ID: 965770186

View in Genome Browser
Species Human (GRCh38)
Location 3:172173812-172173834
Sequence GCCCCACCCCTCCCCCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1319
Summary {0: 1, 1: 0, 2: 10, 3: 124, 4: 1184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965770186_965770195 16 Left 965770186 3:172173812-172173834 CCTGTCTGGGGGAGGGGTGGGGC 0: 1
1: 0
2: 10
3: 124
4: 1184
Right 965770195 3:172173851-172173873 CCCGATGTCCTAGGAATAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 93
965770186_965770192 7 Left 965770186 3:172173812-172173834 CCTGTCTGGGGGAGGGGTGGGGC 0: 1
1: 0
2: 10
3: 124
4: 1184
Right 965770192 3:172173842-172173864 GGGAAGCCTCCCGATGTCCTAGG 0: 1
1: 0
2: 1
3: 16
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965770186 Original CRISPR GCCCCACCCCTCCCCCAGAC AGG (reversed) Intronic
900019994 1:181571-181593 CCCCCCCCCCGCCCCCAGCCCGG - Intergenic
900102487 1:967766-967788 ACCCCACCCCTAACCCAGCCCGG - Intronic
900136868 1:1121506-1121528 GCCCCACCTCCTCCCCAGCCAGG + Intergenic
900363067 1:2299241-2299263 GCCCCCCCCCTCCCCGAGGCAGG - Intronic
900376891 1:2359031-2359053 GCTCCACCCCTGCCCTAGCCTGG + Intronic
900720799 1:4174615-4174637 GCAGCACCCCTCATCCAGACTGG - Intergenic
901030704 1:6305382-6305404 CCCCCACCTCCCTCCCAGACGGG + Intronic
901083643 1:6597647-6597669 GCCCCACCATCCCCCCAGACAGG - Intronic
901271005 1:7952920-7952942 CCCCCACCTCCCTCCCAGACGGG - Intergenic
901403636 1:9031784-9031806 CCCCAACCCCTCTCCGAGACTGG + Intergenic
901448233 1:9320912-9320934 GCCAAACCCCTCCCCCTGCCAGG + Intronic
901855823 1:12043485-12043507 CCCCCACCTCTCTCCCGGACGGG - Intergenic
902027497 1:13394910-13394932 CCCCCACCTCCCTCCCAGACGGG + Intergenic
902233487 1:15043093-15043115 GCCCCAGCCCCTCCCCAGGCTGG - Intronic
902472522 1:16658513-16658535 GCTCCAGCCCGCCCCCAGGCAGG + Intergenic
902486283 1:16748933-16748955 GCTCCAGCCCGCCCCCAGGCAGG - Intronic
902816371 1:18918855-18918877 ACCCCACCTGTCCCCCACACAGG + Intronic
902896831 1:19485318-19485340 ACCCCGCCCCTCCCCCACCCCGG + Intronic
903103408 1:21053352-21053374 CCCCCACCTCCCTCCCAGACGGG - Intronic
903164152 1:21509316-21509338 GCCCCAACCCCTCCCCAGCCCGG - Intergenic
903218474 1:21855725-21855747 GCCCCTCCCCTCCCACACCCAGG + Intronic
903539632 1:24089755-24089777 CCCCTACCCATCCCCCAGAGAGG + Intronic
903921374 1:26803516-26803538 CCCCCACCTCCCTCCCAGACGGG + Intergenic
904077353 1:27852951-27852973 CCCCCACCTCCCTCCCAGACGGG - Intergenic
904279700 1:29410091-29410113 GCCCCAGCCCCACCCCAGCCAGG - Intergenic
904496299 1:30888724-30888746 GCCACTCCCCGCCCCCAGCCTGG + Intronic
904532188 1:31176845-31176867 CCCCCACCTCTCTCCCGGACGGG - Intergenic
904536378 1:31202189-31202211 TCCCCACCCCTTCCCCAGCTGGG + Intronic
904607507 1:31705791-31705813 CTCCCACCCGTGCCCCAGACAGG + Intergenic
904618806 1:31763635-31763657 GCCCCCCCCCTCCCCCAGCCTGG - Intronic
904696930 1:32336106-32336128 GCCCCACCCCTCCGCCGGCCGGG - Exonic
904762947 1:32818176-32818198 TCCCCGCCCCTCCCCCAGTAGGG - Intronic
904773622 1:32894140-32894162 GCCCGACCCCTCCCCCAAAGGGG + Exonic
904784689 1:32974849-32974871 CCCCCACCTCTCTCCCGGACTGG + Intergenic
904813791 1:33180989-33181011 GCCCCGCCCCTTCCCCAGGCAGG + Intronic
905012241 1:34755432-34755454 GCCCCACTCCTCCCCAAGTAGGG + Intronic
905192152 1:36243881-36243903 CCCCCACCTCCCTCCCAGACGGG + Intronic
905515448 1:38558906-38558928 CCCCCTCCCTTCCCCCAGGCAGG + Intergenic
905599115 1:39234601-39234623 GCCCCACCTCCCTCCCGGACGGG + Intronic
905599139 1:39234650-39234672 CCCCCACCTCCCTCCCAGACGGG + Intronic
905990624 1:42334770-42334792 CTCCCGCCCCTCCCCCAGGCGGG - Intronic
906069623 1:43007546-43007568 GCCCCGGCCCCCCGCCAGACAGG + Intergenic
906136180 1:43502096-43502118 CCCCCACCTCCCTCCCAGACGGG - Intergenic
906204504 1:43979655-43979677 CCCCCACCCCGCCCCCACTCCGG + Intronic
906208382 1:43998970-43998992 GCCCCCCCCCTTCCCCCGCCAGG - Intronic
906216396 1:44043449-44043471 GCCCCACACCTCTCCCAACCTGG - Intergenic
906238662 1:44228165-44228187 TTCCTACCCCTCCCCCAGACAGG + Intronic
906399997 1:45497739-45497761 CCCCCACCTCCCTCCCAGACGGG - Intronic
906427365 1:45725145-45725167 CCCCCACCCCACTCCCGGACGGG - Intronic
906429152 1:45740507-45740529 CCCCCACCTCCCTCCCAGACAGG + Intronic
906479568 1:46191205-46191227 GCCCCATTCCTCTCCCAGAGAGG - Intronic
906741997 1:48192632-48192654 CCCCCACCTCCCTCCCAGACGGG - Intergenic
906761718 1:48383089-48383111 CCCCCACCTCCCTCCCAGACGGG + Intronic
906956836 1:50381784-50381806 CCCCCACCTCCCTCCCAGACGGG - Intergenic
907166329 1:52414761-52414783 GCCCCTCCCCTCGCCGAGAAAGG + Exonic
907345368 1:53773810-53773832 CACCCACAACTCCCCCAGACTGG + Intronic
907402043 1:54230184-54230206 GCGCCACCCCTCCCCCAGTCTGG - Intronic
907402587 1:54233696-54233718 CCCCCACCTCCCTCCCAGACGGG - Intronic
908186240 1:61655442-61655464 CCACCACCCCTTCCCCAGGCTGG + Intergenic
908468008 1:64415400-64415422 CCCCCACCTCCCTCCCAGACGGG - Intergenic
910408389 1:86914533-86914555 GCCCCGCCCCTCCCCCCGTTCGG - Intergenic
911351761 1:96762723-96762745 CCCCCACCTCCCTCCCAGACGGG + Intronic
911486644 1:98512771-98512793 CCCCCACCTCCCTCCCAGACGGG + Intergenic
912302943 1:108536112-108536134 CCCCCACCTCTCTCCCTGACGGG + Intergenic
912394304 1:109328906-109328928 GGCCCACCCCTGCACCAGGCTGG + Intronic
913681579 1:121190954-121190976 GCCCCAACCCTACCCCAGAGTGG + Intronic
914002135 1:143702875-143702897 CCCCCACCTCCCTCCCAGACGGG - Intergenic
914033414 1:143978591-143978613 GCCCCAACCCTACCCCAGAGTGG + Intergenic
914156031 1:145089380-145089402 GCCCCAACCCTACCCCAGAGTGG - Intronic
914760742 1:150596038-150596060 TCGCCTCCCCTCCCCCAGGCTGG - Intergenic
914908953 1:151769291-151769313 CCCCCACCTCCCTCCCAGACGGG + Intronic
915074186 1:153295383-153295405 ACCCCACCCCTCCACCAGAAGGG + Intergenic
915112830 1:153575328-153575350 CCCCCACCTCCCTCCCAGACGGG - Intergenic
915152855 1:153848973-153848995 ACCCCCCCCCTCCCCCAGACTGG + Intronic
915318593 1:155043535-155043557 GCCCCTCCTCTGCCCCGGACTGG + Intronic
915379985 1:155431648-155431670 CCCCCATCCCTCCCCCACAGTGG - Intronic
915517537 1:156421879-156421901 GCCCCGCCCCTCCCCCTTCCCGG + Intronic
915701876 1:157804071-157804093 GCCCCTCCCATCCCACAGAGGGG - Exonic
915840975 1:159212796-159212818 GCACCACCCCTGCCCTGGACAGG + Intergenic
916028496 1:160855961-160855983 GCCCCACACCTTCCTCCGACTGG - Intronic
916484918 1:165250070-165250092 CCCCCACCCCACCCCCTGACAGG - Intronic
916944437 1:169711721-169711743 TCCCCACCCCTTTCCTAGACTGG + Intronic
917240343 1:172941266-172941288 GCCCCACTCCTCAACCAGCCTGG - Intergenic
917375735 1:174349463-174349485 CCCCCACCTCCCTCCCAGACAGG + Intronic
917375857 1:174349739-174349761 CCCCCACCTCCCTCCCAGACGGG + Intronic
917582838 1:176396083-176396105 CCCCCACCTCCCTCCCAGACGGG + Intergenic
917583108 1:176396738-176396760 CCCCCACCTCCCTCCCAGACGGG + Intergenic
917897345 1:179504670-179504692 GCGCCACCCCATCCCCTGACTGG + Intronic
920053587 1:203177710-203177732 GGGCCACCCTTCCCCCAGCCGGG - Intergenic
920468895 1:206209472-206209494 GCCCCAACCCTACCCCAGAGTGG + Intronic
921044081 1:211460844-211460866 CCCCCACCTCCCTCCCAGACGGG - Intergenic
921142676 1:212321372-212321394 CCCCCACCTCCCTCCCAGACGGG + Intronic
921198112 1:212779214-212779236 CCCCCACCTCCCTCCCAGACGGG - Intronic
921638432 1:217524083-217524105 CCCCCACCTCCCTCCCAGACGGG + Intronic
921692383 1:218165310-218165332 GCCCCCCACCTCCCCCTGCCCGG - Intergenic
921834423 1:219763004-219763026 GCCCCCCCACCCCCCAAGACAGG - Intronic
922102723 1:222488378-222488400 ACCCCACCTCCCTCCCAGACGGG - Intergenic
922558455 1:226549992-226550014 GCCCCTCCCCTCCTCCAGCTTGG + Intronic
922632920 1:227133195-227133217 CCCCCACCTCCCTCCCAGACGGG - Intronic
922801239 1:228365657-228365679 GTCCCAGCCCTGCCCCAGCCTGG + Intronic
923086297 1:230705861-230705883 TCCCCACCCCGCCCCCAGCCTGG + Intronic
924775839 1:247114048-247114070 GCCCCAACCTTGACCCAGACAGG - Intergenic
1062933604 10:1368884-1368906 GCCCCCACCCTCACCCAGCCCGG - Intronic
1062958262 10:1554235-1554257 GGCCCACCCCTGCCCCTGGCTGG - Intronic
1063141954 10:3263680-3263702 GCCCAGCCCATACCCCAGACCGG + Intergenic
1063187378 10:3663640-3663662 GCCCCACACCTTCCACAGATGGG + Intergenic
1063375977 10:5554374-5554396 GCGTCTCCCCTCCCCCAGCCAGG + Intergenic
1064334785 10:14429191-14429213 CCCCCACCCCGCCCCCCGAAAGG - Intronic
1064974838 10:21102975-21102997 CCCCCACCCCACTTCCAGACAGG + Intronic
1065110809 10:22437819-22437841 TCTCCACGCCTCCCCCAGGCCGG - Intronic
1065288351 10:24206813-24206835 GACCCTCCCCTCCCCCATACGGG - Intronic
1065603493 10:27393129-27393151 GCCCCACCCCTACCCCTTCCAGG + Intergenic
1065699499 10:28411170-28411192 TCCCCACCCTTCCCAAAGACTGG + Intergenic
1065738091 10:28772027-28772049 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1065840399 10:29696803-29696825 GCCCCACCTCCCTCCCGGACGGG - Intronic
1065919014 10:30374630-30374652 GCCCCTCCCCTCTCCCAGAGTGG - Intergenic
1067008880 10:42691353-42691375 ACCCCAACCCGCCCCCACACTGG + Intergenic
1067010976 10:42713456-42713478 CCCCCACCCCACCCCACGACAGG - Intergenic
1067117375 10:43446264-43446286 GCGCCACCCACCTCCCAGACGGG + Intronic
1067441871 10:46313092-46313114 GCCAGGCCCCTCCCCCAGAGGGG + Intronic
1067722723 10:48741671-48741693 GCATCACCCCTCCCCCAGATAGG + Intronic
1067732873 10:48825109-48825131 TCCCCACCCCACCCACTGACAGG + Intronic
1068005923 10:51392816-51392838 CCCCCACCTCCCTCCCAGACAGG + Intronic
1068005946 10:51392865-51392887 CCCCCACCTCCCTCCCAGACGGG + Intronic
1068363805 10:56016730-56016752 CCCCCACCCCACCTCCTGACAGG - Intergenic
1068783312 10:60944238-60944260 CCCCCACCCCGCTCCCAGGCGGG + Exonic
1069052587 10:63811407-63811429 ACCCCACCTCCCTCCCAGACGGG + Intergenic
1069358190 10:67611992-67612014 CCCCCTCTCCTCCCCGAGACTGG - Intronic
1069467635 10:68656068-68656090 GTCCCACCTCACCCCCAGATGGG + Intronic
1069565081 10:69458662-69458684 GGTCCTCCCCTCCCCCAGTCTGG + Intronic
1069645401 10:69992966-69992988 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1069698914 10:70407736-70407758 CCCCCACCTCCCTCCCAGACGGG + Intronic
1069733025 10:70631357-70631379 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1069741291 10:70687693-70687715 CCCCCACCTCCCTCCCAGACGGG + Intronic
1069864746 10:71495034-71495056 GCCCCAGCCCTGCCCCTGAGTGG + Intronic
1069928864 10:71869471-71869493 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1069928984 10:71869744-71869766 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1069929987 10:71875782-71875804 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1069930011 10:71875831-71875853 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1070135535 10:73689967-73689989 CCCCCACCTCCCTCCCAGACGGG - Intronic
1070479503 10:76868657-76868679 ATCCCAACCCTCCCCCAGACTGG + Intergenic
1070591757 10:77806724-77806746 GCCCCACCCCACCCCAGGCCCGG + Intronic
1070819535 10:79346843-79346865 CCCCCAGCCCTCCCCAGGACTGG - Intergenic
1070966479 10:80534200-80534222 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1071482305 10:86073947-86073969 TCCCCCACCCTCCCCCAGACTGG - Intronic
1071674907 10:87646437-87646459 TCCCCTCCCCTCTCCCATACCGG - Intergenic
1072013345 10:91323222-91323244 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1072149684 10:92674696-92674718 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1072291763 10:93970932-93970954 CCCCCACCTCCCCCCCGGACGGG - Intergenic
1072480860 10:95809382-95809404 GCGCCCCCCACCCCCCAGACGGG + Intronic
1072772469 10:98152928-98152950 CCCCCACCTCTCTCCCGGACAGG - Intronic
1073000071 10:100278142-100278164 CCCCCACCTCCCTCCCAGACGGG - Intronic
1073146765 10:101286226-101286248 CCCCACCCCCACCCCCAGACTGG + Intergenic
1073180282 10:101579238-101579260 TGCCCAGCCCTCTCCCAGACAGG - Exonic
1073238226 10:102036098-102036120 CCCCCACCTCCCTCCCAGACGGG - Intronic
1073556650 10:104459602-104459624 CCCCCACCCCACCCCCTGACAGG + Intergenic
1073563248 10:104514932-104514954 CCCCCACCCTGCCCCCAGTCTGG + Intergenic
1074152025 10:110767170-110767192 CCCCCACCTCCCTCCCAGACGGG + Intronic
