ID: 965770462

View in Genome Browser
Species Human (GRCh38)
Location 3:172176535-172176557
Sequence TTTCATGTACAGGAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 336}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965770459_965770462 -6 Left 965770459 3:172176518-172176540 CCTGCTACAACTGCAGATTTCAT 0: 1
1: 0
2: 1
3: 16
4: 181
Right 965770462 3:172176535-172176557 TTTCATGTACAGGAAGAGGAAGG 0: 1
1: 0
2: 4
3: 29
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965770462 Original CRISPR TTTCATGTACAGGAAGAGGA AGG Intronic
903687488 1:25142568-25142590 TTTCAGGAACAGGAAGCGAAGGG - Intergenic
905413880 1:37791742-37791764 TTTCTGGGACAGGCAGAGGAAGG - Intergenic
906050967 1:42871618-42871640 TTCTATGTAGAGGAAGAAGAAGG + Intergenic
907654428 1:56327703-56327725 TTTATTGTACATGAAGAAGAAGG + Intergenic
908117872 1:60958161-60958183 TGTTATCTACAGGAAGAGAAAGG - Intronic
911227735 1:95325638-95325660 TTTCATGGTCAGTAAGAGTAGGG - Intergenic
911401157 1:97377452-97377474 TTTCATATCAAGGCAGAGGAAGG - Intronic
911862014 1:102963470-102963492 TTTCATGTATAAATAGAGGATGG + Intronic
914258881 1:145982397-145982419 TGTCATGTCCAGCCAGAGGATGG + Intergenic
914568640 1:148892660-148892682 TTTGATGAGAAGGAAGAGGAGGG - Intronic
915456342 1:156043360-156043382 CTTCATCTCCAGGATGAGGAAGG - Intronic
916078166 1:161215188-161215210 TCTCTTGTGCAGGAAGGGGAAGG + Intergenic
918236631 1:182586634-182586656 GTTAATTTCCAGGAAGAGGAAGG - Exonic
918309139 1:183273167-183273189 TTTTATGGACAGAAAAAGGAAGG - Intronic
920871046 1:209795291-209795313 ATTGATGTTCAGGAAGGGGAAGG + Exonic
920970270 1:210737343-210737365 TTTTTTGTACTGGAAGAGAAAGG - Intronic
922352802 1:224748098-224748120 TTCCAGGTACAGGAGGAGGAGGG - Intergenic
922776712 1:228217661-228217683 TCTCATGTGCAGGGAGAAGAAGG + Intronic
924007862 1:239632041-239632063 CCTCATGTACCTGAAGAGGACGG - Intronic
924082712 1:240416037-240416059 TTTCACATACAGAAAGAGGAAGG - Intronic
924286522 1:242493463-242493485 TTTCATGTTGCAGAAGAGGAGGG + Intronic
1066124423 10:32326154-32326176 TTTTGTGTATTGGAAGAGGAAGG - Intronic
1066206506 10:33194591-33194613 TTAAATGTACAGGATGGGGAAGG - Intronic
1067669136 10:48303690-48303712 TTGCATGAAAAGGAAGAAGAAGG + Intergenic
1069544759 10:69320084-69320106 TTAGATGCACAGGAAGAGGATGG - Intronic
1070443231 10:76466917-76466939 ATTCATGTGCTGGAAGAGGATGG - Intronic
1070509508 10:77147635-77147657 TTTTATCTACGGGAAGAAGAGGG - Intronic
1071593323 10:86897499-86897521 ATTCATGTCAAGCAAGAGGAAGG + Intronic
1072015059 10:91338369-91338391 TTCCACACACAGGAAGAGGAGGG - Intergenic
1073230812 10:101968123-101968145 TTTCATGAAAAAGAAGAGGCTGG - Intronic
1073243490 10:102073453-102073475 TTTGAAGTACAGGAAGATGCTGG + Intergenic
1075450047 10:122544938-122544960 ATGCATGGACAGGAAGGGGATGG - Intergenic
1075889644 10:125936019-125936041 TTTCAACTACAGGAAAAGCATGG + Intronic
1076218400 10:128713986-128714008 TTTCATCCCCTGGAAGAGGAAGG + Intergenic
1076539441 10:131204835-131204857 TTTTATGAACAGGCAGAGGAAGG + Intronic
1076904272 10:133354536-133354558 TGACAGGTACAGGAAGAAGATGG - Intergenic
1078105220 11:8354173-8354195 TTTCATGTGGAGAAAGAGCAAGG - Intergenic
1078731313 11:13976851-13976873 TAACATGTACAGGAAAGGGAGGG - Intronic
1079356079 11:19731208-19731230 TTTTATGTACAGGAAATGGGAGG - Intronic
