ID: 965774001

View in Genome Browser
Species Human (GRCh38)
Location 3:172209683-172209705
Sequence CAGGGAGGGCCTGAAGCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1066
Summary {0: 1, 1: 23, 2: 171, 3: 319, 4: 552}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965774001_965774009 1 Left 965774001 3:172209683-172209705 CCATAGGCTTCAGGCCCTCCCTG 0: 1
1: 23
2: 171
3: 319
4: 552
Right 965774009 3:172209707-172209729 CTTAAAGGTGGAGTTTCACCAGG 0: 1
1: 17
2: 110
3: 368
4: 752
965774001_965774012 23 Left 965774001 3:172209683-172209705 CCATAGGCTTCAGGCCCTCCCTG 0: 1
1: 23
2: 171
3: 319
4: 552
Right 965774012 3:172209729-172209751 GGACCTGCCCCTTCCTGCCTAGG 0: 5
1: 13
2: 97
3: 253
4: 739
965774001_965774010 2 Left 965774001 3:172209683-172209705 CCATAGGCTTCAGGCCCTCCCTG 0: 1
1: 23
2: 171
3: 319
4: 552
Right 965774010 3:172209708-172209730 TTAAAGGTGGAGTTTCACCAGGG 0: 2
1: 12
2: 93
3: 324
4: 1082

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965774001 Original CRISPR CAGGGAGGGCCTGAAGCCTA TGG (reversed) Intronic
900381722 1:2387481-2387503 CTGGGAGAGCCTCAAGGCTACGG - Exonic
901041695 1:6368146-6368168 TGGGGAGGGCCTGAAGCCTGGGG - Intronic
901965679 1:12863915-12863937 CAAGGAGGGTCTGAAGCCCGTGG + Intronic
901974066 1:12930408-12930430 CAAGGCGGGCCTGAAGCCCGTGG + Intronic
901981077 1:13034293-13034315 CAAGGAGGGCCTGAAGCCCATGG + Intronic
902001010 1:13194637-13194659 CAAGGAGGGCCTGAAGCCCGTGG - Intergenic
902011112 1:13271360-13271382 CAAGGGGGGCCTGAAGCCCGTGG - Intergenic
902020240 1:13340341-13340363 CAAGGAGGGCCTGAAGCCCGTGG - Intergenic
902187623 1:14737201-14737223 CACGGAGACCCTGAAGCCTCAGG + Intronic
902644758 1:17790652-17790674 CAGGGAGGACCTGAAGGCTGGGG - Intronic
902696168 1:18142517-18142539 CAGGGAGGGCCCGAGGGCCAGGG - Intronic
903082351 1:20820551-20820573 CAGGGAGGACCTGAAGGCTGGGG + Intronic
903101736 1:21035801-21035823 CAGGGAGGTTCTGAAGGCTAGGG + Intronic
903337520 1:22635074-22635096 CAGGGAGGGCCTCAAGGCTGGGG - Intergenic
904288207 1:29467297-29467319 AAAGGAGTGCCTGAAGCCCAAGG - Intergenic
904403981 1:30274472-30274494 TGGGGAAGGCCTGAAGCCTGGGG - Intergenic
904443778 1:30551099-30551121 CAGGAAGGGCCTGAAGCCTGGGG + Intergenic
904551771 1:31324887-31324909 CAGGGATGGCCTAAAGCATAGGG + Intronic
904577438 1:31514153-31514175 CAGGGAAGGCCTGAAGGCTGCGG - Intergenic
904732723 1:32607007-32607029 CAGGGAATGCCTGAAGCCTGGGG - Intronic
904915923 1:33970651-33970673 CAGGTAGGCCCTGAAGGCTGGGG - Intronic
905001279 1:34671703-34671725 CAGGGATGGCCTGAAGGCTGGGG + Intergenic
905015014 1:34771863-34771885 CAGGGAGGGCATGGAGACTGAGG - Intronic
905215190 1:36401687-36401709 CAGGGGTGGCCTGAAGCCTGGGG - Intergenic
905839452 1:41162379-41162401 CAGGGAGAGCCTGAAGGCTGGGG + Intronic