1075137137 10:119795135-119795157 CCCCCACCTCCCTCCCAGACGGG + Intronic
1075967010 10:126621951-126621973 GCCCCACACCACCCCCTAACTGG + Intronic
1076003706 10:126931583-126931605 GCCCCACCCCAACCCCAGTGGGG - Intronic
1076420921 10:130331066-130331088 TCCCCACCCCTCCCCCACCATGG + Intergenic
1077107644 11:848945-848967 ACCCCACCCCACCCCTTGACAGG - Intronic
1077145763 11:1043537-1043559 ACCCCAACCCTCCCCCAGATAGG + Intergenic
1077150021 11:1068505-1068527 TCCCCACCCATCACCCACACAGG - Intergenic
1077236942 11:1486410-1486432 TACACACCCCTCCCCCAGCCAGG + Intronic
1077734403 11:4773787-4773809 CCCCCACCTCACCCCCTGACGGG + Intronic
1078092863 11:8278113-8278135 GCCCCACCCCTGCCCCATGATGG + Intergenic
1078380530 11:10836068-10836090 TCCCCACCAATCCCCCATACTGG + Intronic
1079020591 11:16907096-16907118 CCCCCACCTCCCTCCCAGACAGG - Intronic
1079103034 11:17553222-17553244 GCTCCACCCCACCCCCAGGAAGG + Intronic
1079112478 11:17612602-17612624 GCCCTGCCCCTCCCCCAGGCCGG + Exonic
1079277305 11:19053210-19053232 CCCTCACCCCACCCCCCGACAGG + Intergenic
1079367019 11:19818150-19818172 CCCCTACCCCTCCCCCAAACTGG - Intronic
1079371986 11:19860175-19860197 CCCCCACCTCCCTCCCAGACGGG + Intronic
1079377830 11:19909556-19909578 TCCCCACCTCTTCCCCAGCCAGG - Intronic
1080098177 11:28430707-28430729 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1080860353 11:36145364-36145386 CCCCCACCTCCCTCCCAGACGGG - Intronic
1081288942 11:41304555-41304577 CCCCCACCTCCCTCCCAGACGGG - Intronic
1081288966 11:41304604-41304626 CCCCCACCTCCCTCCCAGACGGG - Intronic
1081289034 11:41304751-41304773 CCCCCACCTCCCTCCCAGACGGG - Intronic
1081653733 11:44842927-44842949 CCCCCACCCTTCCCCCAACCAGG + Intronic
1081950206 11:47038159-47038181 CCCCCACCTCCCTCCCAGACGGG + Intronic
1081950408 11:47038637-47038659 CCCCCACCTCTCTCCCGGACGGG + Intronic
1082129494 11:48471097-48471119 GACCCACCCCACTGCCAGACTGG - Intergenic
1082245044 11:49911770-49911792 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1082846801 11:57732821-57732843 GCCCCACCCCACCCCCCACCAGG - Intronic
1083067832 11:59944146-59944168 GCCACACCCCTCTCCCAGGGTGG - Intergenic
1083079140 11:60073105-60073127 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1083154629 11:60815361-60815383 CCCCCACCTCCCTCCCAGACAGG - Intergenic
1083208228 11:61166393-61166415 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1083335121 11:61917604-61917626 GCCCCGCCCCTCCGCCGGCCCGG + Intronic
1083571866 11:63765431-63765453 CACCCACACCTCCCCCAGACTGG + Intronic
1083620526 11:64047190-64047212 TCCCCTCCCCTGCCCCAGAGAGG + Intronic
1083814870 11:65127002-65127024 ACCCCACCCTGCCCCCAAACTGG + Exonic
1083865672 11:65451654-65451676 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1084049084 11:66588180-66588202 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1084411117 11:69006330-69006352 ACCCCCCCCCTCCCCCACGCTGG - Intronic
1084624402 11:70295742-70295764 CCCCCACCTCCCTCCCAGACGGG + Intronic
1084689300 11:70715859-70715881 ACCCCACCCCTCCTCCCCACTGG - Intronic
1084745490 11:71167421-71167443 CCCCCACCTCCCTCCCAGACGGG + Intronic
1084782891 11:71422691-71422713 CCCCCACCCCACCCCCTGACAGG - Intergenic
1084861031 11:72018339-72018361 GCCCCTCCCCTCACCCAGCCAGG - Intronic
1085022406 11:73217937-73217959 GTCCCGCCCCTGCCCCAGCCCGG - Intergenic
1085097829 11:73775232-73775254 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1085284440 11:75350779-75350801 GCCCCCCGCCACCCCCAGCCTGG - Intronic
1085360086 11:75877964-75877986 CCCCCACCTCCCTCCCAGACGGG + Intronic
1085563280 11:77490439-77490461 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1085592585 11:77778093-77778115 TCCCCTCCCCTTCCCAAGACAGG - Intronic
1085793997 11:79520200-79520222 ACCCCACCCCTACCTAAGACAGG - Intergenic
1086366197 11:86111009-86111031 ACCCCACCTCCCTCCCAGACGGG - Intergenic
1086430587 11:86732505-86732527 CCCCCACCTCCCTCCCAGACAGG - Intergenic
1086612860 11:88778162-88778184 GCGACACCCCTCCCCCAGCCAGG + Intronic
1086881712 11:92158220-92158242 GCCCCACCTCGCTCCCGGACGGG - Intergenic
1086976938 11:93142938-93142960 CTCCCACCCCACCCCCAAACAGG - Intergenic
1087701542 11:101441358-101441380 GCCCCCCATCTCCCCAAGACTGG + Intergenic
1088243850 11:107797736-107797758 GCCACAGCCCTCCCCAAGACAGG + Intronic
1088672201 11:112153164-112153186 GCCCCACCCCACCACCAACCCGG + Intronic
1088893100 11:114059805-114059827 GCAACACCCCTCCCCGACACAGG + Exonic
1089284604 11:117397343-117397365 TCCCCCCGCCTCCCCCACACAGG - Intronic
1089432797 11:118436994-118437016 CCCCCTCCCCTCCCCCATCCGGG + Intronic
1089564818 11:119365061-119365083 GCCCCACCCCTCCACCTAACAGG + Intronic
1089653822 11:119932872-119932894 GCCCCATCCCTCACCCTGACAGG + Intergenic
1090181581 11:124704640-124704662 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1090299923 11:125626290-125626312 GCCCCACCCGTCCCAAAGGCCGG - Intronic
1090608736 11:128451474-128451496 GACGCACCCCTCCCCTAGGCAGG - Intergenic
1091373374 12:11185-11207 CCCCCCCCCCGCCCCCAGCCCGG - Intergenic
1091438068 12:489156-489178 CCCCCACCCCAACCCCTGACAGG - Intronic
1091753816 12:3038992-3039014 TCCTCACCCCTTCCCCAGATTGG + Intronic
1091816555 12:3443334-3443356 GCCTCCCCCATCCCCCAAACCGG + Intronic
1092010918 12:5111914-5111936 TGCCCCCCTCTCCCCCAGACTGG + Intergenic
1092184814 12:6470903-6470925 GCCCCGTCCCTCCGCCAGACTGG - Intronic
1092331261 12:7589813-7589835 CCCCCACCTCCCTCCCAGACTGG + Intergenic
1092843867 12:12566266-12566288 CCCCCACCTCCCTCCCAGACAGG - Intergenic
1094111894 12:26870778-26870800 GCCCCTCCCTTGCCCCAGCCTGG - Intergenic
1094454252 12:30614581-30614603 CCCCGACCCCTCCCTCCGACAGG + Intergenic
1094722458 12:33078293-33078315 CCCCCACCCCACCTCCTGACAGG + Intergenic
1095308789 12:40669930-40669952 CCACCACCCCTTCCCCACACAGG - Intergenic
1095432087 12:42144911-42144933 ACCCCGCCCCTCCCCCGGGCGGG + Intergenic
1095632873 12:44398600-44398622 TGCCCACCCCACCCCCACACAGG + Intergenic
1095884796 12:47177598-47177620 CCCCCACCCCACCACCAGGCTGG - Intronic
1095970968 12:47901822-47901844 GCCCCACCCCAACCTCAGACAGG - Intronic
1096051137 12:48609104-48609126 CCCCCACCTCACCCCCTGACAGG + Intergenic
1096075226 12:48799984-48800006 CCCCCACCCCGCCCCCACACTGG + Intergenic
1096167557 12:49437013-49437035 CCCCCACCTCCCTCCCAGACGGG + Intronic
1096189342 12:49605161-49605183 GCCCCAGCCCTGCCTCAGGCGGG + Intronic
1096505404 12:52089303-52089325 GCCCCACCCGACCCCCCTACAGG - Intergenic
1096515290 12:52152284-52152306 TCCCCTCCCCTACCCCAGGCGGG + Intergenic
1096796767 12:54082610-54082632 CCGCCTCCCCTCCCCCAGCCCGG - Intergenic
1096870355 12:54588697-54588719 CCCCTCCCCCTCCCCCAGCCCGG + Intergenic
1096972342 12:55677704-55677726 CCCCCACCCCACCCCACGACAGG - Intergenic
1097110054 12:56651766-56651788 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1097149215 12:56963882-56963904 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1097189598 12:57213099-57213121 GCTCAACCCCCCTCCCAGACAGG + Exonic
1097233313 12:57524985-57525007 GCCCCACCCCAGCCCCACCCGGG - Exonic
1097356225 12:58605052-58605074 ACCCCCCCCCACCCCCCGACAGG - Intronic
1098019180 12:66135290-66135312 CCCCCACCTCCCTCCCAGACTGG - Intronic
1098019229 12:66135417-66135439 CCCCCACCTCCCTCCCAGACGGG - Intronic
1098412801 12:70202371-70202393 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1098733880 12:74071992-74072014 CCCCCACCCCACCCCCGGACAGG - Intergenic
1099013748 12:77321930-77321952 TCACCACCCCTCTCCCAGAAGGG - Intergenic
1099640599 12:85279727-85279749 TCCCCACCCCGCCCCCATGCCGG - Intergenic
1099753377 12:86807274-86807296 CCCCCACTCCACCCTCAGACAGG + Intronic
1100582424 12:95948342-95948364 CCCCCACCTCCCTCCCAGACGGG - Intronic
1100655143 12:96635990-96636012 GCCCCACCCCTCCCACCTCCTGG - Intronic
1100995096 12:100294530-100294552 CCCCCACCTCCCTCCCAGACCGG + Intronic
1101393427 12:104323586-104323608 CCCCCACCTCCCTCCCAGACGGG + Intronic
1102150715 12:110687841-110687863 GCCCCTGCCCTCCCCGACACAGG - Intronic
1102174873 12:110867582-110867604 CCCCCACCTCCCTCCCAGACGGG + Intronic
1102186254 12:110950825-110950847 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1102212590 12:111138123-111138145 GCCCCTCCCCTCGGCCAGCCTGG - Intronic
1102293963 12:111723327-111723349 CCCCCACCTCCCTCCCAGACGGG + Intronic
1103014400 12:117482540-117482562 CTCCCACCCCTGCCCCAGCCAGG - Intronic
1103144108 12:118579314-118579336 ACCCCACCCCACCCCATGACAGG + Intergenic
1103457389 12:121076934-121076956 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1103457413 12:121076983-121077005 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1103758917 12:123233669-123233691 GCCCCACCCCACCGCCAGCGCGG - Intronic
1103896133 12:124274477-124274499 CGCCCTCCCCTCCCCCAGAAGGG - Intronic
1103944176 12:124517251-124517273 GCCCCCTCCCTTCCCCAGCCTGG + Intronic
1104010141 12:124924584-124924606 ACCCCACCCCACCCCCACTCAGG + Intergenic
1104078619 12:125411353-125411375 GCCCCCCCCCACCCTCTGACAGG - Intronic
1104712558 12:130996664-130996686 CCCCCACCTCCCTCCCAGACGGG + Intronic
1104997091 12:132664839-132664861 GGCCCAACCCTCCTCCAGCCTGG + Intronic
1105248523 13:18674065-18674087 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1105322663 13:19343888-19343910 CCCCACCCCCTCCCCCCGACAGG - Intergenic
1105367929 13:19779714-19779736 CCCCCACCTCCCTCCCAGACAGG - Intronic
1105520227 13:21124745-21124767 CCCCCCCCCCGCCCCCCGACAGG + Intergenic
1105546912 13:21357457-21357479 GCCCCACCCATCTCCGAGTCTGG + Intergenic
1106559981 13:30839305-30839327 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1107071729 13:36277306-36277328 CCCCCACCCTACCCCCTGACAGG - Intronic
1107165843 13:37280424-37280446 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1107498870 13:40955259-40955281 CCCCCACCTCCCTCCCAGACGGG - Intronic
1107530304 13:41276742-41276764 GCTCCTCTCCTCCCCCAGCCTGG - Intergenic
1107562743 13:41572205-41572227 CCCCCACCTCCCTCCCAGACGGG - Intronic
1107735093 13:43391065-43391087 TCCCCACAGCTCCCCCAGAACGG + Intronic
1107946013 13:45418312-45418334 GCCCCACACCTCCTCCAACCCGG + Exonic
1108173422 13:47767683-47767705 CCCCCACCCCCACCCCAAACAGG + Intergenic
1108608839 13:52064480-52064502 CCCCCACCTCCCTCCCAGACGGG - Intronic
1110893988 13:80726336-80726358 TCCCCTCCCCTTCCCCTGACAGG + Intergenic
1110976887 13:81849107-81849129 GCCCCACCCCCACCCCTCACAGG + Intergenic
1112420459 13:99242735-99242757 CCCCCACCTCTCTCCCGGACGGG + Intronic
1112652646 13:101416123-101416145 TCCCCACCCCTCCCCCGCGCGGG + Intronic
1113102794 13:106738295-106738317 GCGACTCCCCTCCCCCTGACTGG + Intergenic
1113618352 13:111696612-111696634 GCCTGACCCCTGCCTCAGACTGG + Intergenic
1113758754 13:112833070-112833092 GCCCCTCCCCAGCCCCAGTCAGG + Intronic
1113841617 13:113364288-113364310 GCCCCGCCCCTCCCCCGCCCTGG - Intergenic
1113841669 13:113364394-113364416 GCCCCGCCCCTCCCCCGCCCTGG - Intergenic
1113909592 13:113835889-113835911 CCCCCACCCCTCCACCAAGCAGG - Intronic
1113936917 13:113999710-113999732 GCCCCACCCGGACCCCAGCCGGG - Intronic
1113957425 13:114106652-114106674 GCCCAACCCCTCCCCACGCCAGG - Intronic
1113963778 13:114140218-114140240 GCCCCACCCCTCCCTGAAGCAGG - Intergenic
1114507999 14:23232672-23232694 CCCCCACCTCCCTCCCAGACGGG - Intronic
1114508045 14:23232767-23232789 CCCCCACCTCCCTCCCAGACGGG - Intronic
1115847487 14:37555326-37555348 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1115847535 14:37555424-37555446 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1117133289 14:52707149-52707171 GCCCCGCCCCTTCCCCCGCCCGG + Intergenic
1117145573 14:52833852-52833874 CCCCCACCCCTCCCCCCTGCCGG + Intergenic
1117277191 14:54203732-54203754 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1117596872 14:57333785-57333807 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1118148852 14:63166223-63166245 GCCCCTCACCTCCCGGAGACGGG - Intergenic
1118428506 14:65692462-65692484 CCCCCACCTCCCTCCCAGACGGG + Intronic
1118428579 14:65692611-65692633 CCCCCACCCCCCTCCCAGACGGG + Intronic