1081240006 11:40693776-40693798 ATCCAGGTAAAGGAAGAGGAGGG + Intronic
1081449850 11:43160813-43160835 CTTAATGTCCAGGAAGAGAAAGG + Intergenic
1081451129 11:43171843-43171865 CTTAATGTCCAGGAAGGGGAAGG + Intergenic
1081880765 11:46449549-46449571 TTCCATGTTCATGAATAGGAAGG + Intronic
1082894967 11:58180202-58180224 TCTCAAGTACATGAAGATGAGGG - Exonic
1084371643 11:68749258-68749280 CTTAGTGTACAGGAAAAGGATGG - Intronic
1085308516 11:75501861-75501883 TCTAATTTACTGGAAGAGGAGGG + Intronic
1086978847 11:93170922-93170944 TTTCATGTAGACTAAGGGGAGGG + Intronic
1087733927 11:101810414-101810436 ATTAATATACAGGAAGGGGATGG + Intronic
1087961025 11:104349407-104349429 TTTCATGTACAGAGAGGGGAGGG + Intergenic
1088211230 11:107458597-107458619 TTACATTTACAAGAAGAAGAAGG + Intergenic
1089042193 11:115462613-115462635 TTTGATGTGGAGGAGGAGGAGGG + Intronic
1089473558 11:118740334-118740356 TTTCATGACCATGAAGAAGAGGG - Intergenic
1089863925 11:121615389-121615411 TTTCTTGCATAGCAAGAGGAGGG - Intronic
1090001216 11:122960468-122960490 TTTCCTCTATAGGAAAAGGAAGG - Intergenic
1091124989 11:133086497-133086519 TTTCATCTACAGGAAGAAGATGG - Intronic
1092257254 12:6934159-6934181 TGACATCTACAGGAGGAGGAAGG - Exonic
1092409937 12:8244884-8244906 TTTCATTTAAATCAAGAGGATGG + Intergenic
1093684756 12:22043728-22043750 TTCCAGGAAGAGGAAGAGGATGG - Intergenic
1094132482 12:27089331-27089353 TTTCAGGGGCAGGGAGAGGATGG + Intergenic
1094177838 12:27559824-27559846 TTTCATGTAGAGAAATAGCAGGG - Intronic
1094220776 12:27991014-27991036 TCTCATGTACATGAATTGGAAGG + Intergenic
1094305870 12:29018541-29018563 TTTAATATATATGAAGAGGAAGG - Intergenic
1094478795 12:30863603-30863625 TTTCATCTGCAGGAAAATGAAGG - Intergenic
1094780399 12:33785635-33785657 TTTCATGAGCAGGGAGAAGAAGG - Intergenic
1095915640 12:47475229-47475251 TTCTATGTACAGGAAGGGTAGGG - Intergenic
1097226817 12:57481823-57481845 TTTAAGGAACAGGCAGAGGAAGG - Intronic
1097982205 12:65745760-65745782 TTTCATGAATATGAAGTGGATGG + Intergenic
1098254416 12:68602088-68602110 CTTAAAGGACAGGAAGAGGAAGG + Intergenic
1098423652 12:70333577-70333599 TTAAATGTAAAGGAAGTGGAAGG + Intronic
1098471827 12:70853888-70853910 TTTGATGTACAGTAAGAGTAAGG - Intronic
1098822607 12:75251985-75252007 TTTCATCAACAGGAAGAACAGGG + Intergenic
1099758340 12:86885316-86885338 TTTCATGTACAAGTAATGGAAGG + Intergenic
1099777992 12:87158741-87158763 ATACATGTAGAGGAAGAGAATGG - Intergenic
1099802248 12:87472075-87472097 CTTCATGGACAGGAAAAGGAAGG - Intergenic
1099966501 12:89452087-89452109 TCTCTTCCACAGGAAGAGGAAGG + Intronic
1100466006 12:94845951-94845973 CTTCATGTAAAGAAAGAGAATGG + Intergenic
1100677259 12:96880970-96880992 TTTTATGTCCAAGAAGAAGATGG - Intergenic
1103574043 12:121863862-121863884 TTTCAGGTTCAGGAAGTGGAAGG - Intergenic
1104038005 12:125111734-125111756 TTTCATGTAAAGGAAGAGAAAGG - Intronic
1104577920 12:129984926-129984948 TTTAATTTACAGGGGGAGGAGGG - Intergenic
1106593992 13:31121539-31121561 TTTCTTACACAGGAAGAAGAAGG + Intergenic
1106974778 13:35196613-35196635 TTTCATGTACATAATGGGGAAGG + Intronic
1107421267 13:40249029-40249051 TTTCAGGTAGAGGAAGAAGGTGG + Intergenic
1108409877 13:50134733-50134755 TGTCAGGCACAGGAATAGGACGG + Intronic
1109140188 13:58704853-58704875 TTTCAGGTGCAGGATGTGGAAGG + Intergenic
1110551667 13:76817659-76817681 TACCATGTACAGGAAAATGATGG - Intergenic