906082429 1:43102085-43102107 CAGTAAGGGCCTGAAGGCTGAGG - Intergenic
906132437 1:43468733-43468755 CAGGGAGGGCCTGAAAGCTAGGG - Intergenic
906271671 1:44484204-44484226 CAGGGGGATCCTGAACCCTAGGG - Intronic
906448276 1:45922278-45922300 CAGGGAAAGCCTGAAGCCTGGGG - Intronic
907020190 1:51059568-51059590 CATGGATGGCATGAAGCCTGGGG + Intergenic
907152948 1:52306085-52306107 TAGGAAGGGCCTGAAGGCTGGGG + Intronic
907487686 1:54788692-54788714 GAGGGAGGGGCTGGAGCCTGAGG - Intronic
907603667 1:55794393-55794415 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
907614796 1:55912931-55912953 CCAGGAAGGCCTGAAGCCTAGGG + Intergenic
907761813 1:57368339-57368361 CAGGGAGGGGCTGAAGGATGGGG + Intronic
907777674 1:57534544-57534566 CTGGGAGGGTGTGATGCCTATGG - Intronic
908351001 1:63286358-63286380 TGGGGTGGGCCTGAAGCCTGGGG - Intergenic
908938904 1:69409285-69409307 CAGGGATGGCCTGAAGCTTGGGG + Intergenic
909054629 1:70806937-70806959 CAGGGATGGCCTAAAGTCTGGGG - Intergenic
909238309 1:73180806-73180828 CAGGGAGGGCCAGAAGGCTGGGG - Intergenic
909599630 1:77448190-77448212 CAGGGATGGCCTGAAGCATGGGG + Intronic
909779953 1:79531846-79531868 CAGGGAGAGCCTGGAGACTTGGG - Intergenic
910654971 1:89610049-89610071 CAGGGAGGACTCGAAGCCTGAGG - Intergenic
911025874 1:93435101-93435123 CAGGGATGGCCTGAAGGCTGTGG - Intergenic
911266936 1:95753806-95753828 CAGGGAGGGCCTGAAGCCTGGGG + Intergenic
911275544 1:95853728-95853750 CAGGGAGAGCCTAAAGCCTGGGG + Intergenic
911288690 1:96028775-96028797 CGGGGAAGGCCTGAAGCCTGGGG - Intergenic
911372616 1:97012188-97012210 CAGGGAGGCCATGAGGCCTCAGG + Intergenic
912013757 1:105005631-105005653 CAGGGACAGCCTGAAGCCTTGGG - Intergenic
912062179 1:105687023-105687045 CAGGGATGACCTGAATCCTGGGG - Intergenic
912132527 1:106619905-106619927 CAGGGAGGGCCTGAAGGCCGGGG + Intergenic
912413454 1:109493169-109493191 CAGGGAGGGATGGATGCCTAGGG - Intergenic
913345960 1:117811402-117811424 CTGGTAGGGCCTGAAGTCTTGGG + Intergenic
914753495 1:150550631-150550653 CAGGCAGAGCCTGAAGACTTGGG + Intronic
915016976 1:152743555-152743577 CAGGGAGATCCTGGAGCCTCAGG + Intronic
915171564 1:153981815-153981837 CAGGTAAGGTCTGAAGCCTGAGG + Exonic
915185112 1:154098770-154098792 CAGGTAGGGCCTGAAGCCTGGGG - Intronic
915751293 1:158213160-158213182 CACGGAAGGCCTGAAGCTTGGGG + Intergenic
915797395 1:158751840-158751862 CAGGGAGGGCCTGAAAACTGGGG - Intergenic
916648851 1:166816637-166816659 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
917044228 1:170838929-170838951 TAGGGAGGACCAAAAGCCTATGG - Intergenic
917848821 1:179042989-179043011 CAGGGATGGCCTGAAGCATGGGG - Intronic
918820623 1:189250002-189250024 GAGGGATGGCCTGAAGCTTGGGG + Intergenic
919083264 1:192891522-192891544 CAGGGAGGTCTTGAAGGCTGGGG - Intergenic
