ID: 965771407

View in Genome Browser
Species Human (GRCh38)
Location 3:172185301-172185323
Sequence GTACAGTGGGAAGAAGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 412}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965771407 Original CRISPR GTACAGTGGGAAGAAGATGA GGG (reversed) Intronic
901817041 1:11800289-11800311 GACCAGTGGGAAGAGGAGGAGGG - Exonic
903377498 1:22876079-22876101 GTGCAGTGGGAAGCCGCTGAGGG + Intronic
903397227 1:23011056-23011078 GTTCAGTGAAATGAAGATGAAGG - Exonic
905295391 1:36951426-36951448 GTGCAGTGGGAAGAAGACAAAGG - Intronic
906289874 1:44612900-44612922 AACCAGTGGGAAGAAGAAGAAGG + Intronic
906300540 1:44678303-44678325 GGCAAGTGGGGAGAAGATGAAGG + Intronic
906315347 1:44783482-44783504 ATGCAGTAGGATGAAGATGAAGG - Intergenic
906747047 1:48229269-48229291 GGAGAGTGGGGAGAAGAAGAAGG - Intronic
910679958 1:89852861-89852883 GTACAGAGGGGAGAAGAGGCTGG + Intronic
910736934 1:90469308-90469330 GGAGAGTGGGAAAACGATGAGGG + Intergenic
911791074 1:102015612-102015634 GTAATGTGGGAAGAAGCTGAAGG - Intergenic
911828341 1:102517066-102517088 GTATAGTGATAAGAAGAAGACGG + Intergenic
912754800 1:112315065-112315087 GCGCAGTGGGGAGAAGAAGAGGG + Intergenic
914220533 1:145677738-145677760 GTACAGAGGGGGGAATATGATGG - Intronic
914473112 1:148000604-148000626 GTACAGAGGGGGGAATATGATGG - Intergenic
914798903 1:150945428-150945450 GGATAGTGGGACGAAGAAGAGGG + Intronic
916120309 1:161523576-161523598 AAACAGTGGGGAGAACATGAGGG + Intronic
916130073 1:161605229-161605251 AAACAGTGGGGAGAACATGAGGG + Intronic
916751270 1:167724653-167724675 GTCTTGGGGGAAGAAGATGATGG + Intronic
918232821 1:182551136-182551158 GTATAGGGGGAAGAAGTTCAAGG + Exonic
918569996 1:185978925-185978947 GTACTTTGGGAAGACGATGTGGG - Intronic
918812885 1:189142788-189142810 GAAGAGTGGGAAGGGGATGAGGG - Intergenic
918927388 1:190806141-190806163 GTACAGTGGGAAAAGTATGTTGG + Intergenic
919752760 1:201048463-201048485 GAACTGTGGGAAGAAGTAGAGGG - Intronic
920309451 1:205040199-205040221 CTACAGTAGGAAGAAGCAGATGG + Intergenic
921814456 1:219548172-219548194 GTACAGTGAGAACAGTATGAGGG + Intergenic
921977041 1:221214287-221214309 GTACAGTGACAAGCAAATGAGGG + Intergenic
922165909 1:223115703-223115725 GTAAAGTGGGAAAAAGGAGATGG + Intronic
923321702 1:232840506-232840528 GTACAGTGGAATGAAGATTATGG - Intergenic
924632474 1:245753692-245753714 GTACAGCAGGAAGATGAGGAGGG + Intronic
924934574 1:248757179-248757201 GCACAGTGGAAAGATGAGGAGGG - Intergenic
1062979539 10:1710541-1710563 GGACAGTGGGAAGGAGGGGAAGG - Intronic
1063298663 10:4831954-4831976 GTGCAGGTGGAAGATGATGAAGG + Intronic
1063515036 10:6687429-6687451 GTACAGTGGGAGGAAGAAGAGGG - Intergenic
1064102794 10:12477724-12477746 GTCAAGGGGGAAGAAGCTGAAGG + Intronic
1064540149 10:16396987-16397009 GCAGAATGGGAAGAAGATGATGG - Intergenic
1067973861 10:51001744-51001766 GTACGGTGGGGAGAAGATAGAGG + Intronic
1068405616 10:56585134-56585156 GGAGAGTGGGAGGGAGATGAGGG - Intergenic
1068996681 10:63213769-63213791 ACACAGTGGGAAGTAAATGAGGG + Exonic
1069202513 10:65639029-65639051 GTCCAGTGGTAAAATGATGAAGG + Intergenic
1069550665 10:69361632-69361654 GGGCAGTGGTAAGAAGGTGAGGG - Intronic
1069614683 10:69799558-69799580 GCAGTGTGGGAAGAAGAAGAGGG + Intergenic
1070104903 10:73422422-73422444 GTGCAGTGGGAAAAAGCTAATGG - Intergenic
1071093634 10:81948608-81948630 GTACAGTGGGAAGATGCTGGAGG + Intronic
1071126014 10:82335591-82335613 GTACAGTGGCATGATGATCATGG - Intronic
1071513218 10:86280344-86280366 GTAGAGGAGGGAGAAGATGAAGG - Intronic
1072230426 10:93409718-93409740 GGAGATGGGGAAGAAGATGAAGG - Exonic
1073187294 10:101623922-101623944 GGACAATGGGAAGAGGAGGAGGG + Intronic
1076597850 10:131636984-131637006 GTACGGTAGGAAGAAGCTGTGGG + Intergenic
1076616973 10:131761526-131761548 GCACTGTGGGGAGAAGAAGATGG + Intergenic
1077281862 11:1749514-1749536 GGAGAGTGGGAAGAGGAAGAGGG - Intronic
1077803331 11:5563973-5563995 GGAGAGTGGGAAGAAGATTCAGG - Intronic
