTTTCTCTGGTGG + Intronic
1071268764 10:83987522-83987544 CTGTAAGCAGTTTATTCTGCAGG - Intergenic
1072031230 10:91524594-91524616 CTGTAGGAAGGTTGGTATGCAGG - Intergenic
1073179027 10:101572982-101573004 CTGTAGGACTGTTTCCCTGCTGG + Intronic
1074719824 10:116254764-116254786 CTGTGACAAGGTTTCTCTTTAGG - Intronic
1077001629 11:326310-326332 AAGTAAGCAGGCTTCTCTGCAGG + Intronic
1077001641 11:326377-326399 AAGTAAGGAGGCTTCTCTGCAGG + Intronic
1079646521 11:22869979-22870001 CTGTAAGAAGGTATAGCTCCAGG - Intergenic
1081397068 11:42598898-42598920 CTGGAACCAGGTTTCTCTCCTGG - Intergenic
1081610552 11:44560510-44560532 CTGGAGGAGGGTTTCTCTGATGG - Intergenic
1081737635 11:45415122-45415144 CTGTAAGTAGTTGTCTCTGCGGG + Intergenic
1082677724 11:56128700-56128722 CTCTTAAAAGTTTTCTCTGCAGG - Intergenic
1087181511 11:95146638-95146660 TTGTATTAATGTTTCTCTGCAGG - Intergenic
1087727978 11:101744055-101744077 CTGACAGAAGGTTTATCTGTGGG + Intronic
1088250256 11:107856332-107856354 CTGTTACAAGGTTACTATGCAGG - Intronic
1089696761 11:120220715-120220737 CTGTGAGCAGGTTCTTCTGCCGG - Intronic
1096331702 12:50718828-50718850 CTGTAAGAAGGTAACACTTCAGG - Intronic
1099089948 12:78293584-78293606 TTGTAAAAAGGTTTCACTACAGG + Intergenic
1101484940 12:105147145-105147167 CTGTAAGAACTTTTCTTTGGGGG + Exonic
1102668088 12:114593277-114593299 CTGTATCAAGGTCTCTCAGCTGG + Intergenic
1104336630 12:127902025-127902047 TTTTAATGAGGTTTCTCTGCAGG - Intergenic
1105985651 13:25563620-25563642 CTCTTAGAAGTTTTCTCTGGTGG + Intronic
1105997412 13:25685834-25685856 TGGTAACAGGGTTTCTCTGCTGG + Intronic
1106627091 13:31431896-31431918 TTGTAACAAGTTTTCTGTGCTGG - Intergenic
1107351383 13:39518487-39518509 CAGTAAGAAGGATTTTCTACTGG - Intronic
1108446722 13:50516804-50516826 CATTAAGAAGGTTTGGCTGCAGG - Intronic
1113383918 13:109829745-109829767 CTGTTAGAATGTTTGGCTGCAGG - Intergenic
1118915738 14:70102090-70102112 CTGTAAGAAGAGATCTCTGTTGG - Intronic
1122181182 14:99955963-99955985 CTGAAAAAAGGTTTTGCTGCTGG - Intergenic
1122648935 14:103214574-103214596 CAGCAAGAAGCTATCTCTGCAGG - Intergenic
1125242994 15:37598216-37598238 CTGTGTGTATGTTTCTCTGCGGG + Intergenic
1126712179 15:51471275-51471297 TTGTAAGATGGTCTTTCTGCAGG + Exonic
1128243732 15:66118865-66118887 CTGTAAGGAGGTTGATCTGATGG + Intronic
1131428652 15:92368357-92368379 CTGTAACAGTGTTTCTCTGAGGG - Intergenic
1132070235 15:98770199-98770221 CTGAATGAATGTCTCTCTGCTGG + Intronic
1136095451 16:27952355-27952377 CTGTAAGTAGGTTCCTCTGGGGG + Intronic
1141974454 16:87506109-87506131 CTATTAGAGGGTTTCTCTGGGGG - Intergenic
1141990085 16:87604327-87604349 CTGTAAGATGGTTTCTGTGCAGG + Intronic
1142404350 16:89878940-89878962 CAGTAATAAGGTTTGTCTGACGG + Intronic
1147667124 17:42155800-42155822 CTGCAGGAAGAGTTCTCTGCAGG + Intergenic
1151183872 17:72349536-72349558 CTGTTAGAAGGGTCCTCTCCAGG - Intergenic
1160097846 18:75891460-75891482 CTGCAAGCAGTTTTCTCTCCAGG + Intergenic
1160127705 18:76193210-76193232 CTGTCAGTGGATTTCTCTGCAGG - Intergenic
1161763022 19:6188250-6188272 CTGTAACAAGGCTGCTCTGAGGG - Intronic