1110976949 13:81850140-81850162 TTACATGTACAGGTAGAAAATGG + Intergenic
1110991997 13:82053568-82053590 TTTTATATACAGTAAAAGGAAGG - Intergenic
1113117356 13:106887391-106887413 TTTCATGGACAGGAAAAAGAAGG - Intergenic
1113986803 13:114324166-114324188 TCTGGTGTTCAGGAAGAGGAGGG - Exonic
1114903961 14:27101584-27101606 TTTCCTGGAAAGTAAGAGGAAGG + Intergenic
1115175333 14:30555558-30555580 TTTCCTTTTCAGGAAAAGGATGG - Intergenic
1116159707 14:41253289-41253311 TCTCATGTCCAGGAAGAATAAGG + Intergenic
1116907659 14:50420704-50420726 TTTCACTAACAGGAAGAGGATGG + Intronic
1117601935 14:57385188-57385210 ATTCATGCCCAGTAAGAGGAAGG - Intergenic
1117902254 14:60547126-60547148 TTTCATATAGAGTAAGAGGTGGG + Intergenic
1118045827 14:61970189-61970211 GTTGATGAAGAGGAAGAGGACGG - Intergenic
1118393923 14:65319509-65319531 TTTACTGTACTGGGAGAGGAGGG + Intergenic
1118957459 14:70496463-70496485 TCTCATGGAGAGGAAGAGAAGGG + Intergenic
1119053929 14:71399283-71399305 TCTCATTTACAGGAAACGGATGG - Intronic
1119784852 14:77305381-77305403 TTTGATGGACAGGTAGGGGATGG - Intronic
1119813076 14:77540375-77540397 GTGCATATGCAGGAAGAGGAAGG + Intronic
1120288264 14:82533353-82533375 TTTCATGGACAGGAAAAGTAAGG + Intergenic
1120311252 14:82831050-82831072 TATAATGTACATGAAGAGGTTGG + Intergenic
1120445392 14:84588543-84588565 TTTCAAATACAGCCAGAGGAGGG + Intergenic
1120458568 14:84764110-84764132 TTTCCTGTTCAGGAAGTGGTAGG + Intergenic
1120543501 14:85781092-85781114 TATCATGTACAACATGAGGATGG + Intergenic
1121741611 14:96256502-96256524 TTTCCAGAACAGGAGGAGGAGGG + Intronic
1121907500 14:97760268-97760290 TTTAATATACATGAGGAGGAGGG + Intronic
1123165560 14:106322429-106322451 GCCCATGTACATGAAGAGGAGGG - Intergenic
1123677849 15:22729566-22729588 TTTCATTTACATGATGGGGAAGG - Intergenic
1124330050 15:28803830-28803852 TTTCATTTACATGATGGGGAAGG - Intergenic
1126981227 15:54245890-54245912 TTTCCTCCACAGGATGAGGAGGG + Intronic
1129143622 15:73626634-73626656 TTTCATGTGCAGGAAGATACAGG - Intronic
1130008875 15:80131262-80131284 TTTCATGTGCAGGAAGAAAGTGG + Exonic
1130841257 15:87703311-87703333 TTTCATGATCCTGAAGAGGAAGG - Intergenic
1133478980 16:6151152-6151174 TTCTATATACAGGAAGAGTAAGG - Intronic
1135838710 16:25853890-25853912 TTTCAAGAACTTGAAGAGGAGGG - Intronic
1135886895 16:26318382-26318404 TCTGATGTTCAGGAAGAAGAAGG + Intergenic
1137913507 16:52403471-52403493 TTTTAGCTATAGGAAGAGGAAGG + Intergenic
1138663855 16:58545921-58545943 TTTTATCTACATGAAGAAGATGG - Intronic
1138838095 16:60462750-60462772 TTTCATATAGAGTAAGAGGTAGG + Intergenic
1140307143 16:73813743-73813765 TCTGAGGTACAGGAAGAGGAGGG - Intergenic
1140682035 16:77394568-77394590 CTTAATATACAGAAAGAGGAGGG + Intronic
1142352064 16:89585098-89585120 TTTCACCTGCAGGAAGTGGAAGG - Intronic
1143153821 17:4823220-4823242 GTTCAAGGGCAGGAAGAGGAAGG - Exonic
1143785527 17:9252766-9252788 TTTCATCTACAGGAAGACGGGGG - Intronic
1143980488 17:10865258-10865280 TTGAATGTGAAGGAAGAGGATGG - Intergenic
1143989105 17:10941702-10941724 TTTTATGCTCAGAAAGAGGAGGG - Intergenic
1144145197 17:12390739-12390761 CTTCCAGAACAGGAAGAGGAAGG + Intergenic
1144528769 17:16015535-16015557 TTTCAAGGAAAGGAGGAGGAAGG - Intronic
1145980345 17:29007391-29007413 TTCCCTGTAGAGGAATAGGAGGG + Intronic