1119254242 14:73184060-73184082 CCCCCACCTCCCTCCCAGACGGG + Intronic
1119835773 14:77747734-77747756 CCCCCACCTCCCTCCCAGACGGG - Intronic
1120406503 14:84099464-84099486 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1120619897 14:86750709-86750731 CACCCACCCCTTCCCCAGCCAGG + Intergenic
1121114346 14:91332917-91332939 GCCACACTCCACCCACAGACCGG + Intronic
1121616774 14:95319079-95319101 GCCCCACCCTTCCCCCACGCTGG - Intronic
1121656851 14:95603415-95603437 GCCCCTGCCCACTCCCAGACAGG - Intergenic
1122115003 14:99523191-99523213 GCCCCAGCCCAGCCCCAGCCTGG - Intronic
1122153221 14:99735723-99735745 TCCCCACCCCACCCACAGATAGG + Intergenic
1122190975 14:100043463-100043485 ACCCCACCCCACCCCCACCCTGG - Intronic
1122209583 14:100166018-100166040 CTCCCCCCACTCCCCCAGACAGG - Intergenic
1122209641 14:100166156-100166178 CTCCCCCCACTCCCCCAGACAGG - Intergenic
1122209687 14:100166271-100166293 CTCCCCCCACTCCCCCAGACAGG - Intergenic
1122312586 14:100806555-100806577 GCACCACCCCTGCCCCAGGCGGG - Intergenic
1122343741 14:101045381-101045403 GCCCCACCCCTGCCAGAGGCTGG - Intergenic
1122721419 14:103724548-103724570 GCCCCCTCCTTCCCCCAGAAGGG + Intronic
1122900954 14:104782176-104782198 ACCCCACCCGTCCCCCATCCTGG + Intronic
1122918860 14:104871386-104871408 CCCCCACCCCACGCACAGACAGG + Intronic
1122975989 14:105170982-105171004 GAGCCACCCGTCCCCCAGCCTGG + Intergenic
1122999205 14:105283259-105283281 GCCCCACACCCCACCCAGGCAGG + Intronic
1123056933 14:105575154-105575176 CGCCCACCCCTCCCCCAGGCAGG + Intergenic
1123081277 14:105696631-105696653 CGCCCACCCCTCCCCCAGGCAGG - Intergenic
1202848130 14_GL000009v2_random:200167-200189 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1123450273 15:20355593-20355615 GCCCCTCCCCTCCCTGACACTGG - Intergenic
1123683080 15:22776302-22776324 GCCCCGCCTCTCTCCCAGAGTGG - Intronic
1124132548 15:27003860-27003882 CCCCCACCTCCCTCCCAGACGGG + Intronic
1124334838 15:28848826-28848848 GCCCCGCCCCTCTCCCAGAGTGG - Intergenic
1124405716 15:29389905-29389927 CCCCCACCCCTCCCTGATACCGG + Intronic
1124533682 15:30526099-30526121 CCCCCACCCCTCCCCCATGAGGG + Intergenic
1124562777 15:30791274-30791296 GCCCCTCCCCTCTCACAGAGTGG + Intergenic
1124819540 15:33030975-33030997 TCCCCACCCCACCCCCCGACAGG + Intronic
1124960533 15:34389970-34389992 GCCCCTCCCCTCTCTCAGAGTGG - Intronic
1124960542 15:34389996-34390018 GCCCCTCCACTCTCCCAGAGCGG - Intronic
1124977162 15:34536191-34536213 GCCCCTCCCCTCTCTCAGAGTGG - Intronic
1124977171 15:34536217-34536239 GCCCCTCCACTCTCCCAGAGCGG - Intronic
1125373863 15:39006996-39007018 ACCCCACCCCACCCCCTGACAGG - Intergenic
1125589965 15:40847821-40847843 GCCCCACCAGGCCCCCAGAGTGG - Intronic
1126295552 15:47132951-47132973 CCCCCACCTCCCCCCCTGACTGG - Intergenic
1126516976 15:49549968-49549990 CCCCCACCTCCCTCCCAGACGGG + Intronic
1127154186 15:56110073-56110095 CCCCCACCTCCCTCCCAGACGGG - Intronic
1127154414 15:56110574-56110596 CCCCCACCTCCCTCCCAGACGGG - Intronic
1127154492 15:56110751-56110773 CCCCCACCTCCCTCCCAGACGGG - Intronic
1127154595 15:56111006-56111028 CCCCCACCTCCCTCCCAGACGGG - Intronic
1127709915 15:61586613-61586635 GCCCCCCACCTCCAACAGACTGG - Intergenic
1127983338 15:64050222-64050244 GCCCCATCCCACCCCTAGCCTGG + Intronic
1128063891 15:64752313-64752335 GCTCCTCCCCTCGACCAGACTGG - Intronic
1128148219 15:65344515-65344537 CCCCCACCTCTCCCCCATCCAGG - Intronic
1128489617 15:68134370-68134392 CCCCCACCTCCCTCCCAGACAGG + Intronic
1128489699 15:68134576-68134598 GCGCCCCCCACCCCCCAGACGGG + Intronic
1128527383 15:68421695-68421717 CCCCCACCCCCCACCCAGGCTGG - Intronic
1128582263 15:68818508-68818530 GCCCCACCCCGCCTCCAGGCAGG + Intronic
1128640496 15:69332677-69332699 TCCCCACCCCACCCCCACCCCGG + Intronic
1128688183 15:69702787-69702809 ACCCCAACCCAGCCCCAGACTGG + Intergenic
1128934902 15:71738013-71738035 GATCCACCCGTCCCCCACACAGG - Intronic
1128970533 15:72101671-72101693 CCCCCACCTCCCTCCCAGACGGG - Intronic
1129028952 15:72604919-72604941 GCCCCTCCCCTCTCCCAGAGTGG + Intergenic
1129110478 15:73334275-73334297 GCCCCAGCCCAGCCACAGACCGG - Intronic
1129431737 15:75504622-75504644 CCCCCACCTCCCTCCCAGACGGG - Intronic
1129463867 15:75712987-75713009 CCCTCACCCCTGCCCCAGAGAGG - Intergenic
1129474388 15:75775349-75775371 GCCCCACCCCTCTCCCCAAGTGG + Intergenic
1129521968 15:76191865-76191887 TCCCCACCCCGCCCCCATGCAGG + Intronic
1129692760 15:77723146-77723168 CCCCGCCCCCACCCCCAGACAGG + Intronic
1129730362 15:77927048-77927070 GCCCCGCCCCTCTCCCCGAATGG - Intergenic
1129774124 15:78223272-78223294 CCCCCACCCCACCCCCCAACAGG - Intronic
1130010869 15:80152550-80152572 GCCCCGCCCCTCCCCTGGCCCGG - Intronic
1130064028 15:80590139-80590161 GCCCCACCCAACCCCCAGCCTGG - Intronic
1130260450 15:82349644-82349666 GCCCTTCCCCTCTCCCAGAGTGG - Intergenic
1130268281 15:82429789-82429811 GCCCCTCCCCTCTCCCAGAGTGG + Intergenic
1130280782 15:82519360-82519382 GCCCTTCCCCTCTCCCAGAGTGG + Intergenic
1130428273 15:83822133-83822155 CCCCCACCTCCCTCCCAGACGGG + Intronic
1130472153 15:84235543-84235565 GCCCTTCCCCTCTCCCAGAGTGG + Intergenic
1130479646 15:84350114-84350136 GCCCTTCCCCTCTCCCAGAGTGG + Intergenic
1130492124 15:84438015-84438037 GCCCTTCCCCTCTCCCAGAGTGG - Intergenic
1130503741 15:84517051-84517073 GCCCTTCCCCTCTCCCAGAGTGG - Intergenic
1131257029 15:90869750-90869772 GCCCCACCCATCCTGGAGACTGG - Intronic
1131515091 15:93072098-93072120 GCCTCCCCCCTCCCCCCGAAAGG + Intronic
1131692657 15:94844271-94844293 CCCCCACCCATGCCCCAGGCCGG - Intergenic
1131849506 15:96523953-96523975 TCCCCTCCCCTCCCCCATCCAGG - Intergenic
1132036966 15:98493031-98493053 CCCCCACCTCCCTCCCAGACGGG + Intronic
1132184282 15:99790839-99790861 GCCCCTCCCCTCTCCCAGAGGGG + Intergenic
1132434093 15:101782311-101782333 GCCCCTCCCCTGTCCCAGAGTGG - Intergenic
1132496962 16:268462-268484 GCCTCACCAGTCCCCCAGACTGG - Exonic
1132553050 16:561041-561063 CCCCCAGCTCTCCCCCAAACAGG + Intronic
1132575240 16:661000-661022 GCCCCCCCCCCCCCCCGGCCCGG + Intronic
1132598118 16:762395-762417 CGCCCACCCCTCTCCCAGAAGGG - Intronic
1132642601 16:984643-984665 GCCCCACCCGCCCCACAGAAGGG + Intronic
1132766527 16:1537160-1537182 GCCCCACCCCGACCCTAGACTGG - Intronic
1132836967 16:1959010-1959032 CTCCCTGCCCTCCCCCAGACAGG + Intergenic
1132861140 16:2072373-2072395 CCCCCACCCCAACCCCAGGCCGG - Intronic
1133019711 16:2961975-2961997 GGCCGACCCCTGCCCCAGTCTGG + Intergenic
1133074750 16:3271481-3271503 CCCCCACCTCTCTCCCGGACGGG + Intronic
1133204025 16:4222128-4222150 GCCACTCCCTTCCCCCAGCCTGG + Intronic
1133221241 16:4320000-4320022 CCCCCACCCATCCCCCAGCAGGG - Intronic
1133222360 16:4324178-4324200 GCCCCTCCCCCTCCCAAGACGGG - Intronic
1133304926 16:4802704-4802726 GTACCACCCCGCCCCCAGGCCGG + Exonic
1134059601 16:11191201-11191223 GCCCCACCCCGCCCCCACCTTGG + Intergenic
1134854271 16:17505951-17505973 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1135639577 16:24109037-24109059 CCCCCACCTCTCTCCCAGATGGG + Intronic
1136103867 16:28014939-28014961 GCCCCTGCCCTGCCCCAGCCAGG + Intronic
1136258827 16:29060255-29060277 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1136668595 16:31836612-31836634 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1136668619 16:31836661-31836683 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1136685693 16:31993737-31993759 CCCCCATCCCTCCCCCCGATTGG + Intergenic
1136786307 16:32937270-32937292 CCCCCATCCCTCCCCCCGATTGG + Intergenic
1136834880 16:33493522-33493544 GCCCCATCCCCCACCCAGGCTGG + Intergenic
1136883468 16:33916525-33916547 CCCCCATCCCTCCCCCCGATTGG - Intergenic
1137522980 16:49210340-49210362 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1137787959 16:51152527-51152549 GCCCCTCCCCTCCCCCCGGCCGG - Intergenic
1138037775 16:53625462-53625484 GCCCCCCCCAGCCCCCAGATGGG - Intronic
1138043641 16:53698748-53698770 CCCCCACCTCCCTCCCAGACGGG - Intronic
1138467245 16:57201062-57201084 CCCCCACCTCCCTCCCAGACGGG + Intronic
1138577907 16:57920338-57920360 GCCCCACCCCATCCCCATCCAGG + Intronic
1139352126 16:66343369-66343391 GGCCCTCCCCTCCCCCAGTAAGG + Intergenic
1139390874 16:66605558-66605580 GCGCCACCCCTACCCCACAGCGG - Intronic
1139474153 16:67194259-67194281 GCCTCACCCATCCCCCATAGTGG - Intronic
1139515024 16:67447604-67447626 GCCCCACCCCCACCCCACAAGGG - Intronic
1139885637 16:70205182-70205204 CCCCCACCTCCCTCCCAGACTGG - Intergenic
1140083889 16:71777183-71777205 ACCCCAGCCCACCCCCAGTCTGG + Intronic
1140163529 16:72525454-72525476 GCCCCACCCCACCCCACGATAGG + Intergenic
1140256889 16:73345389-73345411 CCCCCACCCCACCCCCCGACAGG + Intergenic
1140471679 16:75218910-75218932 CCCCCCCCGCTCCCCCAGCCAGG - Intergenic
1140481514 16:75265262-75265284 GAGCCACCCCTCCCCCAGGACGG - Intronic
1140616362 16:76669116-76669138 TCCCCATCCCACCCCCAGCCTGG + Intergenic
1140671026 16:77279364-77279386 GCCACCCCCCGCCCCCTGACAGG + Intronic
1140994162 16:80243483-80243505 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1140994429 16:80244117-80244139 CCCCCACCTCTCTCCCAGATGGG - Intergenic
1141151885 16:81570099-81570121 GCCTCACCCCTTCTGCAGACGGG + Intronic
1141405161 16:83786050-83786072 GCACCATCCCTCCTCCAGAGAGG + Intronic
1141512137 16:84519361-84519383 CCCCCACCCCAACCCCAGCCTGG + Intronic
1141628199 16:85272557-85272579 GCTCCACCCCTCCCACTGCCTGG - Intergenic
1142078136 16:88132192-88132214 CCCCCACCCCTACCCAGGACGGG + Intergenic
1142119479 16:88378911-88378933 GGCCCACGCCTGCCCCAGATGGG - Intergenic
1142202737 16:88768780-88768802 GCACCGCCCCCACCCCAGACTGG - Intronic
1142230774 16:88899276-88899298 GCCGCACCCCTGCCCCTGGCTGG - Intronic
1203009923 16_KI270728v1_random:230510-230532 GCCCCATCCCCCACCCAGGCTGG - Intergenic
1203088540 16_KI270728v1_random:1198936-1198958 CCCCCATCCCTCCCCCCGATTGG + Intergenic
1203093278 16_KI270728v1_random:1229981-1230003 CCCCCACACCTCCCCCACAAAGG + Intergenic
1203145046 16_KI270728v1_random:1793810-1793832 GCCCCATCCCCCACCCAGGCTGG + Intergenic
1142704973 17:1689211-1689233 CCCCCACCTCTCTCCCAGATGGG + Intergenic
1142725059 17:1807418-1807440 GCCCCCCCCGGCCCCCACACCGG + Intronic
1142949258 17:3464871-3464893 CCCCCACCCCCCTCCCAGACGGG - Intronic
1143026466 17:3944529-3944551 GCCCCTCCCTTTCCGCAGACAGG - Intronic
1143078527 17:4365605-4365627 GCTCCTACCCTCCCCCAGCCGGG + Intronic
1143152953 17:4818476-4818498 ACTCCACCCCCTCCCCAGACAGG + Exonic
1143503430 17:7351682-7351704 GCCCCACCCCTCGGCAGGACTGG - Intergenic
1143884838 17:10057611-10057633 TCCCCACCTCCCTCCCAGACGGG - Intronic
1143900420 17:10170310-10170332 GCCCCACCCACCCCTCAGTCTGG + Intronic
1143947371 17:10605159-10605181 GCCCACCCCCACCCCCAAACTGG + Intergenic
1144432464 17:15206764-15206786 CTCCCACCCCACCCCCTGACAGG - Intergenic
1144947942 17:18979310-18979332 GCCACACCCCACCTCCAGGCCGG + Intronic
1145157735 17:20554075-20554097 AACCCACCCCTCCCCCACCCTGG + Intergenic
1145205541 17:20983258-20983280 ACCCCACCCCGCCCCCACCCAGG - Intergenic
1145684354 17:26638648-26638670 CCCCCACCTCCCTCCCAGACAGG - Intergenic
1145684544 17:26639079-26639101 CCCCCACCTCCCTCCCAGACAGG - Intergenic
1145911658 17:28546813-28546835 GCCCCATCCCTCCCCATGAGGGG - Exonic
1145978219 17:28996451-28996473 ACCCCTCCCCTCCCCCACTCAGG - Intronic
1146058785 17:29593787-29593809 GCCGCACCCCCTCCCCAGGCCGG - Intronic
1146062381 17:29614085-29614107 GCCCAGCCCCTCCCCCACCCCGG + Exonic
1146176556 17:30669114-30669136 CCCCCACCCCATCCCCAGCCCGG + Intergenic
1146350018 17:32085229-32085251 CCCCCACCCCATCCCCAGCCCGG + Intergenic
1146444218 17:32922388-32922410 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1146724676 17:35147688-35147710 GGCCCTCCCCCTCCCCAGACTGG - Intergenic
1146731238 17:35195109-35195131 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1146846064 17:36182945-36182967 GCCCCGACCCCTCCCCAGACCGG + Intronic
1147285784 17:39401766-39401788 AGACCACCCCTCCCCCACACGGG + Intronic
1147310054 17:39590377-39590399 CCCCCACCCCACCCTCTGACAGG - Intergenic