919165315 1:193885062-193885084 CAGAGAGGGCCTGAAGGCTGGGG - Intergenic
919168793 1:193928047-193928069 CAGGGACAGCCTAAAGCCTGGGG - Intergenic
919191787 1:194230506-194230528 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
919239197 1:194889602-194889624 CAGGGAGGGCCTGGAGGCTGAGG + Intergenic
919253881 1:195096532-195096554 CAGGGATGGCCTGAAGCCTGGGG + Intergenic
919264000 1:195237817-195237839 CAGGGACGGCCTGAAGCTAGGGG + Intergenic
919313998 1:195948385-195948407 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
919453977 1:197801438-197801460 CAGGGAGGGCCTGAGGCCTAGGG + Intergenic
919513452 1:198494201-198494223 CAGGGAGGGCCTGAAGCCTGGGG - Intergenic
919781060 1:201221527-201221549 CAGGAAGGGGATGAAGCCCAGGG + Exonic
920269544 1:204752516-204752538 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
921097801 1:211901878-211901900 CAGGGAGGGCTTGAAAGCTGGGG + Intergenic
921346311 1:214188845-214188867 CTGGGAGAGCCTGAATCCAATGG - Intergenic
921625387 1:217373196-217373218 CAGGGACAGCCTGAAGCCTGGGG + Intergenic
921674699 1:217965051-217965073 CAGGGACAGCCCGAAGCCTGGGG - Intergenic
921705982 1:218323554-218323576 CAGGGAGGGCCCGAAGCCTGGGG - Intronic
921890879 1:220352754-220352776 CAGGAAAGGCAGGAAGCCTAGGG - Intergenic
922041688 1:221903840-221903862 CACGGAGGGCCTGAAGGTTGGGG - Intergenic
922132737 1:222795491-222795513 TAGGGAGGGCCTGAAGACTGTGG + Intergenic
922141689 1:222894206-222894228 CAGGGACGGCCTGAAGCCTGGGG - Intronic
922452329 1:225747070-225747092 CAGGGAGGGCCTGAAGAGCTGGG + Intergenic
922586552 1:226738106-226738128 CAGGGAGACCCTGAAGCCCAGGG - Intronic
922861298 1:228818684-228818706 CAGGAAGGGTCTGAAGGCTGGGG + Intergenic
923328150 1:232898650-232898672 CAGGGAGGGCCTGAAGCCTGGGG + Intergenic
923755268 1:236785853-236785875 TGGGGAGGGCCTGAAGCCTAGGG + Intergenic
923786232 1:237071660-237071682 CAGGCACGACCTGAAGCCTGGGG - Intronic
923917968 1:238530225-238530247 CAGGGATGACCTGAAGCCTGGGG - Intergenic
924673040 1:246148085-246148107 CAGGGAGGGCCTGAAGGCTGGGG + Intronic
924679887 1:246220691-246220713 CAGGAAGGGCCTGAAGGCTGGGG + Intronic
1063574651 10:7250927-7250949 CAGGCAGGGCCAGAAGCCACAGG + Intronic
1063609689 10:7552205-7552227 CAGGGAGGACCTGAAGCAATTGG + Intergenic
1064010310 10:11730190-11730212 CAGGGACAGCCTGAAGCCTGGGG + Intergenic
1064292724 10:14050641-14050663 CAGGGAGGGCAGGGGGCCTACGG + Intronic
1065201467 10:23316966-23316988 CAGGGGTGGCCTGAAGCCTGGGG - Exonic
1065806107 10:29394894-29394916 CAGGCACGGCCTGAAGCCTGGGG + Intergenic
1065830316 10:29608851-29608873 CAGGGATGGCCTGAAGCCTGGGG + Intronic
1065976551 10:30847165-30847187 CAGAGAAGCCCTGAAGCCTGGGG + Intronic
1066508215 10:36066741-36066763 CAGGGATGGACTGAAGCCTGGGG + Intergenic
1067258711 10:44667268-44667290 CAGGAATGGCTTGAAGCCTGGGG - Intergenic