1147387138 17:40089368-40089390 TTTCATGTGGAGGAAGCGGCTGG - Intronic
1149431552 17:56598198-56598220 TTTCAAATACTGGAAGAGAATGG + Intergenic
1150607356 17:66705717-66705739 CTTCATTTACAGGAACTGGAAGG + Intronic
1152567428 17:81106550-81106572 CTTCATGGCCAGGAGGAGGAAGG + Intronic
1155299451 18:24416012-24416034 TTTCATGTACAGGAAAACCTTGG + Intergenic
1156145357 18:34169411-34169433 TTTAATGTGCAGGAAAAAGAAGG + Intronic
1157574771 18:48736244-48736266 TTTCATGTCTGGGATGAGGAAGG + Intronic
1158507502 18:58059624-58059646 CTTCATGGACAGGATGAGGTGGG - Intronic
1159877436 18:73828062-73828084 TTTCATATTCACGAAGAGGAAGG + Intergenic
1161353629 19:3807042-3807064 TGAGATGTACAGGAACAGGAGGG - Intronic
1161884044 19:6979675-6979697 TCCCAGATACAGGAAGAGGAGGG + Intergenic
1162960007 19:14120034-14120056 TCAGATGTACAGGAAGAGAAAGG + Exonic
1164982805 19:32626912-32626934 TTTCATGCCCAGGACTAGGAGGG - Intronic
1166341072 19:42137418-42137440 TTTCAAGAATAGGTAGAGGAGGG + Intronic
1167497137 19:49826355-49826377 TTTGATGGCTAGGAAGAGGAGGG + Intronic
925063636 2:912480-912502 ATTCATGTATATGAAGGGGAAGG + Intergenic
925063746 2:913223-913245 ATTCATGTATATGAAGGGGAAGG + Intergenic
925063834 2:913812-913834 ATTCATGTATATGAAGGGGAAGG + Intergenic
927755985 2:25708278-25708300 ATCCATGTACAGGCAGAGGCTGG - Intergenic
927761107 2:25754919-25754941 TTTCTTCTAAAAGAAGAGGATGG + Intronic
927937585 2:27084320-27084342 CTTCATGAACAGGGAGAAGATGG - Intronic
928484349 2:31714404-31714426 TTTCACAAAAAGGAAGAGGAAGG + Intergenic
928799958 2:35077088-35077110 TTTCATGTAAAAGAAGAGTTAGG + Intergenic
929421756 2:41797878-41797900 TTTCATGTTCATGGACAGGAAGG - Intergenic
929569095 2:43008688-43008710 TTTCAGTTAGAGGGAGAGGAAGG + Intergenic
930141397 2:47954438-47954460 TTTCAGGTCCAGAAGGAGGAGGG - Intergenic
930709100 2:54533429-54533451 TTACATATTCAGGAAGAGGTTGG - Intronic
931958928 2:67459864-67459886 TTTCATTAACAGGTACAGGAAGG + Intergenic
932484564 2:72075826-72075848 TTTCATGTAGAGGGAGATGATGG - Intergenic
932652167 2:73570080-73570102 TGACAGGAACAGGAAGAGGAGGG + Intronic
933457975 2:82541214-82541236 TGTGATAGACAGGAAGAGGAAGG + Intergenic
933481017 2:82857326-82857348 TTTGATGTCCAGGAGGAGAAAGG + Intergenic
933588706 2:84207824-84207846 TTTCATGCATAAGAAGAGTAAGG - Intergenic
933870342 2:86559798-86559820 ATTCATAGGCAGGAAGAGGATGG + Intronic
934764873 2:96875094-96875116 TTTCATGCACAGGGATAGGGTGG - Intergenic
935389192 2:102532542-102532564 TTTCATGCAGTGGATGAGGAGGG + Exonic
936013859 2:108943195-108943217 TTTCAAGTACAGTAACGGGAAGG + Intronic
936109778 2:109655474-109655496 ACTCATGCACAGGAAGAGGATGG + Intergenic
937180472 2:119991412-119991434 ATTCAAGTACAGAAAGAGGCGGG + Intergenic
937292633 2:120790763-120790785 TTTCATGTACAGTGATGGGAAGG + Intronic
937583354 2:123516233-123516255 TCTCATGTTCAACAAGAGGAGGG - Intergenic
940154890 2:150645237-150645259 TTTCCTAAAGAGGAAGAGGATGG - Intergenic
940657969 2:156511471-156511493 TTTCATGTACAAAAAGAGATAGG - Intronic
941888134 2:170550805-170550827 TTTGCTGTGCAGGAAGAGGGTGG + Intronic
943467278 2:188243635-188243657 TTTTTTCTACAGTAAGAGGAAGG - Intergenic
944361149 2:198858642-198858664 TTTCATGTTCATGGAGTGGAAGG + Intergenic
945332436 2:208555562-208555584 TTTCGTGGACAGAGAGAGGATGG - Intronic
946164425 2:217855303-217855325 TTTCACGGGCAGGATGAGGAAGG - Intronic