1147318434 17:39632136-39632158 TCCCCAGCCTTGCCCCAGACTGG - Intronic
1147575391 17:41595999-41596021 CCCACCTCCCTCCCCCAGACGGG + Intergenic
1147677983 17:42220439-42220461 GCCCCATCCCTCCCGCAGCAAGG + Intronic
1147688068 17:42299133-42299155 GCCCCATCCCTCCCGCAGCAAGG - Intronic
1147709080 17:42449345-42449367 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1147744673 17:42687877-42687899 GCCCAGCCCGTCCCCCAGACGGG - Exonic
1147974487 17:44238897-44238919 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1148299525 17:46534829-46534851 CCCCCACCTCCCTCCCAGACAGG + Intronic
1148632857 17:49125685-49125707 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1148636087 17:49150278-49150300 CCCCCACCTCCCTCCCAGACGGG - Intronic
1148850142 17:50550636-50550658 CCCCAACCCCTCCCACAGCCAGG - Intronic
1148853364 17:50565491-50565513 GCCTCACCCATCCCACAGAGAGG - Intronic
1148861336 17:50605810-50605832 GCCCCACCCCCACGCCAGCCTGG - Intronic
1149109862 17:53015569-53015591 CCCCCACCCCACCCCCTTACAGG - Intergenic
1149455406 17:56783977-56783999 CCCCCATCCCACCCCCTGACAGG + Intergenic
1149780613 17:59394196-59394218 CCCCCACCTCCCTCCCAGACAGG + Intronic
1149845366 17:60006428-60006450 CCCCCACACCTCCCCCAGCCTGG + Intergenic
1150213937 17:63456636-63456658 GCCCCACCTCCCTCCCGGACGGG - Intergenic
1150216960 17:63476554-63476576 GCCACACCCCTACCCCCGGCAGG + Intergenic
1150527419 17:65937725-65937747 CCCCCACCCCCCTCCCAGACTGG - Intronic
1150527441 17:65937775-65937797 CCCCCACCCCCCTCCCAGACGGG - Intronic
1150638466 17:66933171-66933193 GCCCCTCCCCAACCCCAGGCTGG - Intergenic
1151419424 17:73987519-73987541 AGGCCACCCCTCCCGCAGACAGG + Intergenic
1151668205 17:75557608-75557630 TCCATACCCCTCCCCCACACCGG - Intronic
1151758823 17:76089370-76089392 GACCCACGCCGCCCCCAGCCAGG - Intronic
1151821282 17:76498243-76498265 CCGCCACTCCTCCCCCAGCCTGG + Intronic
1151894723 17:76972298-76972320 GCCCCATACCTGCCCCAGGCTGG + Intergenic
1151956177 17:77381288-77381310 GCCTCTCCCCTCCCCCAGGCAGG + Intronic
1151957169 17:77386230-77386252 CCCCCACCCCTCCTGCAGAGGGG + Intronic
1151986695 17:77548429-77548451 GCCCCACCCCCTCCCCAGGTGGG + Intergenic
1152160342 17:78664754-78664776 CGCCCACCCCTCTCCCAGCCAGG - Intergenic
1152235358 17:79135636-79135658 GTCCCATCCCACCCCCATACAGG + Intronic
1152338211 17:79709842-79709864 GCCCCTCCCCTCCCTGACACTGG + Intergenic
1152338269 17:79710017-79710039 GCCCCTCCCCTCCCTGACACTGG + Intergenic
1152338353 17:79710279-79710301 GCCCCTCCCCTCCCTGACACTGG + Intergenic
1152433341 17:80261106-80261128 CCCCGACCCCTCCCGCAGCCGGG - Intronic
1152658983 17:81533801-81533823 GCCCCACACCCCCTTCAGACAGG - Intronic
1152696093 17:81797782-81797804 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1152703956 17:81833344-81833366 GCCCCCGCCCTCCGCCAGCCGGG - Intergenic
1152749555 17:82056398-82056420 ACCTCACCCCTACCCCAGGCGGG - Intronic
1152809992 17:82376823-82376845 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1152912106 17:83010814-83010836 GCTCCACCCATTCCCCCGACAGG + Intronic
1153262525 18:3238365-3238387 GCCTCCCCCCTCCCCCAGGTCGG - Intergenic
1153304909 18:3622612-3622634 GCCACACCACTGTCCCAGACTGG + Intronic
1153309159 18:3661283-3661305 TCCACACTCCTCCCACAGACAGG + Intronic
1154398141 18:14010593-14010615 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1154398287 18:14010945-14010967 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1155955321 18:31951916-31951938 CTTCCCCCCCTCCCCCAGACGGG - Intronic
1156326248 18:36077621-36077643 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1157067295 18:44366782-44366804 GGCACACCCCTCCCCCAACCAGG + Intergenic
1157122874 18:44928078-44928100 GCCTCACCCCACCCCACGACAGG + Intronic
1157235312 18:45959614-45959636 ACCCCGCCCCCACCCCAGACTGG - Intronic
1157455907 18:47828211-47828233 CCCCCACCTCCCTCCCAGACGGG - Exonic
1157640007 18:49203209-49203231 CCCCCACCTCCCTCCCAGACGGG - Intronic
1157705262 18:49800158-49800180 CCCCCACCTCCCTCCCAGACGGG - Intronic
1158118855 18:54026164-54026186 GCCCCTTTCCTCCCCCACACAGG - Intergenic
1158435894 18:57435533-57435555 CCCCCACCCCGCCCCCACCCCGG + Intergenic
1158459242 18:57632840-57632862 CCCCCACCTCTCTCCCGGACGGG + Intergenic
1159770396 18:72541767-72541789 TGCCCACCCCGCCCCCAGCCCGG - Intronic
1160156018 18:76434345-76434367 GCACTACCCCTCCTGCAGACTGG + Intronic
1160567455 18:79795986-79796008 GCACCACCACCCCCCCAGATTGG + Intergenic
1160668420 19:344485-344507 GTCCCTCCCCTCCCCCACCCCGG + Intronic
1160968064 19:1755267-1755289 GCCACTCCCCTCCTCCAGAGTGG + Intronic
1160971204 19:1768559-1768581 GCCCCACTCCTCCGCCAGCTTGG + Intronic
1161134640 19:2612460-2612482 GCCCCTCCCCTCTCCCAGGCTGG - Intronic
1161305330 19:3564210-3564232 TCCCCACCCCACCCCGAGGCTGG - Intronic
1161312907 19:3604590-3604612 CCACCCCACCTCCCCCAGACAGG + Intronic
1161326706 19:3667679-3667701 TCCCCTCCCCTCCTCCAGGCAGG - Intronic
1161330333 19:3683873-3683895 GTCCCACACCTCCCCCACACTGG + Intronic
1161450595 19:4343513-4343535 GCCCCTCCCCTCCCCGGGGCGGG + Exonic
1161473392 19:4472446-4472468 GCCCCCCCCCCCCCCCCCACCGG - Intronic
1161500371 19:4611316-4611338 TCCCCACCCCTCCCCCTAGCTGG + Intergenic
1161512123 19:4677674-4677696 GGCCCACTCCTTCCCCAGCCCGG + Intronic
1161779609 19:6282739-6282761 CCCCCACCACACCCCCTGACAGG - Intergenic
1161849333 19:6730703-6730725 GCCCACCCCCGCCCCCAGAGCGG + Intronic
1161871299 19:6872447-6872469 TCCCAACCCCACCCCCTGACAGG - Intergenic
1161975991 19:7607966-7607988 GCCCCTCCCCTGCTCCAGGCTGG + Intronic
1161983428 19:7642105-7642127 CCCCCTCACCTCGCCCAGACTGG - Exonic
1161990773 19:7682909-7682931 GCCACAGCCCTGCCCCAGGCTGG + Exonic
1162022506 19:7874219-7874241 GCCCGACCCCTCCCCCAGCCGGG + Intronic
1162180331 19:8864427-8864449 GCCCCACCCCACCCCCCAACTGG - Intronic
1162188744 19:8927871-8927893 GCCCCTCCCCTCCCTCTGGCTGG - Intronic
1162231578 19:9270978-9271000 TCCCAACCCCTCTCCGAGACTGG - Intergenic
1162255159 19:9483517-9483539 CCCCCACCCCCCTCCCGGACGGG - Intronic
1162255184 19:9483564-9483586 CCCCCACCCCCCTCCCGGACGGG - Intronic
1162255207 19:9483611-9483633 CCCCCACCTCCCTCCCAGACGGG - Intronic
1162562321 19:11423824-11423846 GCCCCCCCCCCACCCCAGACGGG - Intronic
1163075521 19:14887484-14887506 CCCCCACCCCACCCCCCAACAGG + Intergenic
1163514461 19:17754693-17754715 AGCCCTCCCCTCCCCCAGAGGGG - Intronic
1163548588 19:17952844-17952866 CCCCCTCCCCTCTCCCGGACAGG + Intronic
1163582974 19:18149301-18149323 GGGCCACCCCGCCCCAAGACTGG + Exonic
1163815679 19:19463214-19463236 GTCCCACCCCTCCCACAGTGAGG + Intronic
1163843849 19:19627965-19627987 CCCCTACCCCTTCCCCAGTCTGG - Exonic
1163945216 19:20529818-20529840 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1163945292 19:20529995-20530017 CCCCCACCTCCCTCCCAGACAGG + Intergenic
1164192187 19:22926355-22926377 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1164298410 19:23937144-23937166 CCCCCACCTCCCTCCCAGACAGG + Intronic
1164616322 19:29668883-29668905 GCCCCGCCCCTCGCCCAACCTGG + Intronic
1164730269 19:30498431-30498453 CCCCCACCCCACTCCCTGACAGG - Intronic
1164750345 19:30649097-30649119 GCCCGACAGCTGCCCCAGACAGG + Intronic
1164789293 19:30962233-30962255 TGCCCACCCCTCCTCCACACAGG + Intergenic
1164816093 19:31204444-31204466 ACCACACCCCTCCCCCAAAAAGG - Intergenic
1164999706 19:32751103-32751125 CCCCCTCCCCACCCCCCGACAGG + Intronic
1165349028 19:35266770-35266792 GGCCCACCCCTCTCCCTTACAGG - Intronic
1165360435 19:35333288-35333310 GCCTCAGCTCTCCCCCAGGCTGG + Intronic
1166028276 19:40108094-40108116 CCCCCACCTCCCTCCCAGACAGG + Intergenic
1166030103 19:40118750-40118772 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1166162836 19:40965970-40965992 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1166162964 19:40966272-40966294 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1166180157 19:41103089-41103111 CCCCCACCTCCCTCCCAGACAGG - Intergenic
1166191845 19:41180816-41180838 ACCCCACCTCCCTCCCAGACGGG - Intergenic
1166683296 19:44781185-44781207 CCCCCACCCCTCTCCCACCCAGG + Exonic
1166827121 19:45616554-45616576 CCCCTCCCCCTCCCCCAGACGGG - Exonic
1166944908 19:46390609-46390631 GCCCCACCCCACCCCGAGGACGG - Exonic
1167053534 19:47094807-47094829 CTCCTACCCCTCCCCCAGCCAGG - Intronic
1167278683 19:48553937-48553959 GCCTCACCCCCACCCCAGCCAGG + Intronic
1167409736 19:49337864-49337886 GCCCCACCCCTCCCCCTCTCAGG - Intronic
1167593918 19:50417771-50417793 CCCCCACCCCTCTCCCAGGCTGG + Intronic
1167623021 19:50569116-50569138 TCCTCCCCCCTCCCCCCGACGGG - Intergenic
1167632989 19:50637426-50637448 GCCCCATCCCTCCCACACACAGG - Exonic
1167710589 19:51108143-51108165 GCCACTCCCTTCCCCAAGACAGG - Intronic
1167746563 19:51354371-51354393 GCGCCAACCCTCTCCCAGGCTGG + Exonic
1167838170 19:52092135-52092157 CCCCCACCCCACCCCCAAAATGG - Intronic
1167907808 19:52676530-52676552 CCCCCACCTCCCTCCCAGACGGG - Intronic
1167998490 19:53426027-53426049 GGCCCACCTCTTCCCCGGACAGG - Intronic
1168008618 19:53512133-53512155 GGCCCACCTCTTCCCCGGACCGG - Intergenic
1168280952 19:55305075-55305097 GCCCCACCTCTCTCCCCAACAGG - Intronic
1168645990 19:58059595-58059617 GCCCCACCTCTGCCCCACACCGG + Intronic
1168698648 19:58421292-58421314 GCTCCCCCACTTCCCCAGACTGG + Intergenic
1202704913 1_KI270713v1_random:15318-15340 GCTCCAGCCCGCCCCCAGGCAGG + Intergenic
925142044 2:1557454-1557476 GCCCCACCCCACCCCCACGCAGG - Intergenic
926103431 2:10135477-10135499 GCCCCTCCCCTCCCCCACCAGGG - Intergenic
926648582 2:15316660-15316682 CCGACACCCCTCCCCCAGCCAGG - Intronic
926801830 2:16665900-16665922 GCCCCGCCCCGCCCCCAGCCCGG + Intronic
927188009 2:20496394-20496416 GCCCCACCCCAAACCCAGAGTGG - Intergenic
927265941 2:21151240-21151262 CCCCCACCCCACCCCCCAACAGG + Intergenic
927458182 2:23275400-23275422 GCCCCACCCTTCACCTAGGCAGG - Intergenic
927650235 2:24908619-24908641 TACCCACCCCTCCCCCAACCAGG + Intronic
927776856 2:25910352-25910374 CCCCCACCTCCCTCCCAGACGGG + Intergenic
927833051 2:26370494-26370516 CCCCCACCTCCCTCCCAGACGGG + Intronic
927833102 2:26370620-26370642 CCCCCACCTCCCTCCCAGACGGG + Intronic
927914614 2:26927160-26927182 GCCCCACATCTCCCCCATGCTGG + Intronic
927979585 2:27366195-27366217 ACCCCACCCCACCCCCACCCCGG - Intronic
928002866 2:27539748-27539770 GACCCCCCCCGCCCCCGGACGGG + Intronic
928376990 2:30783378-30783400 GCCCTCCCCCTCCCCCAGCCAGG - Intronic
928722151 2:34133144-34133166 GCCCCCCACCTCCCCCGGACGGG + Intergenic
928888870 2:36180248-36180270 CCCCCACCTCCCTCCCAGACAGG - Intergenic
928888916 2:36180372-36180394 CCCCCACCTCCCTCCCAGACGGG - Intergenic
929440720 2:41964212-41964234 CCCCCACCCCATCCCCAGTCAGG + Intergenic
929447852 2:42014739-42014761 CCCCCACCTCCCTCCCAGACGGG + Intergenic
929487163 2:42365204-42365226 CCACCACCCGTCCCCCAAACTGG - Intronic
929577734 2:43063153-43063175 CCCCCACCTCCCTCCCAGACGGG + Intergenic
929650791 2:43677934-43677956 CCCCCACCTCCCTCCCAGACGGG + Intronic
929690144 2:44067158-44067180 CCCCCACCTCCCTCCCAGACGGG + Intergenic
929690168 2:44067208-44067230 CCCCCACCTCCCTCCCAGACGGG + Intergenic
929690263 2:44067434-44067456 CCCCCACCTCCCTCCCAGACGGG + Intergenic
929739902 2:44589116-44589138 CCCCCACCACCCTCCCAGACGGG - Intronic
930202041 2:48556576-48556598 CCCCCACCTCCCTCCCAGACGGG + Intronic
930396349 2:50828373-50828395 CCCCCACCTCCCTCCCAGACGGG + Intronic
930827729 2:55711161-55711183 CCCCCACCCCACACCCTGACAGG + Intergenic
931370850 2:61661180-61661202 GCCCCACCCCTCCCTCTAAGAGG - Intergenic
931479993 2:62630524-62630546 CCCCCACCTCCCTCCCAGACGGG - Intergenic
931754329 2:65358907-65358929 CCCTCACCCCACCCCCAGATAGG - Intronic
932563559 2:72892067-72892089 CTACCACCCCTCCCCCAGGCTGG + Exonic
932697757 2:73970845-73970867 GCCCAACCCCACCCCCTCACAGG - Intergenic
932710807 2:74061602-74061624 CCCCCACCTCCCTCCCAGACGGG + Intronic
932719055 2:74124293-74124315 CCCCCACCTCCCTCCCAGACGGG - Intergenic
932891060 2:75597881-75597903 GCCCCACCCCACCCCGATTCTGG - Intergenic
932903269 2:75724195-75724217 CCCCCACCCCACCCCTGGACAGG - Intergenic