1077804443 11:5576071-5576093 GTACAGAGAAAAGAAGATAAAGG + Intronic
1077877757 11:6321885-6321907 GTTCAGTGAGAAGAGGAAGAGGG - Intergenic
1078423041 11:11228117-11228139 GTACAGTAGAAAGAACATGGAGG - Intergenic
1079410253 11:20180799-20180821 TTGCAGTGGGAAGAAAGTGATGG + Intergenic
1079478307 11:20854785-20854807 GCACAGTAGCAAGCAGATGATGG + Intronic
1079900447 11:26176627-26176649 GAAAAGTGGGAAGAGGAAGATGG - Intergenic
1079908833 11:26284118-26284140 GTGCAGTGGGAAGCAATTGAAGG + Intergenic
1080805992 11:35654412-35654434 TTTCTGTGGGAAGAAGTTGAGGG + Intergenic
1082843085 11:57705140-57705162 ATTCTGTGGGAAGAAGGTGAAGG - Exonic
1083738571 11:64695426-64695448 GTCAAGTGGGAAGAAGGCGAAGG + Intronic
1083852902 11:65378299-65378321 GTGGAGTGGGAAGAAGAGGCAGG - Intronic
1084040928 11:66542343-66542365 GCACTGTGGAAGGAAGATGAGGG + Intronic
1084645552 11:70455350-70455372 GTAAAGTAGGTGGAAGATGAGGG + Intergenic
1085138475 11:74117589-74117611 CAAGAGTGGGAAGAAGGTGAGGG + Intronic
1085840963 11:80011473-80011495 ATACAGTGGGAAAGAGGTGAAGG + Intergenic
1086232801 11:84590909-84590931 GCAAATTGGGAAGAAAATGATGG + Intronic
1087521336 11:99240567-99240589 GTAAAGGCGGAGGAAGATGAAGG - Intronic
1088543654 11:110938481-110938503 GCACTGGGGGAAGGAGATGAAGG + Intergenic
1089718692 11:120390715-120390737 GTACAAAGGGAAGATGATAATGG + Intronic
1089813029 11:121147394-121147416 GAAGGGTGGGAGGAAGATGAAGG + Intronic
1090456900 11:126857856-126857878 GTGCAGTGGGAAGCTCATGAAGG + Intronic
1090749110 11:129730545-129730567 GTACCGTGGGACGAGGATGCAGG + Intergenic
1091555063 12:1566811-1566833 CTGCAGTGGGAAGAAGAAAAAGG + Intronic
1091624093 12:2109404-2109426 GGGCAGAGGGAAGAACATGAAGG + Intronic
1091699729 12:2651665-2651687 GAACAGGCGGAAGAAGGTGATGG - Exonic
1092508909 12:9132623-9132645 GTTCAGTTGGAAGAAAATGAGGG + Intergenic
1092693030 12:11136143-11136165 GTAAAGTGTGAAGAAAATTAAGG - Intronic
1092776279 12:11947428-11947450 GTGTGGTGGGAACAAGATGACGG + Intergenic
1092858317 12:12695843-12695865 ATACAGTGGGAAGGAGAAGATGG - Intronic
1094412070 12:30177080-30177102 GTACAGAGGGTAAAAGATAAAGG - Intergenic
1097342201 12:58451758-58451780 GAAGAGTGGGAGGCAGATGAGGG - Intergenic
1097761276 12:63467649-63467671 GTATACTGGGTAGAAGATAATGG + Intergenic
1098757344 12:74382531-74382553 GAAAAGTGGTAAGAAGAGGAGGG + Intergenic
1099561755 12:84186636-84186658 GTATAGTAGGATAAAGATGATGG + Intergenic
1100555451 12:95688665-95688687 GTAGAGTGAGAAGATGATCAAGG + Intronic
1100762651 12:97826429-97826451 GTCCAGGAGGAAGATGATGATGG + Intergenic
1100873964 12:98943076-98943098 GTACAATCGTAAGAAGATAAAGG - Intronic
1101423672 12:104569882-104569904 TTACAGTTGGAGGAAGAGGACGG + Intronic
1102356292 12:112239051-112239073 GTTGAGTGGGAAAAAGAGGAAGG - Exonic
1102630109 12:114270622-114270644 CGATAGTGGGAAGAGGATGAGGG + Intergenic
1102800011 12:115723913-115723935 ATGTTGTGGGAAGAAGATGATGG + Intergenic
1103275195 12:119705410-119705432 GTACAGTGGGAGAATGAAGATGG + Intronic
1103422160 12:120795586-120795608 GTACAGAGGAGAAAAGATGAGGG - Intronic
1104068738 12:125327105-125327127 GCAGAGTGGGAAAAAGAGGAGGG - Intronic
1104271085 12:127282829-127282851 GCACAGTGGGGAGCAGGTGAGGG - Intergenic
1104561440 12:129848907-129848929 GAACAGTGGGATGAAGTTGAGGG - Intronic
1105410474 13:20167639-20167661 GTAAAGTGAGAAGAACAGGAGGG + Intergenic
1105493406 13:20909099-20909121 GTACAGTTGGAAAAAAGTGAGGG - Intergenic
1106120614 13:26857348-26857370 AAACAGTGGGAAGAGGGTGAGGG - Intergenic
1106843675 13:33713520-33713542 TTAAAGTGGGAAGAAGGAGAAGG - Intergenic
1108251315 13:48570752-48570774 TTCTAGTGGGATGAAGATGACGG + Intergenic
1108813409 13:54259846-54259868 TCACAGTGGACAGAAGATGATGG + Intergenic
1109505551 13:63297748-63297770 GGAGAATTGGAAGAAGATGAGGG + Intergenic
1110374192 13:74773999-74774021 GTATAGTATGAAGAATATGAAGG + Intergenic
1113422433 13:110180982-110181004 TTACTGTGAGAAGCAGATGAAGG - Intronic
1114153209 14:20069068-20069090 GTAGGGTGGGAAGAGAATGAGGG + Intergenic