1067715847 10:48690916-48690938 CAAGGAGGGCCTGAAGGCTGGGG - Intronic
1067799283 10:49347932-49347954 CAGTGAGGGCCTGTGGCCAAAGG - Intergenic
1068083579 10:52347677-52347699 CACAGAGGGCCTGAAAGCTAAGG + Intergenic
1068137525 10:52965452-52965474 CAGGGCCAGCCTGAAGCCTGTGG - Intergenic
1068222745 10:54064434-54064456 CAGGGATGGCCTGAAGCCTGGGG - Intronic
1068279899 10:54854835-54854857 CAGGGAGTGCCTGAAGGCTGGGG - Intronic
1068283692 10:54909215-54909237 CAGGGAAGGCCTGAAGCCTGGGG - Intronic
1068287650 10:54961464-54961486 CAGGAATGGCTTGAGGCCTAGGG + Intronic
1068300455 10:55131889-55131911 CAGGGATAGCCTGAAGCCTAGGG - Intronic
1068348461 10:55813773-55813795 CAGGGAGGGTGTGAAGGCTGGGG + Intergenic
1068443876 10:57095441-57095463 CAGGGATGACCTGAAGCCAGAGG + Intergenic
1069156243 10:65034496-65034518 CAGGAAAGGCCTGAAGCCTTGGG + Intergenic
1069576007 10:69528966-69528988 CAGGGAGGGTCTGAAAGCTGGGG - Intergenic
1069732012 10:70623022-70623044 CAGGGAAGGTCTGAAGGCTGGGG + Intergenic
1069864995 10:71496779-71496801 CAGGGAGGGACTCAAGCATCGGG - Intronic
1070201194 10:74207786-74207808 CAGGGACAGCCTGAAGCATGGGG - Intronic
1070428781 10:76315751-76315773 CAGGGATGGCTTGAAGCCTGGGG + Intronic
1070744042 10:78922061-78922083 CAGGGAGGGGCTGAGGCAGATGG - Intergenic
1071819409 10:89264806-89264828 CAGGGAGGGCCTGAAGCCTGGGG - Intronic
1071957070 10:90770854-90770876 CAGGGAGGGCCTGAAGACTGGGG + Intronic
1072154736 10:92714597-92714619 CAGAGAGGGCCTGAAGGCTGGGG - Intergenic
1072335610 10:94395569-94395591 AAGGGAGGGCCTGAAGGCTGGGG - Intergenic
1072454471 10:95563864-95563886 GAGGGATGACCTGAAGCCTTAGG - Intergenic
1072470219 10:95706793-95706815 CATGGAGGGCCTGAAAGCTGAGG - Intergenic
1072763370 10:98076768-98076790 CACTGAGAGCCAGAAGCCTAGGG - Intergenic
1073670254 10:105579874-105579896 CAGGGAGCACCTGAAGGCTGGGG - Intergenic
1073890650 10:108097056-108097078 CAGGGTGTGCCTGAAGCCTGAGG - Intergenic
1074028756 10:109663731-109663753 CAGGGAGGGCCTAAAGGCTTGGG + Intergenic
1074301826 10:112240407-112240429 CAGGGACCACCTGAAGCCTGGGG - Intergenic
1074862794 10:117524997-117525019 CAGGGATGGCCTGAAGTCACAGG - Intergenic
1075132098 10:119748815-119748837 CAGGGACAACCTGAAGCCTGGGG - Intronic
1075565857 10:123503709-123503731 CAAGGCGGGCCTGAGGCCTGAGG + Intergenic
1075918059 10:126186677-126186699 CAGGAAGGGGCTGGAGCCTTAGG + Intronic
1075972279 10:126664892-126664914 CAGGGAGGGCTGGAAGAATATGG + Intronic
1076175811 10:128366989-128367011 CAGGCAGGGCTGGAAGCCCACGG + Intergenic
1076549157 10:131267017-131267039 CAGGGAGGACCTGAAGGCTGGGG - Intronic
1076655157 10:132019143-132019165 CAGGGAGGGCCTGAAGGCTAGGG - Intergenic
1076829748 10:132988533-132988555 CAGGGAGGGGCTGAGGCCCGGGG + Intergenic