933324758 2:80821187-80821209 GCCCCCCCCCACCCCCTGACAGG + Intergenic
933724382 2:85418433-85418455 GCCCCAACCCGGCCCCAGCCTGG + Intergenic
933734968 2:85487835-85487857 CCCCCACCTCCCTCCCAGACGGG - Intergenic
933824602 2:86147657-86147679 GCCACACCCCTCTTCCTGACAGG - Intronic
934651358 2:96092981-96093003 GCCCCACCTCTCTCGCTGACAGG + Intergenic
934846337 2:97663603-97663625 CCCCGACCCCTCCCCGAGTCGGG - Intronic
934860571 2:97760960-97760982 GCCCCACACCTCCCCGAGACAGG - Intronic
934937584 2:98476579-98476601 GCGCCACCCCTCCCCCAAGCAGG - Intronic
936444704 2:112586459-112586481 GCCCCACCCCATCACCACACAGG + Intronic
936449780 2:112625593-112625615 GCCCTACCCCAGCCCCAAACTGG + Intergenic
936463186 2:112726302-112726324 GCCCCATCCCACCCCCAGAAAGG - Intronic
936504725 2:113096496-113096518 CCCCCACCTCCCTCCCAGACGGG + Intergenic
936546477 2:113395136-113395158 CCCCCACCTCCCTCCCAGACGGG - Intergenic
936546501 2:113395185-113395207 CCCCCACCTCCCTCCCAGACGGG - Intergenic
937273644 2:120670918-120670940 GGCCCTCTCCTTCCCCAGACAGG + Intergenic
937365373 2:121257318-121257340 GCCCCACCCCTCCCCCGGGAGGG - Intronic
937909273 2:127067670-127067692 GCCCCAACCCTGCCCCTAACCGG + Intronic
937956819 2:127426407-127426429 GCCCCTCCCCTCACCCACCCTGG - Intronic
938136844 2:128765993-128766015 GCACCACCCTTCCCCCACCCAGG + Intergenic
938253426 2:129833677-129833699 CCCCCACCTCCCTCCCAGACGGG - Intergenic
938391485 2:130910050-130910072 CCCTAACCCCACCCCCAGACAGG - Intronic
938413395 2:131084193-131084215 CCCCCACCCCACCCCAAGACAGG + Intronic
938533986 2:132221576-132221598 CCCCCACCTCCCTCCCAGACTGG - Intronic
938534130 2:132221899-132221921 CCCCCACCTCCCTCCCAGACGGG - Intronic
938540280 2:132279617-132279639 ACCCCACCCCACCCCCTCACGGG + Intergenic
938828797 2:135033249-135033271 CCCCCACCTCCCTCCCAGACAGG + Intronic
938828931 2:135033581-135033603 CCCCCACCGCCCTCCCAGACGGG + Intronic
939093367 2:137804505-137804527 CCCCCACCCCACCCCATGACAGG + Intergenic
939216936 2:139250643-139250665 CCCCCACCACACCCCCTGACAGG - Intergenic
939584727 2:143991669-143991691 CCCCCACCTCCCTCCCAGACGGG - Intronic
939584772 2:143991766-143991788 CCCCCACCTCCCTCCCAGACGGG - Intronic
940518506 2:154712921-154712943 GCCACGCTCTTCCCCCAGACTGG - Intronic
940652300 2:156451525-156451547 CCCCCACCTCCCTCCCAGACGGG + Intronic
940652396 2:156451750-156451772 CCCCCACCTCCCTCCCAGACAGG + Intronic
940854958 2:158722708-158722730 CCCCCACCCCAGCCCCAGAAGGG + Intergenic
940894069 2:159063533-159063555 CATCCTCCCCTCCCCCAGACTGG - Intronic
941603110 2:167563911-167563933 CCCCCACCTCCCTCCCAGACGGG + Intergenic
941768868 2:169327295-169327317 ACCCCACCTCCCTCCCAGACGGG - Intronic
941768939 2:169327468-169327490 CCCCCACCTCCCTCCCAGACGGG - Intronic
941847919 2:170150263-170150285 CCCCCACCTCCCTCCCAGACGGG - Intergenic
942133974 2:172907058-172907080 CCACCACCCCTTCCCCAGTCTGG + Intronic
942630658 2:177946767-177946789 CCCCCACCTCCCTCCCAGACGGG - Intronic
943005840 2:182386783-182386805 CCCCCACCTCCCTCCCAGACAGG - Intronic
943297086 2:186153967-186153989 CCCCCACCTCCCTCCCAGACGGG + Intergenic
943331859 2:186569479-186569501 CCCCCACCCCACCCCCCGAGAGG - Intergenic
943350472 2:186791295-186791317 CCCCCACCCCTCCCCCTGACAGG - Intergenic
943411748 2:187556751-187556773 CCCCCACCTCCCTCCCAGACGGG - Intronic
943411909 2:187557142-187557164 CCCCCACCTCCCTCCCAGACGGG - Intronic
943578080 2:189653750-189653772 CCCCCACCTCTCTCCCGGACAGG - Intergenic
943739753 2:191397828-191397850 ACCCCACCACCCTCCCAGACGGG + Intronic
943916097 2:193634136-193634158 GCCTCCCCCCTCCCCATGACAGG - Intergenic
944060779 2:195568134-195568156 GCCCCACCTCCCTCCCGGACGGG - Intergenic
944263058 2:197696417-197696439 CCCCCACCTCCCTCCCAGACCGG + Intronic
944532760 2:200683262-200683284 CCCCCACCACTCTCCCGGACGGG + Intergenic
944815550 2:203372613-203372635 CCCCCACCTCCCTCCCAGACGGG + Intronic
945062861 2:205924123-205924145 GCCCCACTCCACACCCAGGCAGG + Intergenic
945114913 2:206400872-206400894 CCCCCACCTCCCTCCCAGACGGG + Intergenic
945115131 2:206401372-206401394 GCCCCACCTCCCTCCCGGACGGG + Intergenic
945316607 2:208377503-208377525 CCCCCACCTCCCTCCCAGACGGG + Intronic
945579854 2:211579791-211579813 CCCCAACCCCACCCCCTGACAGG - Intronic
946027723 2:216681873-216681895 GCCCCATCCCCCTCCCAGAAAGG - Intronic
946089762 2:217210532-217210554 TCCCAACCCCACCCCCCGACAGG + Intergenic
946159015 2:217824831-217824853 GCACCACCTCTCTCCCAGCCAGG + Intronic
946412045 2:219520312-219520334 GCCCCACCCAGCCGCCAGCCAGG + Intronic
946602907 2:221371518-221371540 CCACCACCCCTCCCGGAGACGGG + Intergenic
946860918 2:223999672-223999694 GCCTCACCCCTACCCCAAAAGGG - Intronic
946929441 2:224657320-224657342 CCCCCCCCCCGCCCCAAGACAGG - Intergenic
947315287 2:228851119-228851141 GCCCAACCCCTTCCCCTGAATGG - Intronic
947593982 2:231399599-231399621 GCCCTACCCCACCCCGACACAGG + Exonic
947619189 2:231577767-231577789 GCCCCACCCCTCCCCATCAAAGG - Intergenic
947731550 2:232434229-232434251 ACCTCACCCCTTCCCCACACAGG - Intergenic
947732340 2:232438389-232438411 CCTCCACCCCTCCCCCAGACAGG + Intergenic
947797912 2:232906101-232906123 CCCCCACCTCCCTCCCAGACGGG - Intronic
947822760 2:233083458-233083480 GCCCCAACCCTCCCCCAACCAGG - Intronic
948204230 2:236154000-236154022 GCCCCACTGCACCCCCAGCCTGG - Intergenic
948335214 2:237202090-237202112 CCCCTACCCCACCCCCAGAAGGG - Intergenic
948468543 2:238163618-238163640 GCCCCACCCCTGCGCCCGGCAGG + Intronic
948915797 2:241034550-241034572 CCCCCACCCCACCCCCAGGCTGG + Exonic
949027187 2:241771846-241771868 GCCCCTCCCCTCCCCCAGGACGG + Intergenic
1168795514 20:608262-608284 TCCCCACCCTTCCACCAGTCAGG - Intronic
1168999341 20:2155778-2155800 GCCTCCCCCCTCCCCCATGCAGG - Intronic
1169680189 20:8203551-8203573 CCCCCACCCCACCCCCGGCCTGG - Intronic
1170645745 20:18194690-18194712 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1170924773 20:20712661-20712683 GCCCCGCCCCTCGCCGTGACCGG - Intergenic
1171191028 20:23159580-23159602 CACCCACCCCACCCCCAGGCTGG - Intergenic
1171381465 20:24737304-24737326 TCGCCTCCCCTCCCCCACACTGG - Intergenic
1171848212 20:30290599-30290621 CCGCCTCCCCTCCCCCAGGCCGG - Intergenic
1171869206 20:30512621-30512643 ACCCCACCCCACCCCCTCACGGG + Intergenic
1172257974 20:33536306-33536328 CCCCCACCTCCCTCCCAGACGGG + Intronic
1172279351 20:33699391-33699413 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1172280026 20:33701676-33701698 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1172349588 20:34230022-34230044 CCCCCACCTCCCTCCCAGACGGG + Intronic
1172602905 20:36195919-36195941 GTCCTACACCTCCCCCAGGCAGG + Intronic
1172720983 20:37000303-37000325 CCCCCACCTCCCTCCCAGACGGG - Intronic
1172735911 20:37126238-37126260 CCCCCACCTCCCTCCCAGACGGG - Intronic
1172819420 20:37718468-37718490 CCCCCACCTCCCTCCCAGACGGG + Intronic
1172918364 20:38461280-38461302 CCCCCACCTCTCTCCCAGACGGG + Intergenic
1172918386 20:38461329-38461351 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1173307254 20:41862360-41862382 TACCCACCCTTCCCCCAGCCTGG - Intergenic
1173668479 20:44780382-44780404 GCCCCACCTCTGCCCTAGGCAGG - Intronic
1174020562 20:47525769-47525791 CCCCCACCTCCCTCCCAGACGGG + Intronic
1174404339 20:50293846-50293868 GCCCCACCCCTGCCCACCACCGG - Intergenic
1174579268 20:51559567-51559589 GCCCAACCCCTCCTCCAGGAAGG + Intronic
1174835842 20:53854581-53854603 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1174880533 20:54274376-54274398 CCCCCACCCCACCCCCTGACAGG + Intergenic
1175108754 20:56631283-56631305 GCGCCACCCCTCTCCCACACTGG + Exonic
1175171665 20:57085305-57085327 CCCACACCCCACCCCCAGGCAGG - Intergenic
1175272855 20:57747032-57747054 CCCCCACCCCCACCCCAGCCAGG + Intergenic
1175371603 20:58496348-58496370 GCCACAACCCTGCCCCAGGCTGG - Intronic
1175443140 20:59004551-59004573 GCCCCACCCCGCCCCAATTCTGG - Intronic
1175727531 20:61329844-61329866 CCCCCACCCCATCCCCCGACAGG + Intronic
1175990235 20:62785183-62785205 GCCCCATCCCTCCTCCACCCAGG - Intergenic
1176032013 20:63017304-63017326 GCCCGTCCCATCCCCCAGGCCGG + Intergenic
1176070645 20:63224602-63224624 TCCCCACCCCTGCCCCCAACAGG + Intergenic
1176091722 20:63321289-63321311 GCCCCTTCCTTCCCCCAGGCTGG + Intronic
1176105218 20:63382616-63382638 GCCCCACCCCTCCCACAAGCAGG + Intergenic
1176305358 21:5120347-5120369 GCCCCACCCACCCCTCAGCCTGG - Intronic
1176348332 21:5770767-5770789 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1176355146 21:5891351-5891373 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1176496495 21:7553688-7553710 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1176542653 21:8168837-8168859 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1176561604 21:8351882-8351904 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1176733439 21:10521717-10521739 CCCCCACCCCTACCCCCGCCCGG - Intronic
1176969382 21:15248354-15248376 TCCCCATCCCCCACCCAGACAGG + Intergenic
1177178256 21:17720044-17720066 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1177178305 21:17720145-17720167 CCCCCACCTCCCTCCCAGACAGG + Intergenic
1178138113 21:29651140-29651162 GCCCCACCCAGGCCCGAGACTGG - Exonic
1179295729 21:40060566-40060588 CCCCCACCCCTACCCCACCCCGG - Intronic
1179455046 21:41493408-41493430 TCCCCACCTCTCCCCCACTCAGG - Intronic
1179617864 21:42593532-42593554 GCCCCACCCCCGCCCCAGCTGGG + Intergenic
1179646344 21:42778535-42778557 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1179646367 21:42778583-42778605 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1179655639 21:42842573-42842595 GCCCCACTCCCCTTCCAGACAGG - Intergenic
1179801481 21:43813375-43813397 GCCCCTCCCCTGCCCCTGCCTGG - Intergenic
1179810068 21:43864888-43864910 GCCCGCCCCCTCCCCCAGCCCGG + Intergenic
1179851697 21:44141684-44141706 GCCCCACCCACCCCTCAGCCTGG + Intronic
1179873555 21:44255963-44255985 CCCCACCCCCTCCCCTAGACCGG - Intronic
1179969355 21:44825294-44825316 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1180039602 21:45269019-45269041 CCCCCACCTCCCTCCCAGACGGG - Intronic
1180039653 21:45269146-45269168 CCCCCACCTCCCTCCCAGACGGG - Intronic
1180064856 21:45407078-45407100 CACACACCCCTCCCCCAGCCCGG + Intronic
1180183075 21:46126612-46126634 GCACGGCCCCTCCCCCAGCCCGG - Intronic
1180581922 22:16845989-16846011 GCCCCACGCCTGCCCCATGCAGG + Intergenic
1180649874 22:17369309-17369331 GCCCCGCCCCTCCCCCTCCCTGG + Intronic
1180832237 22:18912204-18912226 CCACCACCCCTCCCCCTGCCTGG + Intronic
1180847772 22:18993737-18993759 GGCCCTGCCCTCCGCCAGACTGG - Intergenic
1181067605 22:20314138-20314160 CCACCACCCCTCCCCCTGCCTGG - Intergenic
1181111864 22:20607119-20607141 GCCCCAACCCTTCTCCTGACGGG + Intergenic
1181586234 22:23854889-23854911 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1181620840 22:24090154-24090176 CCCCCACCCCTTCCCCATACAGG - Intronic
1181646104 22:24232480-24232502 GCCCCACCCAGCCCACTGACAGG - Intronic
1181810787 22:25402819-25402841 GCCCCATCCCTGGCCCAGGCTGG - Intronic
1181982052 22:26773112-26773134 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1182331160 22:29552558-29552580 CCCCCACCTCCCCCCCGGACGGG - Intronic
1182616270 22:31591912-31591934 CCCCCACCTCCCTCCCAGACGGG + Intronic
1182616392 22:31592186-31592208 CCCCCACCTCCCTCCCAGACAGG + Intronic
1182616592 22:31592638-31592660 CCCCCACCTCCCTCCCAGACAGG + Intronic
1183194007 22:36340789-36340811 TCCCCACCCCTTCTCCAGACTGG - Intronic
1183662789 22:39231348-39231370 GCTCCACACCTCGCCCAGCCCGG + Intronic
1183735770 22:39644029-39644051 TCCCCATCCCTCCTCCAGGCTGG - Intronic
1184093004 22:42302117-42302139 GCCCCTCAGCTCTCCCAGACTGG - Intronic
1184145523 22:42607919-42607941 CCCCCACCTCCCTCCCAGACGGG - Intronic
1184327228 22:43798063-43798085 GCCCCACCCCAACCCAGGACTGG - Intronic
1184401194 22:44275504-44275526 GCCTCACCCATCCCCCAGGCAGG - Intronic
1184648105 22:45907020-45907042 ACCCCACCCCTCTCCCAGCCCGG - Intergenic
1184892746 22:47389710-47389732 CCCCCTCCCCTCCCCCACCCAGG + Intergenic
1184991835 22:48175678-48175700 GCCCCAGTCCTCACCCAGCCTGG + Intergenic