1115603223 14:34975859-34975881 GTACAGAGGGTAGAAAATTAAGG - Intergenic
1115886867 14:37981788-37981810 GTAGGGTGGGAAGAGGAAGAGGG + Intronic
1116561603 14:46386409-46386431 GAACAGTAGAAAGAAGAAGATGG + Intergenic
1116801167 14:49444526-49444548 GGAGAGTGGGAGGGAGATGAGGG - Intergenic
1117074426 14:52088062-52088084 GTACAGTAGAAAGAATATGGAGG - Intergenic
1118864094 14:69689063-69689085 GGAGAGTGGGAAGAACATGGTGG - Intronic
1119195381 14:72713662-72713684 GTACAGTGAGAAGATGACTAGGG + Intronic
1119320440 14:73727038-73727060 TCAGGGTGGGAAGAAGATGAGGG + Intronic
1120416369 14:84223065-84223087 GTAGGGAGGGAAGAAGAGGATGG - Intergenic
1120852506 14:89184268-89184290 GTAAAGTTGGACAAAGATGAGGG + Intronic
1123122607 14:105924935-105924957 GCACAGGAGGAAGATGATGATGG - Intronic
1123130883 14:105984378-105984400 CTCCAGTGGGAAGGAGATGAAGG - Intergenic
1123581114 15:21715599-21715621 CTCCAGTGGGAAGGAGATGAAGG - Intergenic
1123617763 15:22158222-22158244 CTCCAGTGGGAAGGAGATGAAGG - Intergenic
1123834091 15:24170109-24170131 GTGCAGTGGCAAGAAGAGAAAGG + Intergenic
1123840817 15:24245150-24245172 GTGCAGTGGCAAGAAGAGAAAGG + Intergenic
1123849883 15:24343674-24343696 GTGCAGTGGCAAGAAGAGAAAGG + Intergenic
1123853772 15:24385652-24385674 GTGCAGTGGCAAGAAGAGAAAGG + Intergenic
1123869736 15:24558269-24558291 GTGCAGTGGGAAGAAGAGAAAGG + Intergenic
1124027752 15:25982438-25982460 GTGGAGTGGGAAGATGATAAAGG - Intergenic
1125235898 15:37513053-37513075 GCAGTATGGGAAGAAGATGAAGG + Intergenic
1127611961 15:60645753-60645775 CTGCAGTGGGAAGAAGAGGATGG - Intronic
1127672972 15:61213197-61213219 GTGGAGTTGGAAGAACATGATGG - Intronic
1128034683 15:64514398-64514420 GGACACTGTGAAGAACATGAAGG - Intronic
1128631443 15:69272524-69272546 GTCCAGGTGGAAGAAGAGGAGGG + Intergenic
1129568122 15:76646544-76646566 GTACAGAAGGATGAAGATAAAGG - Intronic
1130037978 15:80378868-80378890 GAGCAGGTGGAAGAAGATGAAGG + Exonic
1130145644 15:81271855-81271877 CTACAGTGTCAAGAAGATGGAGG + Intronic
1130562611 15:84970458-84970480 GAAAAGTGGGAAGTAGGTGAGGG + Intergenic
1132268597 15:100502830-100502852 TTGCTGTGGGAACAAGATGATGG + Intronic
1132356893 15:101178404-101178426 GCACAAAGGGAAGAAAATGACGG - Exonic
1132982485 16:2745600-2745622 GAACAGTGGGAGGCAGATGTAGG - Intergenic
1133820098 16:9228297-9228319 GCACTGTGGGAAGAATTTGAGGG + Intergenic
1133838267 16:9385755-9385777 AGACAGTGGGAGGAACATGATGG - Intergenic
1134419969 16:14077799-14077821 TAACAGTGGGAAAAAAATGAGGG - Intronic
1135683804 16:24481390-24481412 CTACAGTGGAAACAAGATGGTGG - Intergenic
1139387360 16:66581344-66581366 GCACAGTGGGAAGATGTTCAGGG - Intronic
1140170377 16:72598586-72598608 GGACAGTGGGAGGAAGGAGAGGG + Intergenic
1140185742 16:72769393-72769415 GTCCAGTGGCAAGAAAATGAGGG - Intergenic
1141004368 16:80338202-80338224 GTACATTGTGATGATGATGATGG - Intergenic
1141053691 16:80796433-80796455 CTAAGGTGGAAAGAAGATGATGG - Intronic
1142190953 16:88717107-88717129 GAGCAGTGGGAACCAGATGATGG + Exonic
1142409822 16:89910365-89910387 GGACAGCGGGAACAGGATGAGGG - Intronic
1146755049 17:35422932-35422954 GAACAGTAGGAAAAAAATGAAGG - Exonic
1147161616 17:38572326-38572348 CTGCATTGGGAAGGAGATGAGGG - Intronic
1147726118 17:42567109-42567131 GTCCGGTGGGTACAAGATGACGG + Exonic
1148554490 17:48570174-48570196 GATCAGTGGGAAAAAGATGGGGG + Intronic
1148669058 17:49396779-49396801 GTTCACTGGCATGAAGATGAAGG + Intronic
1148740156 17:49888128-49888150 GAACAGTGGGAAGGAGCAGAGGG - Intergenic
1149494104 17:57106179-57106201 TTAGAGGGGGAAGAAGATAAGGG + Exonic
1150436717 17:65159728-65159750 GTGAAGTGGGAAGGAGAGGAAGG + Intronic
1151522673 17:74641540-74641562 GTGCACTGGGGAGAGGATGAGGG - Intergenic
1152700782 17:81817917-81817939 GGACAGTGGGAGGAAGAAGCTGG - Intergenic
1154290954 18:13106329-13106351 GAACATTGTGCAGAAGATGATGG - Intronic
1156240001 18:35243966-35243988 GTGCAGTGGGATGCAGTTGAAGG + Intronic
1156347358 18:36269748-36269770 ATCCAGGGGGAAGATGATGAAGG - Exonic