1077012794 11:386246-386268 CAGGGTGGGCCTGAAGGCTGGGG + Intergenic
1077073641 11:689896-689918 CTAGGAGGGGCTGAAGCCCAAGG - Intronic
1077463898 11:2724412-2724434 CAGGGAGGGTTCGAGGCCTAGGG - Intronic
1077470824 11:2759775-2759797 CTGGGAGGGGCTGAAGGCTCAGG + Intronic
1077912710 11:6587042-6587064 CAGGGAGGGCCTGAAGGCTGGGG + Intronic
1078042799 11:7884146-7884168 CAGGGAGGGCCTGAATTCTGGGG - Intergenic
1078086068 11:8233653-8233675 GAGGGAGGGCCTGGACCCTGTGG - Intronic
1078267440 11:9765740-9765762 CAGAGAGGGGCTGAAGCCTCTGG - Intergenic
1078303314 11:10156463-10156485 CAAGGATAGCCTGAAGCCTGGGG + Intronic
1078315189 11:10288911-10288933 CGGGGAGGGCTTGAAGACTGGGG - Intronic
1078836432 11:15035050-15035072 CAGGGAGGGCCTGAAGGCTGGGG - Intronic
1079710728 11:23680009-23680031 CAGGGAGAGCCTGAAGGCTGGGG - Intergenic
1079882340 11:25943878-25943900 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
1079996964 11:27305094-27305116 CAGGGACGGCCTGAAGCCTGGGG + Intergenic
1080333928 11:31174569-31174591 CAGGGAAAACCTGAAGCCTGGGG + Intronic
1080485715 11:32704644-32704666 CAGGGATAGCCTGAAGCCTGGGG + Intronic
1080583989 11:33665658-33665680 CAGGGGGGGCCTGAAGGTTGGGG - Intronic
1080706689 11:34701750-34701772 CAGGGATGGCCTGAAGCCTGGGG + Intergenic
1080851986 11:36078224-36078246 CAGGGAAGGCCTGAGGCCTGAGG - Intronic
1081237155 11:40659408-40659430 CAGGGATGTCCTGAAGCCTGGGG + Intronic
1081802171 11:45867670-45867692 CAGGTAGGGGCTGAGGCCTGTGG - Exonic
1082000630 11:47392017-47392039 CAGGGTTGGCCTGAAGCTCAAGG - Intergenic
1082661666 11:55919976-55919998 CAGGGATAGCCTGAAGACTGGGG + Intergenic
1082687718 11:56260467-56260489 CAGGGATGGCCTGAAGCCTAGGG - Intergenic
1082750116 11:57006093-57006115 CAGGGAGGGCCAGAAGACTTGGG - Intergenic
1083066800 11:59932137-59932159 CAGGGAGGGCCTGAAGTTTGGGG - Intergenic
1083712037 11:64555461-64555483 CAGGGAGTGGCTGAGGCCTCAGG + Intergenic
1083887931 11:65581714-65581736 CAGGAAGGGACAGAAGCCCATGG + Exonic
1084323638 11:68386885-68386907 CAGGGCGGGGCTGAAGACTTGGG + Intronic
1084463518 11:69309131-69309153 CAGGCAGGGCCTGAAGCAGGCGG + Intronic
1084469493 11:69348766-69348788 CAGGAAGGGCCTGAAGGCTAGGG - Intronic
1084991120 11:72926177-72926199 CAGGGAGGGCCTGAAGACTGGGG + Intronic
1085100566 11:73796637-73796659 CAGGGAGTGCCTGAAGTCTGGGG + Intronic
1085319683 11:75566275-75566297 CAGGGTGGTCTTGAAGCCCAAGG - Intronic
1085326602 11:75611117-75611139 GAGGGAGGGACTGTAGCCTCTGG - Intronic
1085435179 11:76493429-76493451 CAGGGATGGCCTGAAGCATGGGG + Intronic
1085466193 11:76725047-76725069 GAGGGAGGGGCTGGAGCCCATGG - Intergenic
1085496871 11:76978208-76978230 CGGGGACAGCCTGAAGCCTGGGG + Intronic
1085508627 11:77074186-77074208 CAGGGAAGGCCAGAAGCCAGAGG - Intronic
1086085099 11:82945672-82945694 TGGGGAAGGCCTGAAGCCTGGGG - Intronic