1185035883 22:48476718-48476740 GCCTGACCCCTCCCCCAGGCAGG + Intergenic
1185047682 22:48537202-48537224 GCCCCACCCTGCCCCCACCCCGG - Intronic
1185159352 22:49213591-49213613 TCCCCACCTCTCCCCTAGATGGG + Intergenic
1185383797 22:50522423-50522445 GCCCCACCCCACCCCCTGGCAGG - Intronic
1185416154 22:50711684-50711706 ACACCAGCACTCCCCCAGACAGG - Intergenic
1203247518 22_KI270733v1_random:85080-85102 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1203282322 22_KI270734v1_random:137509-137531 CCACCACCCCTCCCCCTGCCTGG + Intergenic
949569979 3:5283908-5283930 CCCCCACCTCCCTCCCAGACGGG + Intergenic
949773286 3:7602272-7602294 TCCCCATCCCTCCCCTAGTCAGG + Intronic
950412686 3:12849663-12849685 CCCCCACCTCCCTCCCAGACGGG + Intronic
950430774 3:12949724-12949746 GTCCCATCCCTCCCCGAGACGGG - Intronic
952934868 3:38389535-38389557 CCCCCACCTCCCTCCCAGACGGG + Intronic
953630891 3:44615946-44615968 GCCTCACTCTGCCCCCAGACTGG - Intronic
953855157 3:46494814-46494836 CCCCCACCTCCCTCCCAGACGGG - Intergenic
953855210 3:46494942-46494964 CCCCCACCTCCCTCCCAGACGGG - Intergenic
953927489 3:46989781-46989803 ACCCCACCCCTCCACCTGATGGG - Intronic
953959533 3:47256501-47256523 CCCCCACCTCCCTCCCAGACGGG - Intronic
954059583 3:48056647-48056669 CCCCCACCTCCCTCCCAGACAGG - Intronic
954162821 3:48734493-48734515 CCCCCACCTCCCTCCCAGACGGG - Intronic
954570867 3:51639730-51639752 TCCCTACCCCTTCCCCAGGCAGG - Intronic
954633211 3:52057799-52057821 GCACCACCGCTCCCCCAGTCAGG - Intergenic
954698919 3:52441686-52441708 CCCCAACCCCCACCCCAGACGGG - Exonic
954724575 3:52596789-52596811 GCGCCACCCCTCCCCAACCCTGG - Intronic
955297616 3:57748066-57748088 CCCCCACCTCCCTCCCAGACGGG - Intergenic
955956266 3:64293109-64293131 GCCCACCCCCTACCCCACACCGG - Intronic
956270525 3:67444317-67444339 CCCCCACCTCCCTCCCAGACGGG - Intronic
956270675 3:67444670-67444692 CCCCCACCTCCCTCCCAGACGGG - Intronic
956290311 3:67654311-67654333 GCGCCGCCCCTGCCCCACACTGG + Intronic
957976577 3:87453314-87453336 CCCCCACCCCACCCTCTGACAGG + Intergenic
958808417 3:98837105-98837127 CCCCCACCTCCCTCCCAGACGGG + Intronic
958957312 3:100477740-100477762 CCCCCACCTCCCTCCCAGACTGG + Intergenic
958957409 3:100477964-100477986 CCCCCACCTCCCTCCCAGACTGG + Intergenic
959054136 3:101551652-101551674 GCCCCCCCCACCTCCCAGACGGG - Intergenic
959398364 3:105869040-105869062 GCCCCGCCCCGCCCCGAGCCTGG - Exonic
959415308 3:106073970-106073992 CCCCCACCTCCCTCCCAGACGGG + Intergenic
959415405 3:106074193-106074215 CCCCCACCTCCCTCCCAGACGGG + Intergenic
960714277 3:120560065-120560087 GCCCCCCCCCCCCCCCATTCTGG + Intergenic
960780333 3:121313096-121313118 CCCCCACCACCCTCCCAGACGGG + Intronic
960905072 3:122592432-122592454 CCCCCACCTCACTCCCAGACAGG - Intronic
961163760 3:124750267-124750289 CCCCCACCTCCCTCCCAGACGGG + Intergenic
961163813 3:124750395-124750417 CCCCCACCTCCCTCCCAGACGGG + Intergenic
961167896 3:124776235-124776257 GCCCCTCCTCTCCACCAGTCTGG + Intronic
961505462 3:127368291-127368313 CCCCCACCCCTTGCCCAGCCCGG + Intergenic
961729444 3:128954947-128954969 GCCCCACCTCCCTCCCGGACGGG - Intronic
961789071 3:129363414-129363436 CCCCCACCTCCCTCCCAGACGGG + Intergenic
961962705 3:130868784-130868806 CCCCCACCACTCTCCCGGACGGG - Intronic
962572359 3:136723912-136723934 CCCCCACCTCACTCCCAGACGGG - Intronic
963259762 3:143180093-143180115 CCCCCACCCCCTCCCCTGACAGG + Intergenic
964358338 3:155870494-155870516 GCCCGGCCCCGCCCCCAGCCCGG - Intergenic
964708785 3:159648858-159648880 CCCACTCCCCTCCCCCATACAGG - Intronic
965602647 3:170470203-170470225 TCCTCTCCCCTCCCCCAGGCTGG + Intronic
965700784 3:171458178-171458200 GCAGCACCCCACCCCCAGTCGGG + Intronic
965770186 3:172173812-172173834 GCCCCACCCCTCCCCCAGACAGG - Intronic
966015111 3:175131876-175131898 CCCCCACCTCCCTCCCAGACGGG + Intronic
966015272 3:175132269-175132291 CCCCCACCTCCCTCCCAGACGGG + Intronic
966015389 3:175132567-175132589 CCCCCACCTCCCTCCCAGACGGG + Intronic
966420106 3:179727980-179728002 CCCCCACCTCCCTCCCAGACGGG + Intronic
966637347 3:182150564-182150586 CCCCCACCTCTACCCCTGACAGG + Intergenic
966869096 3:184278409-184278431 GCCCCACCCCTACCCCCGCTCGG + Intronic
967169354 3:186811637-186811659 CCCCCACCTCCCTCCCAGACGGG + Intergenic
967524262 3:190473433-190473455 CCCCCACCTCCCTCCCAGACAGG - Intergenic
967936179 3:194729599-194729621 ACCCCACCCCCACCCCATACAGG - Intergenic
968230817 3:197003513-197003535 CCCCCACCCCCACCCCAGAGCGG - Intronic
968479527 4:827077-827099 GCCCCATCCCTCCCGCCGCCTGG - Intergenic
968514891 4:1011820-1011842 GCGCCGCCCCGCCCCGAGACCGG + Intronic
968517336 4:1020772-1020794 GCCCCACCCCTTCCCCTGCCTGG - Intronic
968517543 4:1021185-1021207 GCCCCACCCCATCCCCTGCCTGG - Intronic
968519014 4:1027378-1027400 GCCCCACCCCTCCTGCTGACCGG - Intergenic
968520818 4:1033956-1033978 GCCCCGCCCCTCCCCGAGCCTGG - Intergenic
968815882 4:2821440-2821462 GCCCCAGCCCTGTCCCAGGCTGG - Intronic
968936383 4:3612548-3612570 GGCCCACCCCTCCTCCCCACTGG - Intergenic
968975561 4:3820534-3820556 GCCCCACCCCAGCCCCAGCCCGG - Intergenic
969228579 4:5814700-5814722 GCCACACCCCTGCCCCCCACTGG + Intronic
969404207 4:6978052-6978074 CCCCCACCTCCCTCCCAGACGGG - Intronic
969721607 4:8895397-8895419 GCCCCTCCCCTGCCCCACACTGG - Intergenic
969724876 4:8912946-8912968 GCCCCCACCCTCCCCCATGCCGG + Intergenic
969876815 4:10141528-10141550 CCCCCACCCCTCCCCCAGGGAGG - Intergenic
971122244 4:23717670-23717692 GCCTCACCCCTCCCACAGTCTGG + Intergenic
972552604 4:40147639-40147661 CCCCCACCTCCCTCCCAGACGGG + Intronic
972552626 4:40147686-40147708 CCCCCACCTCCCTCCCAGACGGG + Intronic
972705437 4:41538288-41538310 GCCCCTCCCATCTCCCAGAGTGG + Intronic
973018798 4:45173180-45173202 CCCCCACCCCTAGCCAAGACAGG - Intergenic
973593595 4:52465312-52465334 CCCCCACCTCCCTCCCAGACAGG - Intergenic
973672722 4:53237523-53237545 CCCCCACCTCTCTCCCAGATGGG + Intronic
973675167 4:53255975-53255997 CCCCCACCTCCCTCCCAGACGGG + Intronic
973728032 4:53795466-53795488 CCCCCACCCCATCCCCCGACAGG - Intronic
973906470 4:55536768-55536790 CCCCCACCCCTCTCCCAACCCGG + Intronic
974597937 4:64037525-64037547 GGCCCCCCCACCCCCCAGACGGG - Intergenic
975335308 4:73169548-73169570 TCCCCACCCCTCCCCAAGTTTGG + Intronic
975685787 4:76917334-76917356 CCCCCACCTCCCTCCCAGACGGG - Intergenic
976078391 4:81325155-81325177 CCCCCACCCCACCCCCTGACAGG - Intergenic
976265981 4:83186190-83186212 CCCCCACCCCGCTCCCGGACGGG + Intergenic
976401312 4:84610205-84610227 TCCTCATCCCTCCCTCAGACTGG - Intronic
976865246 4:89717790-89717812 GCACCACCCCTACCCAAGTCAGG - Intergenic
977582157 4:98737207-98737229 CCCCCACCCCGCCCCCTGACAGG + Intergenic
977721407 4:100244166-100244188 CCCCCACCCAACCCCCAGAGAGG + Intergenic
978138033 4:105286985-105287007 TCCTCACCCCGCCCCCTGACTGG - Intergenic
978140914 4:105316744-105316766 CCACCACCCCACCCCCCGACAGG - Intergenic
978159872 4:105533191-105533213 CCCCCACCCCGCCCCTTGACAGG + Intergenic
978509154 4:109496635-109496657 GCCCCACCCCTGCTCAAGATGGG - Intronic
978518977 4:109597642-109597664 CCCCCACCTCCCTCCCAGACCGG + Intronic
979622427 4:122812123-122812145 CCCCCACCCCCCTCCCGGACGGG - Intergenic
979677726 4:123428140-123428162 GACCCACCCCTCCCGTATACAGG + Intergenic
979785737 4:124712941-124712963 CCCCCACGCCGCCCCGAGACAGG - Intergenic
980056407 4:128083579-128083601 CCCCCACCTCCCTCCCAGACGGG + Intronic
981677480 4:147358047-147358069 CCCCCACCTCCCTCCCAGACAGG - Intergenic
981994944 4:150964231-150964253 GGCCCCCCCATCTCCCAGACAGG - Intronic
982026125 4:151255131-151255153 CCCCCACCTCCCTCCCAGACGGG + Intronic
982182808 4:152765257-152765279 CCCCCACCTCCCTCCCAGACGGG + Intronic
983019420 4:162656455-162656477 CCCCCACCCCACCCCCCGACAGG - Intergenic
983604624 4:169570438-169570460 CCCCCACCTCCCTCCCAGACTGG - Intronic
984037943 4:174692298-174692320 CCCCCACCTCCCTCCCAGACGGG - Intronic
984533457 4:180944839-180944861 CCCCCACCTCCCTCCCAGACGGG - Intergenic
984533559 4:180945066-180945088 CCCCCACCTCCCTCCCAGACAGG - Intergenic
984627993 4:182030231-182030253 CCCCCACCCCACCCCATGACAGG + Intergenic
984803767 4:183735900-183735922 CCCCCACCCCCCTCCCGGACAGG + Intergenic
984803935 4:183736290-183736312 CCCCCACCTCCCTCCCAGACTGG + Intergenic
984977197 4:185240702-185240724 CCCCCACCTCCCTCCCAGACGGG + Intronic
985599677 5:820544-820566 GCCCCACCCCTCACAGACACCGG - Intronic
985639726 5:1058022-1058044 GCCCCAAGCCTCCCTGAGACGGG - Intronic
986045487 5:4033292-4033314 CCCCCACCCCATCCCCTGACAGG + Intergenic
986393685 5:7306836-7306858 GCCCCGCCCCTCTCCCAGAGTGG - Intergenic
986464597 5:8008518-8008540 GACCCACCCCTCTGCCAGGCTGG - Intergenic
986767471 5:10940740-10940762 CCCCCACCCCACCCACTGACTGG + Intergenic
986994150 5:13586944-13586966 CCTCCACCCCACCCCCTGACAGG + Intergenic
987301736 5:16603662-16603684 GCCCAACCCCACCCTCAGAGTGG + Intronic
988240072 5:28597050-28597072 CCCCCACCTCCCTCCCAGACGGG + Intergenic
988966159 5:36420118-36420140 GCCCCAGCCCACCCACAGATGGG + Intergenic
989075999 5:37563710-37563732 CCCCCACCTCCCTCCCAGACGGG + Intronic
989103432 5:37840075-37840097 GCGCCTCCCCTCCCCCACCCCGG - Intergenic
989252774 5:39334676-39334698 GCCCCACCTCCCTCCCGGACTGG - Intronic
989379747 5:40800627-40800649 CCCCCACCTCCCTCCCAGACGGG - Intergenic
989379849 5:40800880-40800902 CCCCCACCACCCTCCCAGACGGG - Intergenic
989379949 5:40801134-40801156 CCCCCACCACCCTCCCAGACGGG - Intergenic
989634878 5:43522312-43522334 CCCCCACCTCCCTCCCAGACGGG - Intergenic
990426912 5:55696530-55696552 CCCCCACCTCCCTCCCAGACGGG + Intronic
990870989 5:60431177-60431199 CCCCCACCTCCCTCCCAGACAGG + Intronic
991073609 5:62513318-62513340 CCCCCACCTCCCTCCCAGACGGG + Intronic
991373323 5:65940499-65940521 CCCCCACCTCCCTCCCAGACGGG - Intronic
991909995 5:71551782-71551804 CCCCCACCTCCCTCCCAGACGGG + Intronic
992463625 5:76984754-76984776 CCCCCACCTCCCTCCCAGACGGG + Intergenic
992505408 5:77382579-77382601 CCCCCACCCCACCCTCCGACAGG + Intronic
992747117 5:79830595-79830617 CCCCCACCCTGCCCCCAGGCAGG - Intergenic
992801836 5:80301548-80301570 GCCCCACCTCCCTCCCGGACAGG - Intergenic
992852473 5:80824399-80824421 CCCCCACCTCCCTCCCAGACGGG + Intronic
993977451 5:94499579-94499601 GTCCCCCCCCCCCCCCAGATTGG - Intronic
994778221 5:104062016-104062038 CCCCCACCCCTCACCCTGCCTGG + Intergenic
995109323 5:108411381-108411403 GCCCCTCCCCACCCCCTGACAGG + Intergenic
995776553 5:115729674-115729696 CCCCCACCCCTACCCCAAGCTGG + Intergenic
995903202 5:117093755-117093777 CCAACACCCCTCCCCCATACCGG - Intergenic
996069912 5:119122143-119122165 CCCCCACCTCCCTCCCAGACGGG + Intronic
996070040 5:119122447-119122469 CCCCCACCTCCCTCCCAGACGGG + Intronic
996386234 5:122913304-122913326 CCCCCACCTCCCTCCCAGACGGG + Intronic
997262716 5:132476755-132476777 ACCCCACCCCTACCCCATATGGG + Intergenic
997647088 5:135488964-135488986 CCTCCTCCCCTCCCCCAGGCCGG + Intergenic
997874867 5:137538064-137538086 CCCCCACCTCCCTCCCAGACGGG + Intronic
997874886 5:137538113-137538135 CCCCCACCTCCCTCCCAGACGGG + Intronic
997878036 5:137566300-137566322 GCCACACTCCTCTCCCACACAGG + Intronic
998151973 5:139762806-139762828 GCCCCACCACCTCCCCAGCCAGG - Intergenic
999181125 5:149670620-149670642 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1000033001 5:157419847-157419869 CCCCCACCTCCCTCCCAGACGGG - Intronic
1000033045 5:157419942-157419964 CCCCCACCTCCCTCCCAGACGGG - Intronic
1000159315 5:158582968-158582990 CCCCCACCACCCTCCCAGACGGG - Intergenic
1000400607 5:160823379-160823401 ACCCCACCCCACTCCCTGACAGG - Intronic
1000541249 5:162542610-162542632 TCCCCACCCCACCCCCTGACAGG - Intergenic
1000597689 5:163234724-163234746 GCCCCCCTCCACCCCCCGACAGG + Intergenic
1001640766 5:173242648-173242670 CCCCTACCCCGGCCCCAGACAGG - Intergenic
1001703107 5:173721649-173721671 GCCCCACCCCTCCCGAGGATGGG + Intergenic
1001770624 5:174293292-174293314 CCCCCACCCCTCCCCTAGGGAGG - Intergenic
1002013858 5:176305513-176305535 CCCCCACCTCCCTCCCAGACGGG - Intronic
1002205476 5:177560102-177560124 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1002434271 5:179221540-179221562 ACCCCAGCCCTCCCCCATGCTGG + Intronic