1156862088 18:41849187-41849209 GAAGAGTGGGAAGAAGAAGAGGG + Intergenic
1158861548 18:61597622-61597644 GTTCAGAAGGAAGAAGATGGAGG - Intergenic
1160443401 18:78910425-78910447 GTACAATGGGAAGCAGAGGCGGG - Intergenic
1161517041 19:4702343-4702365 GTGCAGTGGGAAGCAGAGCAGGG + Intronic
1161827101 19:6575374-6575396 CCACAGAGGGAAGGAGATGAGGG - Intergenic
1162122574 19:8480722-8480744 GCAGAGTGGCAAGAAGCTGAAGG - Intronic
1162186764 19:8911314-8911336 GTTGAGTGGGATGATGATGATGG - Intronic
1163693445 19:18750265-18750287 GTCCAGTGGGAAGCAGTGGAAGG - Intronic
1163803558 19:19382865-19382887 GTACAGTGGCAAGATCATGATGG - Intergenic
1164441079 19:28281517-28281539 GAACAGTGGGAAGAAGACAGTGG - Intergenic
1164441379 19:28282873-28282895 GGACAGTGGGAAGAAGAGGATGG - Intergenic
1166295798 19:41888707-41888729 GTACAATGGGGAGAAGAGGAGGG - Intronic
1166432151 19:42737008-42737030 ATGAAGTGGGAGGAAGATGAGGG + Intronic
1166435268 19:42762201-42762223 ATGAAGTGGGAGGAAGATGAGGG + Intronic
1166445132 19:42852227-42852249 ATGAAGTGGGAGGAAGATGAGGG + Intronic
1166448134 19:42876190-42876212 ATGAAGTGGGAGGAAGATGAGGG + Intronic
1166452533 19:42914404-42914426 ATGAAGTGGGAGGAAGATGAGGG + Intronic
1166455021 19:42933686-42933708 ATGAAGTGGGAGGAAGATGAGGG + Intronic
1166464814 19:43022970-43022992 ATGAAGTGGGAGGAAGATGAGGG + Intronic
1166470937 19:43079152-43079174 ATGAAGTGGGAGGAAGATGAGGG + Intronic
1166482093 19:43183072-43183094 ATGAAGTGGGAGGAAGATGAGGG + Intronic
1166484574 19:43202187-43202209 ATGAAGTGGGAGGAAGATGAGGG + Intronic
1166491694 19:43266067-43266089 ATGAAGTGGGAGGAAGATGAGGG + Intronic
1167043276 19:47035425-47035447 ACACAGTGGGGAGAAGATGGGGG + Intronic
925510024 2:4615166-4615188 ATAATTTGGGAAGAAGATGATGG - Intergenic
927212731 2:20648616-20648638 GTACAGTGAGAGGAAGAAGGAGG - Intronic
927425467 2:22976689-22976711 GTACAATGGGATGAACATCAAGG - Intergenic
928203694 2:29268863-29268885 GTAAAATGGGAAGAAAATGATGG + Intronic
928217348 2:29372718-29372740 GGACAGTGGAAAGAAGATATAGG - Intronic
928633097 2:33214427-33214449 GCAGAGTGGGGAGAAGAAGAGGG - Intronic
928850959 2:35745518-35745540 GGACAGTGGGAGGGAGGTGAGGG - Intergenic
928987346 2:37194701-37194723 GAACAGTGGCAAGAAGAAAATGG - Intronic
929127149 2:38532557-38532579 CTACAGAGGGGAGAAGATGATGG - Intergenic
929693979 2:44098609-44098631 GTATATTGGCAAGTAGATGAGGG + Intergenic
929898590 2:45982742-45982764 GAACAGAGGGAGGAGGATGAAGG - Intronic
931926833 2:67082545-67082567 GGACGGTGGGAAGAGGAAGAGGG + Intergenic
933111232 2:78402929-78402951 AAAGAGTGGGAAGTAGATGAAGG + Intergenic
933500888 2:83109712-83109734 GTAATGAGGGAAAAAGATGAAGG - Intergenic
934742820 2:96738152-96738174 TTAAAGGGGGAAAAAGATGATGG - Intronic
936519125 2:113200713-113200735 GTACAGTGTTAAGTAGATGAGGG + Intronic
939394183 2:141607505-141607527 TTACAGTGAAAATAAGATGAGGG - Intronic
940568046 2:155394002-155394024 GGACAGCAGGAAGAAGAAGAAGG - Intergenic
940920119 2:159296652-159296674 CTACAATGGGAATAAGATTAGGG - Intergenic
941241744 2:163047181-163047203 GTAAAGTGCCAAGAAAATGATGG + Intergenic
942421953 2:175816969-175816991 GTTTACTGGGAAGCAGATGATGG + Intergenic
942594419 2:177579466-177579488 GTACAGTGGGAACAGGAAAATGG - Intergenic
942683595 2:178507562-178507584 GTACAAATGGCAGAAGATGAAGG - Exonic
943627981 2:190219887-190219909 TTACAATGTAAAGAAGATGAAGG + Intronic
946227626 2:218272630-218272652 GGACCGTGTGAAGCAGATGAAGG + Intronic
946417702 2:219548855-219548877 GTCCAGTGGAAAGATGATGATGG + Intronic
946574452 2:221058844-221058866 GTAGAGTGGGAGGAGGATGAGGG - Intergenic
947152360 2:227128792-227128814 GGGCAGTGGGGAGAAGATCAGGG - Intronic
947782811 2:232784880-232784902 TTACAGTGGGGAGGGGATGAGGG - Intronic
1169450859 20:5709730-5709752 GAACAGTGGAGAAAAGATGAAGG + Intergenic
1169572272 20:6919299-6919321 GGAAAGTGGGAAGAAAATGTGGG + Intergenic
1170141586 20:13130339-13130361 GTGGAGTGGGCTGAAGATGAAGG - Intronic
1170888876 20:20363372-20363394 GGACAGTGGGAAGAAGGGGCTGG + Intergenic