948008693 2:234633234-234633256 TGACATGTTCAGGAAGAGGCTGG - Intergenic
1168845411 20:941184-941206 TGTCATGTTCAGGAACAGAAAGG + Intergenic
1168875647 20:1170536-1170558 TTTCCTGTACCAGAAAAGGAAGG + Intronic
1169062619 20:2672619-2672641 TTTCTTGCTCAGGAGGAGGAAGG + Intergenic
1169447930 20:5688052-5688074 TTGCATGAGCAGGAAGGGGAAGG - Intergenic
1171157625 20:22890854-22890876 TTTAATGTGCAGGGAGAGGTGGG - Intergenic
1172466344 20:35157901-35157923 TTTCAAGTACAGGGTGAAGAAGG - Intergenic
1172516239 20:35536000-35536022 TTCCATAAAAAGGAAGAGGAGGG - Intergenic
1173153334 20:40586655-40586677 TTTCATGTACAGGAAAGGAGAGG + Intergenic
1173645074 20:44628219-44628241 TTGCATCTTCAGGATGAGGATGG + Intronic
1173803302 20:45908460-45908482 GTTCTTGTTCTGGAAGAGGATGG - Intronic
1176886725 21:14265510-14265532 TTTCAGGTACAGGAATAACATGG - Intergenic
1177944128 21:27446131-27446153 TTTCCCATACAGGAAGAGGAGGG + Intergenic
1178093279 21:29187113-29187135 TTCCATGTGCAGGGAGAGCATGG + Intergenic
1178409121 21:32349337-32349359 CTCCATGTCCAGGAAGAGGTCGG + Exonic
1178812038 21:35893257-35893279 TTCCATGCAGAGGAAGAGGTGGG - Intronic
1182159011 22:28103284-28103306 CTTCATTTGCAAGAAGAGGAAGG + Intronic
1184641971 22:45877645-45877667 TTTCTCGTCCAGGAAGAGGATGG + Intergenic
1185019226 22:48364097-48364119 TTTCACCTCCAGGAAGGGGATGG + Intergenic
950105166 3:10384045-10384067 TTTCAGGCACAGGAGGAGGAAGG - Intronic
950135508 3:10577892-10577914 TTTTCTGCACAGGAAGTGGATGG - Intronic
951576833 3:24122941-24122963 CTTCATGTGCAGGAAGCGGCTGG + Exonic
952958866 3:38577325-38577347 TTGCAAGGACAGGAAGTGGAGGG - Intronic
954675518 3:52313374-52313396 TTCCCTTTACAGGAGGAGGAGGG - Intergenic
954757213 3:52847586-52847608 TCTCATGTAAATGAAGAAGAGGG - Intronic
955533295 3:59897380-59897402 TTTAGGGAACAGGAAGAGGAAGG - Intronic
955950882 3:64240880-64240902 TTTTATGGCCAAGAAGAGGAAGG + Intronic
957055179 3:75437008-75437030 TTTCATTTAAATCAAGAGGATGG + Intergenic
958120574 3:89282505-89282527 TTCCATGTGTAGGAAGATGATGG - Intronic
958922867 3:100125701-100125723 TTTCATCCACAGGAAGAGTCTGG - Intronic
959710600 3:109382217-109382239 TTTCATGGCCATGAAGAAGATGG + Intergenic
960046819 3:113206582-113206604 TATTATATACAGGAAGAGAATGG - Intergenic
960957868 3:123047010-123047032 TTTCCTCAACAGGCAGAGGATGG - Intergenic
961370595 3:126427029-126427051 TTCCATGTTCAGGGATAGGAAGG + Intronic
961529047 3:127528635-127528657 TTGCATATAGAAGAAGAGGAGGG + Intergenic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
964245268 3:154644550-154644572 TTTCAGGTAGAGGAAGTAGATGG - Intergenic
964900229 3:161649944-161649966 TTTTATATACAGGAAAAGGCAGG + Intergenic
965123478 3:164594178-164594200 TTTCAGCTGCAGGAAGAGGGAGG + Intergenic
965351649 3:167618971-167618993 CTTCATGTTCAGGAAGAGAATGG - Intronic
965386391 3:168051148-168051170 TTTCATCTTCAGTAAGAGAATGG + Intronic
965508814 3:169545773-169545795 ATTCATGTCAGGGAAGAGGAAGG - Intronic
965770462 3:172176535-172176557 TTTCATGTACAGGAAGAGGAAGG + Intronic
966063669 3:175790024-175790046 TTTCATAAACAGGAAAAGCAGGG + Intronic
966318307 3:178673545-178673567 GTTCATCTATAGTAAGAGGAGGG - Intronic
966550982 3:181203718-181203740 TTTCTTGTCCAGTGAGAGGAAGG + Intergenic
966657210 3:182373209-182373231 TGTCATGTACAGCAACTGGATGG + Intergenic
966997024 3:185292924-185292946 TTTCATGTAAAGAAAAATGAGGG - Intronic