1086249307 11:84795018-84795040 CTGGGACAGCCTGAAGCCTGGGG + Intronic
1086850132 11:91798948-91798970 CAGGGACAGCCTGAAGCCTGGGG + Intergenic
1086893770 11:92289006-92289028 CAAGCAGGGCCTGAAGCTCAGGG - Intergenic
1087036254 11:93758869-93758891 CAGGGAAGGCCTGAAGGCTGGGG + Intronic
1087037908 11:93773096-93773118 CAGGGAGGGCCTGAATGCTGGGG - Intronic
1087338932 11:96878303-96878325 CAGGGGTGGCCTGAAGCCTGGGG - Intergenic
1087407888 11:97752444-97752466 CAAGGATGGCCTGAAGTCTGGGG - Intergenic
1087453436 11:98353444-98353466 CAGGGATGGCCTGAAGTCTGGGG - Intergenic
1088135656 11:106552671-106552693 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1088456848 11:110041922-110041944 CAGGGAAGGGGTGAAGCCTCTGG - Intergenic
1088513272 11:110599574-110599596 CAGGGAGGGCCTGAAAGCTGGGG + Intronic
1088829290 11:113521751-113521773 CAGGGAGGGTTCTAAGCCTAGGG + Intergenic
1088905507 11:114152609-114152631 GAGTGAGGACCTGAAGCATATGG + Intronic
1089172958 11:116527909-116527931 CAGTAAGGGCCTGAAGGCTGAGG + Intergenic
1089505787 11:118961285-118961307 CAGGGAGGGCCTGAAAGCTGGGG - Intergenic
1089605542 11:119639130-119639152 CAGGGCGGGCATGAGGCCTCAGG + Intronic
1089823165 11:121246610-121246632 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1090116607 11:123980001-123980023 CAGGGACAGCCTGGAGCCTGGGG - Intergenic
1090124910 11:124075575-124075597 CAGGGAGGGTCCGAAGGCTAGGG - Intergenic
1090910140 11:131111456-131111478 CAGGAAGGGCTTGAAGCCTGGGG - Intergenic
1091091227 11:132773052-132773074 CAGGGAGGGGCAGAGACCTAGGG + Intronic
1091525599 12:1297158-1297180 CAGTGAGGACCTGAAGACAATGG + Intronic
1092501381 12:9051010-9051032 CAGGAAGGGCCTGAAGGCTGGGG + Intergenic
1092916723 12:13196193-13196215 CAGGGAGGCCCTGAAGGCGAAGG - Intergenic
1093281798 12:17204183-17204205 CAGGGAGGGCCTGAAGTCTGGGG + Intergenic
1093317211 12:17666666-17666688 CAGGGAATGCCTGAAGCCTGTGG - Intergenic
1093502433 12:19828033-19828055 CAGGGACAACCTGAAGCCTGGGG - Intergenic
1093525724 12:20102150-20102172 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
1094427301 12:30328409-30328431 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1094639349 12:32258888-32258910 CAGGGAGGGGTTTAAGCCTCCGG + Intronic
1094838609 12:34333767-34333789 CACGGAGGGCCTGGAGCCCACGG + Intergenic
1094851743 12:34385387-34385409 CACGGAGTGCCTCAGGCCTATGG - Intergenic
1094864556 12:34515254-34515276 CTGGGAGTGCTTGAGGCCTATGG - Intergenic
1095444094 12:42267652-42267674 CAGGGACAGCCTGAAGCCTGGGG - Intronic
1095603184 12:44037565-44037587 CAGGGAGGGCCTGAAGCCTGGGG + Intronic
1095826096 12:46531435-46531457 CTGGGAGGGCCTGAAGGCTGGGG + Intergenic
1096602198 12:52737199-52737221 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