1171360260 20:24582253-24582275 GTGCAGTGGGAAGTATGTGAAGG - Intronic
1171362933 20:24602682-24602704 TTAAAGAGGTAAGAAGATGAGGG - Intronic
1173026935 20:39316347-39316369 GGACAGTGGGCAGAAGAACAGGG + Intergenic
1175218081 20:57401892-57401914 GTACAGTGGGAGGCAGCTGGAGG + Intronic
1175388671 20:58612947-58612969 GGACAGAGGGAAGAAGAGGTGGG + Intergenic
1175563847 20:59956543-59956565 GAAGAGTGGGAAGAGGGTGAGGG - Intergenic
1175973407 20:62698580-62698602 GTCCAGTGGGCAGAAGACCAGGG - Intergenic
1176180329 20:63746802-63746824 GTTCAGGGGGAAGCAGAGGAGGG + Exonic
1176367248 21:6040533-6040555 GTACAGTGGCCAGAGGAAGAAGG - Intergenic
1177497507 21:21909238-21909260 GTACAGGTGATAGAAGATGAAGG + Intergenic
1178882933 21:36462977-36462999 GGAGAGAGGGAAGAAGAGGAGGG + Intronic
1179756271 21:43498013-43498035 GTACAGTGGCCAGAGGAAGAAGG + Intergenic
1180676177 22:17587939-17587961 AAACAGTGGGAAGTAGATGATGG - Exonic
1181110569 22:20600504-20600526 GTCCAGTGGCAAAAAGTTGAGGG + Intergenic
1182065128 22:27425599-27425621 GTGCAGGGGGAGGAAGACGATGG - Intergenic
1182335408 22:29580594-29580616 GTTCTGTGGGAAAGAGATGATGG - Intronic
1182813874 22:33140565-33140587 ATACAGCAGGAAGAAGTTGAAGG + Intergenic
1183195217 22:36349038-36349060 GGAGAATGGGAAGAAGGTGAAGG - Exonic
1184064954 22:42113251-42113273 ATACAATAGGAAAAAGATGAGGG - Intergenic
1184142608 22:42586923-42586945 GTACAGTGGGAAGCCATTGAAGG - Intronic
1184935184 22:47716005-47716027 CTGCAGTGGGAAGAGGATGCAGG + Intergenic
1185355557 22:50367467-50367489 GAGCAGTGGGCAGAGGATGAGGG + Intronic
1203309166 22_KI270736v1_random:130530-130552 GTACAGTGGAATGGAGAGGAGGG + Intergenic
949316892 3:2766596-2766618 GAAAGGTGGGAAGAGGATGAGGG + Intronic
949497283 3:4644411-4644433 GTGCAGTGGGTAGTAGATGTGGG + Intronic
949687939 3:6599532-6599554 GCACAGTGCTAAGAACATGAGGG + Intergenic
949868173 3:8563867-8563889 GTACGTTGGGAGGAAGATCACGG - Intronic
949897978 3:8784485-8784507 GGACAGTGGGAAGTATGTGATGG + Intronic
950041784 3:9924322-9924344 GAGGAGTGGGAAGATGATGATGG + Intronic
950046759 3:9952702-9952724 GTACATTGAGAAGAATCTGAAGG - Intergenic
950095234 3:10325156-10325178 TTACAATGGGGGGAAGATGATGG + Exonic
950192551 3:10987663-10987685 GGAGAGTGGTAAGAAGCTGAAGG + Intergenic
950436745 3:12984768-12984790 GTGCACTGGGAGGAAGCTGAAGG - Intronic
950620638 3:14202654-14202676 GGACAGTTGGAATAAGCTGAAGG - Intergenic
950682740 3:14596130-14596152 TTACAGGGTGAAGAAGAGGATGG + Intergenic
951510241 3:23492351-23492373 GGGTAGTGAGAAGAAGATGAGGG - Intronic
952244510 3:31571466-31571488 GTGCTGTGAGTAGAAGATGATGG - Intronic
953397628 3:42585619-42585641 GTATATTGGGAAGAATGTGATGG - Intronic
953497509 3:43400852-43400874 GCACAGTGAGATGAGGATGAGGG + Intronic
953999909 3:47548139-47548161 GCACTGTGGGAAGCAGAGGAGGG + Intergenic
954369308 3:50161954-50161976 GTACTCTGGGAGGAAGATGGTGG - Intronic
954546001 3:51435322-51435344 GCACAGTGGGATGAAGCTGGAGG - Intronic
954710646 3:52503647-52503669 GTAAAGTGGGGAGAGGATAAGGG + Intronic
954771311 3:52971853-52971875 CTACAGTGGGAAGGACCTGAAGG + Intronic
954907138 3:54072392-54072414 GTACAACAGGAAAAAGATGAAGG + Intergenic
956455732 3:69419045-69419067 GTGCACTGGGAAGAAAATGTAGG + Intronic
956539782 3:70323690-70323712 TTACATTGGGAAGAAGATTGGGG + Intergenic
958924484 3:100143032-100143054 GTACAGAGGCAAGAGGAAGAAGG + Intronic
959160835 3:102722632-102722654 ATCCACTGGGAAGATGATGAGGG - Intergenic
959343751 3:105165475-105165497 GTGAAGTGGACAGAAGATGAAGG - Intergenic
959757576 3:109917220-109917242 ATATAGAGAGAAGAAGATGATGG - Intergenic
960504569 3:118477600-118477622 GGACAGTGGCAGGAAGCTGATGG + Intergenic
960633132 3:119753800-119753822 GAAGAGTGGGAAGGGGATGAGGG - Intronic
962388342 3:134951365-134951387 GTACAGTGGGAAGAAGTCAGTGG + Exonic
962955253 3:140259975-140259997 GGAGGGTGGGAAGAGGATGAGGG + Intronic
962959662 3:140298996-140299018 GTACAGGGGGAAGAGGGTCAGGG - Intronic
963224511 3:142848295-142848317 GTCCAGTGGCAACAAGATGATGG - Exonic