968386575 4:144624-144646 TTTTATGTTCATGAATAGGAAGG - Intronic
968480461 4:830860-830882 TTTCATGCCCAGGAAGTGGGAGG + Intergenic
969506101 4:7588716-7588738 CTTCCTGTCCTGGAAGAGGAAGG + Intronic
969756006 4:9151340-9151362 TTTCATTTAAATCAAGAGGATGG - Intergenic
970199066 4:13583521-13583543 TTTCAGGGACTGGAAGGGGATGG + Intronic
970495486 4:16620691-16620713 ATTCAAGAACAGGAAGAGGAAGG - Intronic
970506724 4:16738350-16738372 TTTCTTTTATAGGAAGAAGAAGG + Intronic
971704547 4:30023437-30023459 TGCCATGTTTAGGAAGAGGAAGG - Intergenic
971944772 4:33260112-33260134 TTTTATTTAGAGCAAGAGGAAGG - Intergenic
972339683 4:38140729-38140751 TTTCATGTACAAAATGAGGTGGG - Intergenic
972426783 4:38940854-38940876 TCTCTTGCAGAGGAAGAGGAGGG - Intronic
974391233 4:61271919-61271941 TTTAATGCAAAGCAAGAGGAAGG + Intronic
974516915 4:62927710-62927732 TTTCAAGTTCAGTAAGTGGAAGG + Intergenic
975380995 4:73700581-73700603 TTTCATGTGGAAGAAAAGGAAGG + Intergenic
976048013 4:80976145-80976167 TTAACTGGACAGGAAGAGGAAGG - Intergenic
976764893 4:88589940-88589962 TTTCATCTTGAGGAAAAGGATGG - Intronic
977593916 4:98857494-98857516 ATTCATTTACAGGCAGAGGCAGG + Intergenic
978372880 4:108046801-108046823 CTTCAAGTACAGTATGAGGAGGG + Intergenic
978928425 4:114280071-114280093 TTTCAGGTACAGCAATAAGAAGG + Intergenic
981596192 4:146425580-146425602 TTTCAAGTTCAGGAAGAGGGAGG - Intronic
982175244 4:152700026-152700048 ATTCATGTAAGGGATGAGGATGG + Intronic
982476214 4:155854573-155854595 TTCAATTTAAAGGAAGAGGAGGG + Intronic
983853726 4:172616084-172616106 TATCAGTTACAGGCAGAGGATGG - Intronic
984430723 4:179645382-179645404 TATCAAGAACAGGAAGAGGGTGG - Intergenic
984530436 4:180909500-180909522 TTCCATGGGAAGGAAGAGGAAGG - Intergenic
985128414 4:186718140-186718162 TTCCATGTACAGCAAGAAAACGG + Intronic
985170054 4:187139135-187139157 TCTCATGCCCAGGAAGAAGAGGG + Intergenic
985485485 5:146175-146197 TACCATGGAAAGGAAGAGGAGGG - Intronic
989427511 5:41313875-41313897 TTTCACGTATAGGTACAGGAAGG + Intronic
989635089 5:43523505-43523527 CTTCCTGTACAGGAAGAGGAGGG + Intergenic
989713601 5:44431797-44431819 TTTCATGTTCAATAATAGGAAGG - Intergenic
991054791 5:62308141-62308163 TTTCATATACAGGATAACGATGG - Intronic
991947580 5:71914586-71914608 TTTCAATTCCAGGAAAAGGAAGG - Intergenic
992309975 5:75487301-75487323 TTTAATGTATAGCAAGAGGTAGG - Intronic
992699444 5:79327114-79327136 TTGCATGTACAACAAGAGAAAGG - Exonic
992729148 5:79640679-79640701 ACTCAAGTACAGGAAGAGAATGG - Intronic
992779641 5:80116363-80116385 TTCTCTGTCCAGGAAGAGGAAGG - Intronic
993153059 5:84184948-84184970 TTTCATTTAATGGATGAGGATGG + Intronic
994179394 5:96747333-96747355 TTTCATTTACAGGATAAAGATGG + Exonic
994916086 5:105982128-105982150 TATCATGCAAAGGAAGATGATGG + Intergenic
995012968 5:107278233-107278255 TTTAAAGTACAGGAAGGGAAAGG - Intergenic
995098626 5:108271228-108271250 TTTAATAGACTGGAAGAGGAAGG - Intronic
995172902 5:109138119-109138141 AAGCATGTACAGGAAAAGGAGGG + Intronic
995772099 5:115681923-115681945 TTTCAATAAAAGGAAGAGGAAGG - Intergenic
997293945 5:132758165-132758187 TATCATATACAGGGAGAGGTGGG - Intronic
997661503 5:135592596-135592618 TGTGATTTACTGGAAGAGGAAGG + Intergenic
998393906 5:141806060-141806082 TTTCCTGTGCAGGAAGAGTCAGG - Intergenic
998673403 5:144379340-144379362 TTTCACGTACTAGAAGAAGAGGG + Intronic