1163663277 19:18591003-18591025 CTGGCAGAGGGTTCCTCTGCTGG - Intronic
1165604332 19:37087533-37087555 CTGTATCAATGATTCTCTGCAGG + Intronic
925806946 2:7659906-7659928 CTGTGAGATGATTACTCTGCAGG - Intergenic
928601446 2:32907684-32907706 GTGTAAGAAGTTTTCTGGGCTGG - Intergenic
928760708 2:34578580-34578602 CTGTAATAAATTTTCTCTCCAGG - Intergenic
931172565 2:59819421-59819443 CTGTCAGAACGTCTCCCTGCGGG + Intergenic
934651076 2:96091720-96091742 CTGGGAGACGGTTTCCCTGCAGG - Intergenic
937186991 2:120053461-120053483 GTGTAAGAGGGTTTCTTTGGGGG - Intronic
938082672 2:128378554-128378576 ATTTCAGAAGGTATCTCTGCAGG + Intergenic
938746724 2:134286145-134286167 CAGTAAGAAGGGTTCTCTGATGG - Intronic
939750502 2:146039382-146039404 GTGGAGGAATGTTTCTCTGCAGG + Intergenic
941486316 2:166086629-166086651 CTGTCAGAAGGTCACTCTGCAGG + Intronic
941637063 2:167946128-167946150 CTGTGAGAAGGTCACCCTGCAGG + Intergenic
949042468 2:241855625-241855647 CTGTAATGCGGTCTCTCTGCGGG - Intronic
1173750206 20:45470240-45470262 CTGGAAGAAGGAGTCTCTGGGGG + Intronic
1183742392 22:39676012-39676034 CTTTGAGAAGGTGGCTCTGCTGG + Intronic
1184527501 22:45034066-45034088 CTGTGTGATGTTTTCTCTGCAGG - Intergenic
955475993 3:59336825-59336847 TTGTAAGACTGTTTCTCTTCTGG + Intergenic
958187039 3:90135504-90135526 CTTTGACAAGGTTTATCTGCTGG - Intergenic
963076215 3:141348849-141348871 CTGTAAAATTGCTTCTCTGCCGG - Intronic
964636480 3:158862990-158863012 CTGTTAGAAGGTTTGTAGGCAGG + Intergenic
965431165 3:168590614-168590636 CTGTAAGAAATTTTCTTTGAAGG + Intergenic
965769780 3:172169605-172169627 CTGTAAGAAGGTTTCTCTGCCGG - Intronic
973107471 4:46357952-46357974 CTGTATGAAAGTTTCACAGCTGG - Intronic
981090886 4:140730874-140730896 TAGTAAGAAGGTATATCTGCAGG - Intronic
982549102 4:156774576-156774598 CTGTAAGAATGTTCCCCTGTGGG - Intronic
984353935 4:178634129-178634151 TTTTAAGAAGGTATCTATGCTGG + Intergenic
984591972 4:181627021-181627043 CGTTAACAAGGTTTCCCTGCAGG + Intergenic
984743720 4:183192943-183192965 CTTTAAGACGCTTTCTCTGTAGG - Intronic
993015988 5:82535187-82535209 CTTTAAGAAAGATTCTCTGTTGG + Intergenic
993721465 5:91325314-91325336 CTGTAATAAAGTTGATCTGCTGG + Intergenic
994006403 5:94842295-94842317 AAGTAAGAAGCTTTCTTTGCTGG - Intronic
994074496 5:95635382-95635404 CTGTAAGCAGTTTTTACTGCAGG + Intergenic
994522655 5:100860793-100860815 CTATAGGAAGGTTTGTGTGCAGG - Intronic
997114647 5:131112839-131112861 CTGTCAGAATGTGGCTCTGCAGG - Intergenic
998052671 5:139049070-139049092 CTGTCAGAAGGTCACTCAGCTGG - Intronic
998734002 5:145113945-145113967 TTGAACGAAGGTTTCCCTGCTGG - Intergenic
1001751073 5:174131852-174131874 CAGGAAGAAACTTTCTCTGCAGG + Intronic
1002292433 5:178209121-178209143 CTGTCGGAAGGGTTCTCTGCTGG + Intronic
1003094093 6:3129053-3129075 GTTTAAGAAGGTTTCTCTGCTGG + Exonic
1003571582 6:7259705-7259727 CTGTTTGATGATTTCTCTGCTGG - Intergenic
1004573063 6:16866879-16866901 GTGTAAGAATTTTTCTTTGCTGG - Intergenic
1005832579 6:29682328-29682350 CTGTCACAAGGTTTATCAGCAGG - Intergenic
1007122242 6:39392372-39392394 CTGTGAGAACATTTCTCTGCTGG + Intronic