963774749 3:149427154-149427176 TTACAGTAGGAAGAAAATGATGG + Intergenic
964536152 3:157724586-157724608 GAAGAGTGGGAAGAGGCTGAGGG + Intergenic
965354582 3:167657822-167657844 GTCAAGAGGCAAGAAGATGATGG - Intergenic
965771407 3:172185301-172185323 GTACAGTGGGAAGAAGATGAGGG - Intronic
966826838 3:183972019-183972041 ATACAGTGGAAGGAAGCTGAAGG + Intronic
967628726 3:191717734-191717756 ATACTGTGGGAACAAGAAGAAGG - Intergenic
967693947 3:192509331-192509353 GTGCATTGGGAAGAATATCAGGG - Intronic
968441335 4:626009-626031 GTCCAGTGGGAAGACGATCTCGG - Exonic
968658878 4:1790763-1790785 GCAGAGTGGGAAGCAGATGCTGG + Intergenic
969354937 4:6619764-6619786 GTGCTGTGAGAAGCAGATGAGGG + Intronic
969377593 4:6773166-6773188 CTGCACTGGGGAGAAGATGAAGG - Intergenic
970330461 4:14977463-14977485 ATACAGTAGGAAGGAGAGGAGGG - Intergenic
970885728 4:20985738-20985760 GTACAGTGGGAAAACAAGGAGGG + Intronic
971007343 4:22390119-22390141 GTACAGCAGGAAGAAGGGGAAGG - Intronic
971983651 4:33790703-33790725 GTACAGTGGGGAGATAATGGGGG - Intergenic
972629809 4:40833314-40833336 GTGCAGTGGGAGGAACATGCTGG - Intronic
972789212 4:42354587-42354609 GGACAATGGGGAGAAGGTGATGG + Intergenic
972873644 4:43330743-43330765 ATACAGTGGGAACAATGTGAAGG + Intergenic
973184289 4:47306359-47306381 GAACAGTGAGAAGAAGGTGCGGG + Intronic
974165691 4:58198697-58198719 GTAGAGTGGGAAGGGGATGGGGG - Intergenic
976152546 4:82106772-82106794 GTAGAGTGGGAGGAAGGTAAGGG - Intergenic
976227119 4:82803924-82803946 ATGCAGTGGGCAGCAGATGAGGG + Intergenic
976296313 4:83475953-83475975 GTACTTTGGGAAGCAGAGGAAGG + Intronic
977257807 4:94758883-94758905 TGACAGAGGGAAGAGGATGAAGG - Intronic
977387901 4:96367871-96367893 GGAAAGTGGGAGGAAGTTGAGGG - Intergenic
978752476 4:112266695-112266717 CTAGAGTGGGAAGATGAAGAAGG + Exonic
979365390 4:119816158-119816180 GTACAGTAAGAAGAAAAAGATGG - Intergenic
979712995 4:123802854-123802876 GGAAAGGGGGAAGAAGAGGAAGG - Intergenic
979763421 4:124435860-124435882 GTACACTGGGAAGCTGGTGAGGG - Intergenic
979890514 4:126086669-126086691 GTACATGGAGAAGAGGATGATGG - Intergenic
980138000 4:128879261-128879283 GGACACTGGTAAGATGATGAGGG + Intronic
982300424 4:153873048-153873070 GTAGAGAGGGAAAGAGATGAGGG - Intergenic
982577512 4:157133732-157133754 GCAAAATGGGAAGAAAATGAAGG + Intronic
983975008 4:173923026-173923048 GTACAGTATAAAGAAGATAATGG - Intergenic
984890700 4:184490068-184490090 GTACAGTGGAAACTGGATGAAGG - Intergenic
985603146 5:845308-845330 AGACAGTAGGATGAAGATGAGGG - Intronic
985833262 5:2251595-2251617 GTGCAGTGGGGAGAGGCTGAGGG + Intergenic
985869479 5:2542780-2542802 CTACAGTGGGAAGATGCTGCAGG + Intergenic
987359839 5:17096900-17096922 GTACAGTGCACAGAAGATGGGGG + Intronic
987621816 5:20345021-20345043 ATACAATGGGACTAAGATGATGG - Intronic
989090557 5:37725864-37725886 GGACAGTGGGAAGCTTATGAAGG - Intronic
990273385 5:54170235-54170257 TTACAGGGGGAAGAAGAGGAAGG - Intronic
991001409 5:61787298-61787320 GTACAGTGGGAAGAATATGGAGG + Intergenic
992347277 5:75892581-75892603 CTACAGAGGGAAGATGAGGAAGG - Intergenic
995188750 5:109298529-109298551 GGACAGTGGGATTTAGATGAGGG - Intergenic
996281050 5:121729288-121729310 TTACAGTAGGAAGAGGAGGAGGG - Intergenic
996642403 5:125771997-125772019 GTTGAGTGGGTAGAAGGTGAGGG + Intergenic
997446076 5:133941358-133941380 GTGCAGTGGGAAAAGGAGGAGGG + Intergenic
997507919 5:134432897-134432919 GTAAGGTGGGAAGCAGAGGAAGG - Intergenic
999423618 5:151466866-151466888 GGGCATTGGGAAGAAGGTGAGGG - Intronic
1001842962 5:174895035-174895057 GGAGGGTGGGAAGAGGATGAGGG + Intergenic
1002111656 5:176918788-176918810 GTACAGTAGAAAGAAGTTGAGGG - Intronic
1002544926 5:179934598-179934620 GTACAGTGGCAAGATCATCATGG + Intronic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1002921923 6:1579098-1579120 AAACAGTGGGAAGATGATGGGGG + Intergenic
1003504061 6:6725429-6725451 GTGCGGTGGGAAGAAGAGAATGG - Intergenic
1004067235 6:12260553-12260575 GTAGAATGGGAAAAAGAGGAAGG - Intergenic
1004275249 6:14230309-14230331 GGAAAGTGGGAGGAGGATGAAGG - Intergenic