1096602860 12:52742534-52742556 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1096788336 12:54030392-54030414 CGGGGAGGGCCGGAGGCCCAAGG + Exonic
1096791450 12:54047597-54047619 CAGGGAGGGGACGAAGCCCAAGG + Intronic
1097015051 12:55980138-55980160 CAGGTAAGGTCTGAAGCCTGAGG + Intronic
1097076274 12:56397212-56397234 CAGGGAGGACCTGAAGGCTGGGG - Intergenic
1097129951 12:56804674-56804696 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
1097130893 12:56810124-56810146 CAGGGAGACCCTGAAGACTGGGG - Intergenic
1097247727 12:57615788-57615810 CAGGGAGGGCCTGAGGAATCTGG + Intronic
1097491994 12:60282492-60282514 CTGTGAATGCCTGAAGCCTAGGG - Intergenic
1097500245 12:60392480-60392502 TGGGGAAGGCCTGAAGTCTAAGG + Intergenic
1097536157 12:60873043-60873065 CAGGGATGGCCTGAGGCCTGGGG - Intergenic
1098290859 12:68955928-68955950 TGGGGACGGCCTGAAGCCTGGGG - Intronic
1098519636 12:71420948-71420970 CAGTGACTGCCTGAAGCCTGGGG - Intronic
1098790563 12:74816902-74816924 CAGGAACAGCCTGAAGCCTGTGG + Intergenic
1098803012 12:74985658-74985680 CAGGGAGGGCCTGAAGCCTGGGG - Intergenic
1099033720 12:77560058-77560080 CAGGGATGGCCTGAAGCATGGGG + Intergenic
1099295420 12:80822879-80822901 CAGGGACAGCCTGAAGCCCAGGG + Intronic
1099428607 12:82553680-82553702 TGGGGTGGCCCTGAAGCCTAGGG + Intergenic
1099560968 12:84173866-84173888 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
1099574552 12:84362746-84362768 CAGGGAGGGATTGAAGGCTGGGG + Intergenic
1100672852 12:96835451-96835473 CAGGGAGGGCCTGAAGGCTGGGG - Intronic
1101580895 12:106040183-106040205 CAGGGAGGGCCTGAAGCCTGGGG - Intergenic
1101764000 12:107682232-107682254 CAGGGAGGGCCTGAAAGCTGGGG - Intergenic
1102060405 12:109926798-109926820 CAGGGGGGGCCTGAAGGCTGGGG + Intronic
1102328578 12:112010919-112010941 CAGGGAGGGCCTGAAGACAGGGG - Intronic
1102404890 12:112664632-112664654 GAGAGAGGGGCTGAAACCTAGGG + Intronic
1102430843 12:112881765-112881787 CTTGCAGGGCCTGAAGCCCATGG + Exonic
1103173667 12:118843712-118843734 CAGGGATGGCCTGAAACTTGGGG + Intergenic
1103341863 12:120225060-120225082 CAGTGGGGGCCTGGAGCCTCTGG - Intronic
1104382026 12:128315569-128315591 CAGGAAGGGTCGGGAGCCTATGG + Intronic
1105424462 13:20282801-20282823 CAGGAGGGGCCTGAAGACTGGGG + Intergenic
1105810697 13:23992667-23992689 CAGGGAGGGGCTGTAGCACATGG - Intronic
1105837878 13:24226211-24226233 CAGGGACAGCCTGAAGCCTCAGG - Intronic
1106308902 13:28535530-28535552 CAGGGCAGTCCTGAAGCCTGGGG + Intergenic
1106325427 13:28684497-28684519 CAGGGATGGCCTGAAGCGTGGGG + Intergenic
1106537500 13:30660265-30660287 CAGGGAGGGCCTGAAGGCTGAGG - Intronic
1106572015 13:30935308-30935330 CAGGGAGGGCCTGAAGTCTGGGG + Intronic
1106576326 13:30979059-30979081 CAGGGAGAGCCTGAAGACTAGGG - Intergenic