1008391873 6:50961488-50961510 CTTTAAGAATGTTTCTCTGTTGG + Intergenic
1013364978 6:109430259-109430281 CTACAAGAAGGTTTCTGAGCAGG + Intronic
1015795814 6:137009902-137009924 CTGTAAGAAGGTGTCTTTTAAGG - Intronic
1023000972 7:35807437-35807459 CTGTAAGAAGGTCTGCCTCCCGG + Intronic
1023300892 7:38769844-38769866 CTGTTAGAAAGATTCTCTGATGG - Intronic
1023849985 7:44145144-44145166 CTGTAAGAAGGCCTGTATGCTGG - Exonic
1025215608 7:57053466-57053488 CTTTAGGAAGCTTTCTCTTCTGG + Intergenic
1025626351 7:63225891-63225913 CTTTAGGAAGCTTTCTCTTCTGG + Intergenic
1025655769 7:63517235-63517257 CTTTAGGAAGCTTTCTCTTCTGG - Intergenic
1026207740 7:68272824-68272846 CTGGCAGAAGTTTTCTTTGCAGG - Intergenic
1026742971 7:72990427-72990449 CTGTCAAAAGGCTTCTGTGCTGG + Intergenic
1027029086 7:74875131-74875153 CTGTCAAAAGGCTTCTGTGCAGG + Intergenic
1027100764 7:75374651-75374673 CTGTCAAAAGGCTTCTGTGCAGG - Intergenic
1029189800 7:98763500-98763522 CTTTAATACGGTTTCTCTGGAGG - Intergenic
1030041045 7:105450163-105450185 GTATAAAGAGGTTTCTCTGCTGG - Intronic
1032597070 7:133252677-133252699 ATGAAAGAGGGGTTCTCTGCCGG - Intergenic
1036293036 8:7511691-7511713 CCGTGAGAATGTTTGTCTGCTGG + Intergenic
1036329525 8:7809309-7809331 CCGTGAGAATGTTTGTCTGCTGG - Intergenic
1037352891 8:17981296-17981318 TTGTAAGTTCGTTTCTCTGCTGG + Intronic
1041834544 8:62196944-62196966 CTGTCAGAAGGATACTCTGCTGG + Intergenic
1042335442 8:67625419-67625441 CTGTCAGAAAGTTTCTCTTTGGG + Intronic
1042997945 8:74721612-74721634 CTGTAAGAAGGCTATTCTTCTGG - Intronic
1044346420 8:91109642-91109664 ATATAAGAAGGATTCTCTACTGG - Intronic
1045035050 8:98170227-98170249 CTGCACGGAGGTTTCTCTCCCGG - Intergenic
1046208005 8:111028469-111028491 CTGTACGAATGTGTCTATGCAGG + Intergenic
1046249534 8:111611925-111611947 CTGTAAGCAGCTCTCACTGCAGG + Intergenic
1047105342 8:121725161-121725183 CATTAAAAAGTTTTCTCTGCAGG + Intergenic
1050262867 9:3859636-3859658 ATGTCAGAAGGTGTCTCTTCTGG - Intronic
1053411195 9:37917247-37917269 CTGTAAGCTGGCTCCTCTGCTGG + Intronic
1055041443 9:71877712-71877734 GTGTATGAAAGTTTTTCTGCTGG - Intronic
1058422400 9:104844351-104844373 CTGAAAGAAGGCTTCTCCTCTGG + Intronic
1059750223 9:117240639-117240661 CTGTTAGAAGGTTTATCTATGGG - Intronic
1059937929 9:119330351-119330373 CTGTAAGAAGTTTGGTATGCTGG - Intronic
1060095742 9:120787883-120787905 CTGGAAGAAGGTTTATTTGAAGG - Exonic
1062515053 9:136928884-136928906 CTAAGGGAAGGTTTCTCTGCAGG - Intronic
1186633499 X:11377048-11377070 CTGGAAGAATTTTGCTCTGCAGG - Intronic
1190082024 X:47364216-47364238 AGATAACAAGGTTTCTCTGCAGG + Intergenic
1193457773 X:81752501-81752523 CTGTCAGTAGATTTCTCAGCAGG - Intergenic
1198201906 X:134430060-134430082 CTGTAAGTGGGTTTTTATGCTGG + Intergenic
1198280423 X:135136279-135136301 CAATGAGGAGGTTTCTCTGCGGG - Intergenic
1198290536 X:135236235-135236257 CAATGAGGAGGTTTCTCTGCGGG + Intergenic
1198798529 X:140425654-140425676 CTCAAAGAAGGTTTCTCAGTAGG - Intergenic
1199196819 X:145041694-145041716 CTCTAAGCAGCTCTCTCTGCCGG - Intergenic