1004923395 6:20397779-20397801 GTACAGTGGCAATGAGATCAGGG - Intergenic
1005819914 6:29589248-29589270 GTGAAGTGGGAAAAACATGAGGG - Intronic
1007484756 6:42173415-42173437 GAGCAGAAGGAAGAAGATGATGG - Exonic
1007842577 6:44728746-44728768 GTAAAATGGGAATAAGAAGATGG - Intergenic
1008496979 6:52143891-52143913 GTACAGTAGGAAGTACAGGAGGG + Intergenic
1008657128 6:53627468-53627490 AAACAGTGGGTAGAGGATGAAGG - Intergenic
1009487110 6:64238529-64238551 GGAGAGTGGGAGGGAGATGAGGG - Intronic
1009636940 6:66278854-66278876 GTATAGGAGGAGGAAGATGATGG - Intergenic
1010351445 6:74879786-74879808 GAACAGGGAGCAGAAGATGAAGG - Intergenic
1010354602 6:74917176-74917198 GTATTGTGGGAAGAAGAAGATGG - Intergenic
1010777301 6:79902046-79902068 CAACAATGGGAAGAATATGAAGG + Intergenic
1012304194 6:97629848-97629870 GAACAGTGGGAGTGAGATGAAGG - Intergenic
1012409310 6:98938017-98938039 GTGCAGGGGGAGGAGGATGAAGG - Intronic
1012943927 6:105446520-105446542 GCAAAGAGTGAAGAAGATGAAGG - Intergenic
1013819653 6:114139133-114139155 GGAGAGTGGGGAGAAGATCAAGG - Intronic
1015820542 6:137256108-137256130 ATGGAGTGTGAAGAAGATGAAGG + Intergenic
1016060347 6:139623332-139623354 GTACAGGGAGAAGGAGAAGAGGG + Intergenic
1016927359 6:149364255-149364277 GAACAATGGGAAGCCGATGAAGG - Intronic
1017486362 6:154905478-154905500 GTACAGAGGCATGGAGATGACGG - Intronic
1017674917 6:156803472-156803494 GTACAGAGGGAGGAAGATGGTGG - Intronic
1018334584 6:162772821-162772843 TTACAGAGGAAAGAATATGAGGG + Intronic
1018566999 6:165164682-165164704 GTACAGTGGGAGGAACCTGGTGG - Intergenic
1019407550 7:891635-891657 GTTCTGTGGGAAGAAACTGACGG - Intronic
1019572679 7:1720260-1720282 CTCCAGTGGGAAGACGAAGATGG + Intronic
1019625499 7:2013847-2013869 GTGCAGTGGGAAGAAGGAGCTGG - Intronic
1019632005 7:2054364-2054386 CTCCAGTGTGAAGATGATGAAGG - Intronic
1020033731 7:4951237-4951259 CTCCAGTGGGAAGAAAATAAAGG - Intronic
1020329622 7:7004288-7004310 ATACAGTTGGAAGACAATGAAGG - Intergenic
1020808832 7:12826317-12826339 GAACAGGAGGAAGAGGATGAGGG - Intergenic
1020890502 7:13872107-13872129 GTACAGCGGGAAAAAGCTAATGG + Intergenic
1021339484 7:19446472-19446494 GGAGGGTGGGAAGAGGATGAGGG - Intergenic
1021898378 7:25258798-25258820 GTACAGAGGCAAGAAAAAGATGG + Intergenic
1023828575 7:44025985-44026007 GTACAGTGAGATCAGGATGAGGG + Intergenic
1026220634 7:68393300-68393322 GTGCATTGAGAGGAAGATGAGGG - Intergenic
1027410248 7:77908937-77908959 GTACAGGGGGTAAAAGAAGAAGG + Exonic
1028488364 7:91384594-91384616 GTACCGTGGGCCCAAGATGAGGG + Intergenic
1028798098 7:94928219-94928241 GAACAGTTGGAGGAACATGAAGG + Intronic
1029738870 7:102480265-102480287 GTACAGTGAGATCAGGATGAGGG + Intergenic
1029756871 7:102579428-102579450 GTACAGTGAGATCAGGATGAGGG + Intronic
1029774810 7:102678488-102678510 GTACAGTGAGATCAGGATGAGGG + Intergenic
1031330684 7:120459858-120459880 TTACTTTGGGAAGAAGAAGAAGG - Intronic
1032619028 7:133508745-133508767 GGAAAGTAGGAAGAGGATGAAGG + Intronic
1032970244 7:137153621-137153643 CTACAGTTGGAAGAAGAAGTGGG - Intergenic
1033641661 7:143267865-143267887 GAAAAGAAGGAAGAAGATGAGGG - Intronic
1033665597 7:143437738-143437760 GTACAATGTACAGAAGATGAGGG - Intergenic
1034776465 7:153831812-153831834 CCAGAGAGGGAAGAAGATGAGGG + Intergenic
1034960857 7:155363487-155363509 CTAATGTGGGAAGAAGATGGGGG - Intronic
1037209355 8:16366896-16366918 GGAGAGTGGGAAGAGGGTGAAGG + Intronic
1037490824 8:19395603-19395625 ATGCAGTGGGAAGAAGACCAGGG + Exonic
1037751009 8:21682463-21682485 GGACAGTGGGAAACAGAAGATGG + Intergenic
1037884865 8:22590559-22590581 GAACAGTGGGGAGAAGGGGAGGG + Intronic
1037974051 8:23196953-23196975 GTAGAGTGGGAAGAAGAGATGGG + Intronic
1038148172 8:24917458-24917480 GAAGAGGAGGAAGAAGATGAGGG + Exonic
1038972854 8:32656790-32656812 GTACAATGGAAATAAGCTGATGG + Intronic
1039362016 8:36886785-36886807 GGACATTGGGAGGAGGATGAGGG - Intronic
1039376264 8:37037311-37037333 GGCCATAGGGAAGAAGATGAAGG - Intergenic