1002634514 5:180600516-180600538 GCCCCAAACCTCCCCCAAGCAGG + Intergenic
1002639362 5:180623438-180623460 CCCCCACCCCACCCCCAGCTGGG + Intronic
1002794247 6:458035-458057 CCCCCCCCCCACCCCCTGACAGG + Intergenic
1003150684 6:3546297-3546319 GGCCCTCCCCTCCCCAAGATGGG - Intergenic
1003193325 6:3892965-3892987 GCCGAAGCCCTCCCCAAGACTGG - Intergenic
1003407275 6:5835518-5835540 CCCCCACCTCCCTCCCAGACTGG + Intergenic
1003819171 6:9876894-9876916 GCGCCACTCCTCCCCCAGGCTGG + Intronic
1004660005 6:17701960-17701982 ACCCCACCCCACCCCCATCCCGG + Intronic
1004874374 6:19939551-19939573 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1004874495 6:19939824-19939846 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1004874769 6:19940509-19940531 CCCCCACCCCCCTCCCGGACGGG - Intergenic
1005021496 6:21423436-21423458 GCCTCAACCCTCTCCCAGATTGG + Intergenic
1005158924 6:22836938-22836960 CCCCCACCTCCCTCCCAGACAGG - Intergenic
1005412469 6:25564929-25564951 ACAACACCCCTCCCCCAGGCTGG - Intronic
1005413887 6:25581301-25581323 GCCCTTCCCATCCCTCAGACAGG + Exonic
1005644322 6:27826776-27826798 CCCCCACCTCCCCCCCGGACGGG + Intergenic
1005771501 6:29077461-29077483 TCCCCTCTCCACCCCCAGACAGG + Intergenic
1005929843 6:30475294-30475316 CCCCCACCTCCCTCCCAGACAGG - Intergenic
1005946688 6:30600989-30601011 TCCCCACCCCTCCCCCAGCGTGG - Exonic
1006039805 6:31244238-31244260 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1006064676 6:31454735-31454757 ACCCCACCTCCCTCCCAGACGGG + Intergenic
1006064931 6:31455342-31455364 ACCCCACCTCCCTCCCAGACGGG + Intergenic
1006075291 6:31528852-31528874 GCCCCACGTCTCTCCCAGCCTGG - Exonic
1006187615 6:32189947-32189969 GCTCCGCCCCTCCCCCCGCCTGG + Exonic
1006231967 6:32595049-32595071 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1006232303 6:32595781-32595803 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1006346290 6:33485742-33485764 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1006546752 6:34786848-34786870 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1006837078 6:37005552-37005574 GCCCCACCTCTCCCTCAGGGGGG - Intergenic
1006839243 6:37017800-37017822 GCCCCACCCCTGCTCCTGACTGG + Intronic
1007302226 6:40876034-40876056 CCCCCAGCCCTCCCCCAGGCAGG - Intergenic
1007403173 6:41616423-41616445 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1007521455 6:42453703-42453725 CCCCCACCCCACCCCCACCCGGG + Intergenic
1007967161 6:46014028-46014050 CCCCCACCCCCACCCCAGGCTGG - Intronic
1008342325 6:50382560-50382582 ACCCCACCCCACCCCATGACAGG + Intergenic
1008355388 6:50546896-50546918 GTACCACCCCTTCCCCAGAAAGG + Intergenic
1008624612 6:53305111-53305133 CCCCCACCTCCCTCCCAGACGGG + Intronic
1008899561 6:56595780-56595802 CCCCCACCCCACCCCGAGAAGGG + Intronic
1008909879 6:56721064-56721086 GCCCCCCCCACCTCCCAGACGGG + Intronic
1009526336 6:64751246-64751268 GCCCCACCCCTCCCACGCAGAGG + Intronic
1009951572 6:70402937-70402959 CCCCCACCCCCCCCACACACAGG + Intergenic
1010017046 6:71116966-71116988 CCCCCACACCTCCCCCACTCTGG - Intergenic
1010030487 6:71266619-71266641 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1010245894 6:73660703-73660725 CCCCCACCTCCCTCCCAGACCGG + Intergenic
1010264366 6:73851062-73851084 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1010288592 6:74108972-74108994 GCTCCTCTCCTCCACCAGACTGG - Intergenic
1010300599 6:74255110-74255132 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1010324741 6:74551040-74551062 ACCCCACCCCACCCCCAACCTGG - Intergenic
1011148568 6:84244668-84244690 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1011297271 6:85838800-85838822 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1011297378 6:85839042-85839064 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1011305269 6:85918733-85918755 CCCCTACCCCACCCCCTGACAGG + Intergenic
1011426745 6:87239399-87239421 CCCCCACCTCCCTCCCAGACGGG + Intronic
1012428725 6:99142228-99142250 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1012899556 6:104991191-104991213 CCCCCACCTCCCTCCCAGACGGG + Intronic
1012951117 6:105519028-105519050 TCCCCACCCGACCCCCCGACAGG + Intergenic
1012983668 6:105854048-105854070 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1013190881 6:107803361-107803383 CCCCCACCTCCCTCCCAGACGGG - Intronic
1013204693 6:107934829-107934851 CCCCCACCTCCCTCCCAGACGGG - Intronic
1013888088 6:114995598-114995620 GCTCCTCCCCTCCCACAGAAAGG + Intergenic
1014085369 6:117336320-117336342 CCCCCACCCCTCCCCCTGACAGG + Intronic
1014489223 6:122041913-122041935 GGACCACACCTCCCCAAGACAGG + Intergenic
1015070558 6:129088483-129088505 CCCCCACCTCCCTCCCAGACGGG + Intronic
1015220946 6:130802668-130802690 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1015440367 6:133241032-133241054 CCCCCACCCCGCCCCCACCCGGG - Intronic
1015533459 6:134244120-134244142 CTCCCACCCCACCCCCTGACAGG + Intronic
1015967694 6:138711629-138711651 CCAACACCCCTCCCCCAGCCAGG + Intergenic
1016026818 6:139296033-139296055 GACCCCCCCCTCCTCCAGCCTGG + Intergenic
1016491434 6:144608560-144608582 GTACCACCCCTCCCCCAAGCTGG + Intronic
1016973477 6:149786219-149786241 CCCCCACCTCCCTCCCAGACGGG + Intronic
1016988099 6:149910097-149910119 GACCCTCCCCTCCCCCACCCTGG + Intergenic
1017170435 6:151450433-151450455 CCCCCACCTCCCTCCCAGACGGG - Intronic
1017284593 6:152659455-152659477 AGCCCACCCCTTCCCCACACAGG - Intergenic
1017311487 6:152982481-152982503 GCCCCTCCCCTCCCCCACCCCGG - Intronic
1017422401 6:154286184-154286206 GCCACCCCCCACCCCCAGACAGG - Intronic
1017447356 6:154518790-154518812 CCCCCACCCCACCCCCCCACAGG + Intergenic
1017843917 6:158240654-158240676 CCCCCACCTCCCTCCCAGACGGG + Intronic
1018720286 6:166566784-166566806 GCCCCACTCCTGCACCTGACAGG + Intronic
1018900544 6:168049746-168049768 ACCCCACCCCACCCCCACCCTGG - Intergenic
1019265131 7:110949-110971 GCCCCACACAGCCCCAAGACAGG + Intergenic
1019337873 7:493867-493889 GCCCCACCACTCTCCCCGGCTGG + Intergenic
1019525987 7:1480781-1480803 GCCCCACCCCTCCCCAGGCTGGG + Intronic
1019559402 7:1648453-1648475 GCCACCCCCCTCCCCGGGACAGG - Intergenic
1019559927 7:1650927-1650949 TGCCCACCCCTCCCCCAGGCTGG + Intergenic
1019616510 7:1965359-1965381 GCCCTTCCTCTCCCACAGACAGG + Intronic
1019719555 7:2559761-2559783 GCCCCCCCCCCCCCCCCCACTGG - Intronic
1019981412 7:4624259-4624281 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1020016424 7:4834549-4834571 GGCCCCCTCTTCCCCCAGACCGG + Intronic
1020106348 7:5423931-5423953 GCCCGCCCCCCCCCCCAGCCCGG + Intronic
1020257279 7:6509185-6509207 GTCCCACCCCTACGCCAGCCTGG - Exonic
1020284628 7:6670956-6670978 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1020284722 7:6671182-6671204 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1020325952 7:6975219-6975241 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1020545483 7:9523976-9523998 CCCCCATCCCACCCCCTGACAGG + Intergenic
1020568076 7:9822627-9822649 TCCCAACCCCACTCCCAGACCGG + Intergenic
1020616340 7:10465613-10465635 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1021525002 7:21577283-21577305 GTCCCACCCCTCCCCTTGCCAGG + Intronic
1021672275 7:23046108-23046130 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1022005486 7:26262283-26262305 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1022083404 7:27045153-27045175 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1022364756 7:29701551-29701573 TCCCCACCCCATCCCCCGACAGG + Intergenic
1022391584 7:29948888-29948910 GCCCCTTCCCTCCACCAGGCTGG + Intronic
1022404209 7:30071456-30071478 GCCTCACCCCCAACCCAGACTGG + Intronic
1022432380 7:30338423-30338445 GCCCCCCCCCACCCCCCAACAGG + Intronic
1022452383 7:30526487-30526509 GCCCCTCCCCTCTCCCAGAGTGG - Intronic
1022511506 7:30937680-30937702 CCCTCACCCCTCCCCCTAACAGG + Intergenic
1022965924 7:35471533-35471555 CCCCTACCCCACCCCCCGACAGG + Intergenic
1023137574 7:37068150-37068172 GCCTCATCCCTTCCCCAGGCAGG + Intronic
1023909780 7:44545473-44545495 GCCCCACCCCTTCCCCAGCATGG + Intergenic
1023995670 7:45157748-45157770 GCCCCACCCCAACCCCAACCGGG + Intergenic
1024625879 7:51208369-51208391 CCCCCACCTCCCTCCCAGACGGG - Intronic
1024931181 7:54667736-54667758 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1024931278 7:54667958-54667980 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1025000611 7:55312066-55312088 CCCCCACCTCTCTCCCGGACGGG - Intergenic
1025011637 7:55402703-55402725 CCCCCACCTCCCTCCCAGACGGG + Intronic
1025078696 7:55964533-55964555 GCGCGACCCCTCCCCCGGCCGGG - Intronic
1025103194 7:56151309-56151331 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1025706924 7:63874477-63874499 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1025706947 7:63874526-63874548 GCCCCACCTCCCTCCCGGACGGG - Intergenic
1025800891 7:64785032-64785054 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1025800912 7:64785080-64785102 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1025808503 7:64856878-64856900 CCCCCACCTCCCTCCCAGACTGG - Intergenic
1025808551 7:64857004-64857026 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1025821638 7:64968294-64968316 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1025990612 7:66494033-66494055 CCCCAACTCCTCCCCCAGCCAGG + Intergenic
1026848147 7:73709008-73709030 ACCCCACCCTTCCCGCACACTGG - Intronic
1027213270 7:76167026-76167048 CCCCAACTCCTCCCCCAGCCAGG + Intergenic
1027228525 7:76259778-76259800 CCCTCGCCCCTCCCCCAGCCGGG + Intronic
1027371264 7:77509634-77509656 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1027371313 7:77509761-77509783 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1029286390 7:99468777-99468799 CCCCCGCCCCTTCCCCAGGCCGG + Intergenic
1029384064 7:100232051-100232073 TCCCCACCCCGCCCCCTGCCAGG - Intronic
1029569098 7:101358984-101359006 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1029667401 7:102004647-102004669 GCCCCATCCCTCTCCAAGGCAGG - Intronic
1029730329 7:102434221-102434243 GCCCCACCCCACCCCCTGCCTGG + Intronic
1030107919 7:106002144-106002166 CCCCCACCCATCCCCCACAAAGG - Intronic
1030124816 7:106143774-106143796 GCCCGAACCCTGCTCCAGACAGG + Intergenic
1030602862 7:111610291-111610313 ACCCCACCTCCCTCCCAGACGGG - Intergenic
1030725720 7:112922767-112922789 CCCCCACCTCCCTCCCAGACAGG - Intronic
1031539112 7:122971696-122971718 TCCCCACCCTTCCCCCATATAGG + Intergenic
1032042926 7:128577096-128577118 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1032569549 7:132984834-132984856 CCCCCACCTCCCTCCCAGACCGG - Intronic
1032569623 7:132985008-132985030 CCCCCACCTCCCTCCCAGACGGG - Intronic
1033237388 7:139649152-139649174 TTACCACCCCTCCCACAGACTGG + Intronic
1034147403 7:148884731-148884753 GCCCCGCCCCTCCCCCGCCCGGG - Intergenic
1034196804 7:149254431-149254453 CCCCCCTCCATCCCCCAGACGGG - Exonic
1034638655 7:152585988-152586010 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1034723444 7:153315134-153315156 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1034924745 7:155111993-155112015 ACCCCAACCCTCCCTCACACTGG - Intergenic
1034939385 7:155220556-155220578 CCCCCAGCCCTGCCCCAGCCTGG + Intergenic
1034961859 7:155367848-155367870 CCCCCACCTCCCCCCCGGACGGG + Exonic
1035083069 7:156233506-156233528 GCCCCTCCCCCTCCCCAGAATGG - Intergenic
1035436506 7:158863773-158863795 GCTCCCCCCCGCCCCCACACCGG - Intronic
1035611991 8:973207-973229 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1036536535 8:9657305-9657327 CCCCCACCTCCCTCCCAGACGGG + Intronic
1036609153 8:10334846-10334868 GCGCCACCCCTCCCCCGCTCTGG + Intronic
1036737319 8:11330322-11330344 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1037612377 8:20487041-20487063 CCCCCCCCCCACCCCCTGACAGG - Intergenic
1037685820 8:21138698-21138720 TCCCCACCACACCTCCAGACTGG - Intergenic
1037882569 8:22580153-22580175 TCACCAGCCCTCCCCCAGAGTGG + Intronic