1000458265 5:161480125-161480147 GTTCATGGAGAGGAAGAGAAAGG - Intronic
1003335061 6:5163229-5163251 TTTCATGTATGGTATGAGGAAGG + Intronic
1003795513 6:9598288-9598310 TTTCAGCTAAATGAAGAGGAGGG + Intronic
1004244342 6:13958509-13958531 ATTCATGGATAGGAAGAGGTGGG + Intronic
1004636029 6:17468693-17468715 TTCCATCAACTGGAAGAGGATGG - Intronic
1004685428 6:17938735-17938757 CTCCATGTACAGGAAGAAAATGG - Intronic
1006103412 6:31701275-31701297 TTTCCTGTACAAGTAGAAGAAGG + Exonic
1007509846 6:42366515-42366537 ATGCAGGTGCAGGAAGAGGAGGG - Intronic
1008385126 6:50880379-50880401 ATACCTGTACAGGAAGGGGAGGG - Intergenic
1008610284 6:53179191-53179213 TTTTCTTTACAGGAAGAGGGGGG + Intergenic
1009666018 6:66680668-66680690 TTTCATTTACTGGCAGAGGGAGG + Intergenic
1009927666 6:70139511-70139533 TTTAATGTAGGGGTAGAGGAAGG - Intronic
1009957972 6:70479534-70479556 TTTCATTTATAGGTAGAGAAAGG - Intronic
1009961507 6:70528383-70528405 TTTAGTGTAGAAGAAGAGGATGG + Exonic
1010186926 6:73155658-73155680 ATTGATGTACAGGAAGAGATTGG + Intronic
1013279066 6:108617837-108617859 TTTTATGTACAGTAAAAGAATGG + Intronic
1013356527 6:109350248-109350270 TTCCCTGTGCAGGGAGAGGAGGG + Intergenic
1015490769 6:133823195-133823217 GTCCGTTTACAGGAAGAGGACGG - Intergenic
1017187623 6:151618000-151618022 TTTCATAATCAGGAAGAGCAAGG - Exonic
1017382083 6:153843022-153843044 TTAAATGTAGAGGAAGAGGAGGG - Intergenic
1018600295 6:165531011-165531033 TCCCATGTAGAGGAGGAGGATGG - Intronic
1021174708 7:17437809-17437831 TTTGATGTCCATTAAGAGGAAGG - Intergenic
1022154039 7:27641162-27641184 TTTCATGTATTGGAAGAGTTGGG - Intronic
1023515347 7:40996255-40996277 TTTCATGTACAGGAAGACAGAGG - Intergenic
1024118329 7:46213406-46213428 TTTCATGGAAAGGAACAGGTAGG + Intergenic
1024438362 7:49386129-49386151 TTTCATGTACATTGATAGGAAGG - Intergenic
1025034533 7:55585460-55585482 TTTCATGGCCATGAAGAAGAGGG + Intergenic
1027461074 7:78454333-78454355 TTTCATGTATAGAGAAAGGAAGG - Intronic
1027812649 7:82924952-82924974 TTTCTTGTACAGTTAGAGGGAGG - Intronic
1028357081 7:89923526-89923548 CATCAGGTACAGCAAGAGGATGG - Intergenic
1028478699 7:91280369-91280391 CTTGATGTGCAGGCAGAGGAGGG + Intergenic
1029724784 7:102395610-102395632 GATTATGTACAGGAAGAGGCAGG + Intronic
1030207476 7:106964936-106964958 TTGCATGTAGGGGAATAGGAGGG + Intergenic
1030382368 7:108827049-108827071 TTGCTTGTATAGGAAAAGGAAGG + Intergenic
1031342915 7:120627237-120627259 TTTTATGTAGAAGAAGAGAAAGG + Intronic
1031488546 7:122359732-122359754 TTCTAGGTACAGGACGAGGAGGG + Intronic
1032730509 7:134637674-134637696 TGTCATTTACAGAAAGAGGTGGG - Intergenic
1032919223 7:136527139-136527161 TTTCATGTCCAGGAAGAATTAGG + Intergenic
1034155250 7:148950924-148950946 TTCCATGTAAAGGAATAGAAAGG - Intergenic
1035694266 8:1583129-1583151 ATTCTTGTACGGGAAGAGAAGGG + Intronic
1036850307 8:12195971-12195993 TTTCATTTAAATCAAGAGGATGG + Intergenic
1036871671 8:12438244-12438266 TTTCATTTAAATCAAGAGGATGG + Intergenic
1037588847 8:20296276-20296298 ATTCATGCACAGGAATGGGAGGG + Intronic
1038621700 8:29149672-29149694 ATTCAGGTACAGGAAGAAAAAGG - Intronic
1039292770 8:36114497-36114519 TTCCATTTACAGGGAAAGGATGG + Intergenic
1039350523 8:36759081-36759103 TTGCATGGGCAGGAAGGGGAAGG - Intergenic
1039674755 8:39649899-39649921 CTTCATTTACAAGAAGAGGCGGG - Intronic