1039389770 8:37169346-37169368 GGAAAGTGGAAAGAGGATGAGGG + Intergenic
1040044321 8:42946417-42946439 GTATAGTGAGAAAAGGATGAAGG + Intronic
1043461779 8:80467801-80467823 GAACAATGGGAAGCAGCTGAAGG - Intergenic
1043855800 8:85263307-85263329 ATGCAGTGGGAAGAAGACAATGG + Intronic
1043919610 8:85965929-85965951 GAACAGGGGCAAGAAGCTGAGGG + Intergenic
1045246902 8:100450244-100450266 GCAGAGTGGGAGGAACATGAGGG + Intergenic
1045663056 8:104457994-104458016 GTCCAGTGGGAAGACGAAGGTGG - Intronic
1046803543 8:118455093-118455115 GTCCAGTGGGAGGATGAGGAAGG - Intronic
1047045478 8:121048012-121048034 GTTCAGTTGGAAGGATATGAGGG - Intergenic
1047388376 8:124430428-124430450 GTACAGTGGGAAGACAGTGGAGG + Intergenic
1047884523 8:129234293-129234315 AGAGAGTGGGAAGGAGATGAAGG + Intergenic
1047982635 8:130198854-130198876 GTTCAGTGGGAAGCCAATGATGG - Intronic
1051277390 9:15409727-15409749 AAAGAGTGGGAAGAAGGTGAGGG - Intergenic
1052208653 9:25873876-25873898 GAATATTGGGAGGAAGATGAGGG - Intergenic
1052441345 9:28499727-28499749 TTTCAGTGGGAATAAGATGAAGG - Intronic
1056906344 9:90652211-90652233 GGGCAGTAGGAAGAAAATGAGGG + Intergenic
1058583892 9:106486333-106486355 GTGAAGTGGGTAGAAGAAGAAGG + Intergenic
1059077783 9:111212851-111212873 GGAGGGTGGGAGGAAGATGAGGG - Intergenic
1059159313 9:112019061-112019083 TTATATTGGGAAGAAGATTATGG - Intergenic
1059265439 9:113024422-113024444 GGAAAGTGGGAAGGAGAAGATGG + Intergenic
1060745410 9:126127738-126127760 GATCACTGGGAAGAAGATCAAGG - Intergenic
1061082748 9:128382075-128382097 GAACAGTGGCTGGAAGATGAAGG - Intronic
1061226409 9:129283420-129283442 GAACAGGGGGAGGAAAATGAAGG - Intergenic
1061501427 9:131005004-131005026 GTACAGGTGGAAGGAGACGATGG - Intergenic
1061604803 9:131700725-131700747 TTACAGTGGTGAGAAGAAGAAGG + Intronic
1062182263 9:135196762-135196784 GGGAAGTGGGAAGAAGAAGAGGG - Intergenic
1187424539 X:19165079-19165101 CTTAAGTAGGAAGAAGATGAAGG - Intergenic
1188840783 X:35014501-35014523 ATACAGTCGTAAGAAAATGATGG - Intergenic
1189615515 X:42779109-42779131 GTAGAGTGGGAAGAATTTAAGGG - Intergenic
1190183110 X:48210693-48210715 AAACAGTGGGCAAAAGATGATGG - Intronic
1190192001 X:48284881-48284903 AAACAGTGGGCAAAAGATGATGG + Intergenic
1190196326 X:48322109-48322131 AAACAGTGGGCAAAAGATGATGG - Intergenic
1190362390 X:49661569-49661591 GTTCATTGGGAAGTAGAGGAGGG + Intergenic
1190663041 X:52672477-52672499 AAACAGTGGGCAAAAGATGATGG - Intronic
1190676382 X:52786005-52786027 AAACAGTGGGCAAAAGATGATGG + Intronic
1191817325 X:65260421-65260443 GTAGGGTGGGAAGAAGGTTAAGG + Intergenic
1192114725 X:68399213-68399235 GTATAGGTGGAAGAAGTTGATGG - Intronic
1193152122 X:78136518-78136540 ATACAGTAGAAAGAAGATTAAGG - Intronic
1194940954 X:100009510-100009532 TTATAGAGGGAAGAAAATGAGGG - Intergenic
1195129080 X:101837274-101837296 ACACAGAGGGAAGAAGAGGAAGG + Intronic
1195165211 X:102213245-102213267 GTACACTTGGGAGAAGAAGAAGG - Intergenic
1195193647 X:102473846-102473868 GTACACTTGGGAGAAGAAGAAGG + Intergenic
1195294367 X:103461059-103461081 GGACAGTGAGATGAAGCTGAGGG + Intergenic
1195476286 X:105289459-105289481 GTCCAGAGGGAAGATGATTATGG + Intronic
1195486555 X:105414451-105414473 GTATAGTGGGAAGACATTGAAGG - Intronic
1195596645 X:106698881-106698903 GTTCAGTGAGTAGAAGAGGAGGG - Intronic
1196340547 X:114590568-114590590 GTAAAGGTGAAAGAAGATGAAGG + Intronic
1196787531 X:119434034-119434056 GTAGTGTGGGCAAAAGATGATGG + Intronic
1197712421 X:129681063-129681085 GTAGAGTGGGAAGAAGTAGAAGG - Intergenic
1198251721 X:134885475-134885497 GTCCAGTTCAAAGAAGATGATGG - Intergenic
1199087898 X:143650237-143650259 GTATAGAGGAAAAAAGATGAAGG - Intergenic
1199535289 X:148895820-148895842 ATACAGAGGGGAGAAGAAGAGGG - Intronic
1200133256 X:153862731-153862753 GTACAGTGGCAAGAAGGAGAAGG - Exonic
1201104884 Y:10756152-10756174 GTGCAGTGGAATGGAGATGAGGG - Intergenic
1202349343 Y:23971105-23971127 ATAGAGTGGTGAGAAGATGAAGG + Intergenic
1202521432 Y:25698999-25699021 ATAGAGTGGTGAGAAGATGAAGG - Intergenic