1037977311 8:23222892-23222914 TCCCCACCCCTTCCCCTGATGGG + Intronic
1038152459 8:24955320-24955342 GCCCCACCCCTCCCACACAGTGG + Intronic
1038437374 8:27545515-27545537 GCCCCTGCCCACCCCCAGCCCGG + Exonic
1038451347 8:27641278-27641300 TCCCCATCCCTCCCCCAGACTGG + Intronic
1039024868 8:33247206-33247228 GCTCCACCCCCACCCCCGACAGG + Intergenic
1039025818 8:33256887-33256909 CCCCCACCTTTCCCCCAAACTGG + Intergenic
1039153323 8:34529221-34529243 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1040051913 8:43023480-43023502 TCCCCTCCCCTCCCCCAGGCTGG + Exonic
1040069813 8:43179844-43179866 CCCCCACCTCCCTCCCAGACGGG + Intronic
1040785494 8:51159222-51159244 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1041070814 8:54125474-54125496 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1041358099 8:57022134-57022156 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1041677253 8:60548775-60548797 CCCCCACCTCCCTCCCAGACGGG + Intronic
1041796373 8:61752610-61752632 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1042475784 8:69246043-69246065 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1043885229 8:85591648-85591670 CCCCCGCCCCTCCCCCACCCTGG + Intergenic
1043985836 8:86694083-86694105 CCCCCACCTCCCTCCCAGACGGG + Intronic
1045002204 8:97888234-97888256 GCACCACCACTCACCCAGAAGGG - Exonic
1045282076 8:100757949-100757971 TTCCCACCACTCCCCAAGACAGG - Intergenic
1045298666 8:100892663-100892685 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1045505680 8:102776822-102776844 ACCCCACCCCCACCCCAGGCTGG - Intergenic
1045965671 8:108021763-108021785 CCCCAACCCCTGCCCCCGACAGG - Intronic
1047654485 8:126961843-126961865 CCCCCACCCCACCCCCCGCCCGG - Intergenic
1048368556 8:133758073-133758095 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1048387003 8:133921524-133921546 TCCCCACCACATCCCCAGACAGG + Intergenic
1048769244 8:137877874-137877896 ACCCCACCCCACACCCTGACAGG + Intergenic
1048926433 8:139276548-139276570 GGCCCACCCCTGCCCCTGAGCGG - Intergenic
1049307964 8:141917354-141917376 CCCCCACCCCACTCCCCGACAGG - Intergenic
1049446684 8:142634563-142634585 GCCCCACCCCAGCCCCTGCCAGG + Intergenic
1049509939 8:143022340-143022362 GCCCCAGCCCACCCCCACATTGG + Exonic
1049562268 8:143317663-143317685 GCACGGCCCCTGCCCCAGACCGG - Intronic
1049606864 8:143533625-143533647 TCCCCACCCCTTCCTCAGACAGG + Intronic
1049617118 8:143580486-143580508 GCCCCACCCCGCCCACTCACAGG + Exonic
1049639337 8:143707595-143707617 CCCCCACCCCGCCCCCGGCCCGG + Intronic
1049818173 8:144618226-144618248 GTCCCCGCCCTCTCCCAGACTGG + Intergenic
1049883082 9:11159-11181 CCCCCCCCCCGCCCCCAGCCCGG - Intergenic
1050047126 9:1558858-1558880 CCGGCACCCCTCCCCCAGCCTGG - Intergenic
1050083366 9:1938839-1938861 GCCCCTCCCCACCCCCACCCCGG + Intergenic
1050558202 9:6807773-6807795 CCCCCACCTCCCTCCCAGACGGG - Intronic
1051276900 9:15406717-15406739 CCCCCACCTCTCTCCCGGACGGG - Intergenic
1051387543 9:16525064-16525086 TCCCCCCCCCTCCCCCACTCCGG - Intronic
1052713558 9:32087827-32087849 CCCCCACCCCACCCACTGACAGG - Intergenic
1052974620 9:34401594-34401616 GCCCCAGCCCTCCCCCGGGATGG + Intronic
1053269833 9:36742463-36742485 TCCCTACCCCTCCCCCAAAGGGG + Intergenic
1053293482 9:36897337-36897359 GATCGACCCCTCCCCCAAACTGG - Intronic
1053430390 9:38038434-38038456 GCCCCACCTCCACCCCAAACTGG + Intronic
1054175061 9:61869195-61869217 CCGCCTCCCCTCCCCCAGGCCGG - Intergenic
1054449907 9:65398206-65398228 CCGCCTCCCCTCCCCCAGCCCGG - Intergenic
1054662476 9:67711598-67711620 CCGCCTCCCCTCCCCCAGGCCGG + Intergenic
1054971586 9:71094079-71094101 CCCCCACCCCCACCCCTGACAGG - Intronic
1055242246 9:74198003-74198025 CCCCCACCTCCCTCCCAGACAGG - Intergenic
1055586344 9:77761704-77761726 CCCCCACCTCCCTCCCAGACGGG - Intronic
1056243384 9:84670270-84670292 TCCCCACCCCGACCCCAGCCCGG - Intronic
1056539483 9:87558967-87558989 TACCCTCCCCTCCCCCAGAGTGG - Intronic
1056564130 9:87758445-87758467 CCCCCACCTCCCTCCCAGACAGG + Intergenic
1056564282 9:87758827-87758849 CCCCCACCTCCCTCCCAGACAGG + Intergenic
1056624855 9:88245127-88245149 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1057080428 9:92170916-92170938 GGCCCACCCCTCCCCCTCAGTGG - Intergenic
1057674841 9:97130558-97130580 GCCCCCCCCACCTCCCAGACGGG + Intergenic
1057959510 9:99440759-99440781 ACACTGCCCCTCCCCCAGACTGG - Intergenic
1059121068 9:111641384-111641406 CCCCCACCTCCCTCCCAGACAGG - Intronic
1059230681 9:112718309-112718331 GCCCCGCCCCTCCCCCGCCCCGG - Intergenic
1059277641 9:113109333-113109355 TGCCCACCCCTCGCCCAGAGGGG + Intergenic
1059278610 9:113115218-113115240 TGCCCACCCCTCGCCCAGAGGGG - Intergenic
1059325862 9:113503689-113503711 TCCCCACCCCTACCCCATCCAGG - Intronic
1059399183 9:114058176-114058198 GCCCCCCCCCTCCCCCCCACCGG - Intergenic
1059526981 9:115001101-115001123 CCCCCACCCCACCCCCCGACAGG + Intergenic
1060080192 9:120636842-120636864 GGCCCCCCCACCCCCCAGACGGG - Intronic
1060474192 9:123974661-123974683 GCCCCACCCCTCCGGCAGGTGGG + Intergenic
1060687234 9:125624014-125624036 CCCCCACCTCCCTCCCAGACGGG - Intronic
1060687308 9:125624190-125624212 CCCCCACCTCCCTCCCAGACAGG - Intronic
1060703696 9:125780370-125780392 ACCCCACCTCCCTCCCAGACGGG + Intronic
1060703723 9:125780422-125780444 CCCCCACCTCCCTCCCAGACGGG + Intronic
1060816825 9:126639414-126639436 GCCCCACCCCTCTACCCGCCTGG + Intronic
1060887464 9:127165338-127165360 GCCCTTCCCCTTCCCCAGCCAGG + Intronic
1060937993 9:127527034-127527056 GCCCCTCCCCTCCCCCAAACTGG - Intronic
1061230921 9:129315420-129315442 TCCCCACCCCACCCCCACCCTGG - Intergenic
1061516432 9:131092984-131093006 GCCCTACCCCTGCCCCTGTCAGG - Exonic
1061755406 9:132808924-132808946 TCCCCACCACTCCCCAAGCCAGG - Intronic
1061948519 9:133922151-133922173 GCCCCACCACCTCCCAAGACTGG - Intronic
1061982968 9:134116221-134116243 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1061983593 9:134117680-134117702 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1062020454 9:134316918-134316940 CAGCCACCCCTCCCCCAGGCAGG - Intergenic
1062622631 9:137429639-137429661 GTGCCACCCCGCCCCCAGACTGG + Intronic
1062627096 9:137448291-137448313 GCCCCAGCCCTCCCTCAGCTGGG + Exonic
1203463924 Un_GL000220v1:68315-68337 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1203405601 Un_KI270539v1:404-426 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1203405792 Un_KI270539v1:835-857 CCCCCACCTCCCTCCCAGACAGG - Intergenic
1203562702 Un_KI270744v1:71753-71775 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1203654512 Un_KI270752v1:10068-10090 CGCCCCCCCCACCCCCAGACAGG - Intergenic
1186344312 X:8675856-8675878 CCCCCACCCCACCCCCCGACAGG + Intronic
1187108454 X:16269848-16269870 CCCCCACCCCACCCACCGACAGG + Intergenic
1187154811 X:16712672-16712694 GCCCCAGGCCTCGCCCAGCCCGG + Intronic
1187183660 X:16965272-16965294 CCCCCACCTCCCTCCCAGACGGG + Intronic
1187184202 X:16968653-16968675 CCCCCACCTCCCTCCCAGACGGG + Intronic
1187976332 X:24709023-24709045 CCCCCACCTCCCTCCCAGACGGG + Intronic
1188141360 X:26556297-26556319 CCCCCACCCCACTTCCAGACAGG - Intergenic
1188261275 X:28027107-28027129 GCCCTTCTCCTCCCCCAAACTGG - Intergenic
1188367583 X:29333588-29333610 CCCCCACCTCCCTCCCAGACGGG + Intronic
1188367805 X:29334079-29334101 GCCCCACCTCCCTCCCGGACGGG + Intronic
1188477269 X:30602706-30602728 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1189056799 X:37707265-37707287 CCCCCACCTCCCTCCCAGACGGG + Intronic
1189210359 X:39278019-39278041 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1189210432 X:39278194-39278216 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1189210500 X:39278369-39278391 CCCCCACCTCTCTCCCAGACGGG - Intergenic
1189256646 X:39645156-39645178 ACCCCTCCCCTCCCCCACCCTGG + Intergenic
1189569986 X:42285718-42285740 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1189570006 X:42285764-42285786 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1189837597 X:45040404-45040426 CCCCCACCTCCCTCCCAGACGGG + Intronic
1189955864 X:46275650-46275672 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1189968406 X:46395744-46395766 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1189968449 X:46395842-46395864 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1190109544 X:47581383-47581405 GCCCCACCCCACCCCCCACCAGG + Intronic
1190521187 X:51280278-51280300 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1190769642 X:53504259-53504281 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1190778983 X:53578336-53578358 CCCCCACCTCCCTCCCAGACGGG - Intronic
1190779185 X:53578786-53578808 CCCCCACCTCCCTCCCAGACGGG - Intronic
1191010052 X:55749041-55749063 CCCCCACCTCCCTCCCAGACGGG - Intronic
1191068958 X:56380248-56380270 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1191068980 X:56380294-56380316 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1191098966 X:56704772-56704794 GCCCCTCCCCTCCTCCAGGCTGG + Intergenic
1191741026 X:64434982-64435004 CCCCCACCCCCCTCCCAGAAAGG - Intergenic
1192045626 X:67670748-67670770 GCCCTACCCCACTCCCTGACAGG + Intronic
1192068258 X:67909858-67909880 CCCACACCTCTCCCTCAGACAGG - Intergenic
1192260800 X:69504996-69505018 GCCCCGCACCGCCCCCAGCCGGG + Intergenic
1192476946 X:71452116-71452138 CCCCCACCTCCCTCCCAGACGGG + Intronic
1192768820 X:74167212-74167234 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1192768868 X:74167310-74167332 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1192813400 X:74568671-74568693 CCCCCACCTCTCTCCCGGACCGG + Intergenic
1193068107 X:77279562-77279584 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1193068130 X:77279611-77279633 CCCCCACCTCCCTCCCAGACAGG - Intergenic
1193207400 X:78765294-78765316 CCCCCACCTCCCTCCCAGACAGG - Intergenic
1193316052 X:80066272-80066294 GGGACACCCCTCCCCCAGCCAGG + Intergenic
1193345171 X:80396909-80396931 CCCCCACCTCCCTCCCAGACGGG + Intronic
1193345222 X:80397034-80397056 CCCCCACCTCCCTCCCAGACGGG + Intronic
1193362310 X:80591456-80591478 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1193806576 X:86002673-86002695 GCGACGCCCCTCCCCCAGCCAGG - Intronic
1193924411 X:87466210-87466232 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1194278167 X:91913205-91913227 CTCCCTCCCATCCCCCAGACTGG - Intronic
1194611475 X:96050923-96050945 CCCCCACCTCCCTCCCAGACGGG + Intergenic
1194714551 X:97275229-97275251 GCCCCCCCCACCTCCCAGACGGG + Intronic
1194838982 X:98715339-98715361 ACCCCTCCCCTTCACCAGACAGG - Intergenic
1195845985 X:109229194-109229216 TGGACACCCCTCCCCCAGACAGG - Intergenic
1196717312 X:118824028-118824050 CCCCCACCCCTCTCCCCGCCGGG - Intronic
1197335460 X:125205297-125205319 GCTCCGCCCCTCACCCAGCCTGG + Intergenic
1197433206 X:126391986-126392008 CCCCCACCCCACACCCTGACAGG - Intergenic
1197455736 X:126674153-126674175 CCCCCACCTCCCTCCCAGACGGG - Intergenic
1197771498 X:130092325-130092347 GCCCCGCCCCTGCCTCACACAGG + Intronic
1197977354 X:132180054-132180076 CCCCCACCCCACCCTCTGACAGG - Intergenic
1198006407 X:132498908-132498930 TCCACATCCCTCCCCAAGACAGG + Intergenic
1198715940 X:139558085-139558107 GCCACTCCCCTCCCCCAGCGGGG + Intronic
1199622220 X:149711970-149711992 GCCTCGCCCCGCCCCCACACGGG + Intronic
1199980684 X:152918793-152918815 GCCTCTCCCCTTCCCCAGAAAGG - Intronic
1200059363 X:153477337-153477359 GCTCCGCCCCTCCCCCTGCCTGG - Intronic
1200137545 X:153882369-153882391 GCCCCACCCCTTCCCAGCACAGG + Intronic
1200182530 X:154159426-154159448 GCGCCATCCCTGCCACAGACTGG - Intergenic
1200188184 X:154196540-154196562 GCGCCATCCCTGCCACAGACTGG - Intergenic
1200193834 X:154233680-154233702 GCGCCATCCCTGCCACAGACTGG - Intergenic
1200199589 X:154271484-154271506 GCGCCATCCCTGCCACAGACTGG - Exonic
1200402721 X:156028982-156029004 GCACCCCCCCGCCCCCAGCCCGG + Intergenic
1200595505 Y:5135280-5135302 CTCCCTCCCGTCCCCCAGACTGG - Intronic
1202366215 Y:24167895-24167917 GCCCCTCCCCTCTCCCAGATTGG + Intergenic
1202504566 Y:25502228-25502250 GCCCCTCCCCTCTCCCAGATTGG - Intergenic