1041955092 8:63549994-63550016 TTTAATGTACAGTATGAGGTAGG - Intergenic
1043459126 8:80441670-80441692 TTTCAGGTACAGGAGTGGGATGG + Intergenic
1043962390 8:86432356-86432378 GTTCATCTATAGGAACAGGAGGG - Intronic
1045942131 8:107751542-107751564 TTCCATGGACAAGAAGACGAGGG - Intergenic
1045958056 8:107932927-107932949 TTTGATGTACTAGAAGGGGATGG + Intronic
1046568564 8:115933047-115933069 TTTCATGTGCAGAAAGTGGTAGG + Intergenic
1046668017 8:117026505-117026527 TATCATGTACAGAGAGAGGGAGG - Intronic
1046852155 8:118986869-118986891 TTTCAGGTATAGGATGTGGAAGG + Intergenic
1047362553 8:124182574-124182596 TTTGATGTACAGGATGCGGTGGG - Intergenic
1047726872 8:127691517-127691539 TTTCATGTTCTGGAAGTGGCAGG - Intergenic
1047805593 8:128356164-128356186 TTTCATGGTCAGAATGAGGAAGG + Intergenic
1048985163 8:139731172-139731194 TCCCGTGTAGAGGAAGAGGAGGG + Exonic
1049434189 8:142578879-142578901 TTTCATGAACAGAACGAGGCCGG + Intergenic
1050237989 9:3603142-3603164 TGTCATATGCAGGAAGAGGAAGG - Intergenic
1050836603 9:10088571-10088593 TTTCATCTTCAGGAAGATAAAGG + Intronic
1053109932 9:35450178-35450200 TTTCATGTGCAGGAAGAAAGTGG + Intergenic
1053169682 9:35869619-35869641 CTTCAAGTACATGAAGATGATGG + Exonic
1053183113 9:35991510-35991532 CTTCCCGTACATGAAGAGGATGG + Intergenic
1053342499 9:37349651-37349673 TTACATGTACATGAACAGGTTGG + Intronic
1055036835 9:71826588-71826610 TGTCATGTCCAGGATGGGGAGGG + Intergenic
1055378508 9:75679263-75679285 TTTCATATTCATGAATAGGAAGG + Intergenic
1056192832 9:84201273-84201295 TTTCATGTTCATGGATAGGAAGG + Intergenic
1057630199 9:96713681-96713703 TTTTATGCACAGGGAGAGAAAGG + Intergenic
1058399538 9:104598631-104598653 CTTCATGTACATGAGGAAGATGG + Exonic
1058400001 9:104604845-104604867 CTTCATGTACATGAAGAGGATGG + Exonic
1058400833 9:104617422-104617444 CTTCATATACATGAAGAGGATGG + Exonic
1058704103 9:107624594-107624616 TTTCATAGCCAGGGAGAGGAGGG + Intergenic
1060136472 9:121160094-121160116 TTTCATTTACAGTCACAGGAGGG + Intronic
1186568934 X:10694185-10694207 TTTCATGGCCACGAAGAAGATGG + Intronic
1188026431 X:25215043-25215065 TTTCATCAACTAGAAGAGGATGG - Intergenic
1188174158 X:26967162-26967184 TTTTATGGACAGGGAGAGGTAGG + Intergenic
1188673639 X:32911977-32911999 CTTAAAGTACAGGGAGAGGAAGG + Intronic
1190260892 X:48796135-48796157 ATTCCTGTACAGGATCAGGATGG - Intergenic
1190817104 X:53938596-53938618 CTTCATGGAAATGAAGAGGAAGG - Exonic
1191810674 X:65184128-65184150 TGTCAGGAAAAGGAAGAGGAAGG - Intergenic
1192127902 X:68519247-68519269 TTGTAGGTAAAGGAAGAGGACGG + Intronic
1192254580 X:69444393-69444415 TGTCATGGAAAGGAAGAGAAAGG - Intergenic
1192709059 X:73561035-73561057 TTTGAAGTACAGGAAGGGAAAGG - Intergenic
1193910402 X:87298978-87299000 ATTGATGTAGAGGAAGAGAAAGG - Intergenic
1194269061 X:91787423-91787445 TTTCAGGTACAGTGAGAGCAGGG + Intronic
1194321717 X:92456704-92456726 TTATATGCGCAGGAAGAGGAGGG - Intronic
1197301453 X:124786798-124786820 TATCATGGATAGGAAGGGGAAGG - Intronic
1199441570 X:147874523-147874545 TTTCATTTACAGAGAAAGGATGG + Intergenic
1199672513 X:150158995-150159017 TTTCATGTGCAGAAAGAGGGAGG - Intergenic
1200019825 X:153193433-153193455 TTTCATATACAGGGAGAGATAGG - Intergenic
1200586277 Y:5008431-5008453 TTTCAGGTACAGTGAGAGCAGGG + Intronic
1200629889 Y:5570182-5570204 TTATATGCACAGGAAGAGGAGGG - Intronic