1107147047 13:37070342-37070364 CAGGGAAGGCCTGAAGGCTTGGG + Intergenic
1107229045 13:38086297-38086319 CAAGAATGGCCTGAAGCCTGGGG + Intergenic
1107513563 13:41107781-41107803 CAGGGAGCACCTGAAGGCTGGGG + Intergenic
1107699829 13:43036573-43036595 TAGGACTGGCCTGAAGCCTAGGG - Intronic
1107875842 13:44789955-44789977 CAGGGAGGGCCTGAAGGTTGGGG - Intergenic
1108118772 13:47160518-47160540 CAAGGATGGCCTGAAGTCTGGGG + Intergenic
1108240332 13:48457532-48457554 CAGGGAGCGCCTGAAGGCTGGGG - Intronic
1108249599 13:48551215-48551237 CAGGGATGGCATGAAGCCGGGGG + Intergenic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1109030027 13:57179547-57179569 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
1109348465 13:61145509-61145531 CAGGGATGGCCTGAAGGCTGGGG + Intergenic
1109396506 13:61766240-61766262 GATGGACAGCCTGAAGCCTAGGG - Intergenic
1109426226 13:62168424-62168446 CAGGGAGGGCCTGAATGCTGGGG + Intergenic
1109438897 13:62343529-62343551 CAGGGATGGCCTGAAGCCTGGGG + Intergenic
1109525239 13:63566542-63566564 CGAGGAAGGCCTGAAGCCTGGGG + Intergenic
1109563283 13:64078317-64078339 CAAGGATGGCGTGAAGCCTGAGG - Intergenic
1109652881 13:65352917-65352939 CAGGGCAGGCCAAAAGCCTAGGG - Intergenic
1109683532 13:65784150-65784172 CAGGAACAGCCTGAAGACTAAGG - Intergenic
1109837453 13:67877827-67877849 CAGAAAGGGCCTGAGGCCTGCGG + Intergenic
1109982280 13:69924263-69924285 CAGGGATGCACTGAAGCCTGAGG + Intronic
1110008179 13:70297659-70297681 CAGGGAGGACCTGAAGACTCGGG + Intergenic
1110047239 13:70845408-70845430 CAGGGACTGCCTGAAGCCGGGGG - Intergenic
1110215906 13:73024485-73024507 CAGGCAGGGCCTGTACCCTGTGG - Intergenic
1110439134 13:75507963-75507985 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
1110633416 13:77736715-77736737 CAGGGAGGGCATGTAGGATAAGG - Intronic
1110730807 13:78876913-78876935 CAGAGACAGCCTGAAGCCTGGGG - Intergenic
1110777992 13:79432488-79432510 CAGGGATGGCCTGAAGCCTGGGG + Intergenic
1110796642 13:79646031-79646053 CAAGCAGGGCCTCAAGCCTCAGG + Intergenic
1110810648 13:79807859-79807881 CAGGGAAGGCCTGAAGCCTGGGG + Intergenic
1110939442 13:81330788-81330810 CAGGGAGGGGCTGAAAGCTGGGG + Intergenic
1111072154 13:83183736-83183758 CAGTGAAGGCCTGAGGCCTGGGG - Intergenic
1111141658 13:84127394-84127416 CAGGGATGGCCTGAAGCGTGGGG - Intergenic
1111202838 13:84962095-84962117 CAGGGCCGGCCTGAAGGCTGGGG - Intergenic
1111225295 13:85263398-85263420 CAGAGAGGACCTGAAGTCCAAGG - Intergenic
1111237792 13:85431367-85431389 CAGGGAAGGCCTGAAACCTGGGG + Intergenic
1111268821 13:85853755-85853777 CAGGGATGGCCTGAAGCCCGGGG + Intergenic
1111274866 13:85935507-85935529 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1111337255 13:86840239-86840261 CAGGTTGGACCTGAAGCCTGGGG - Intergenic
1111347294 13:86974904-86974926 CAGGGACAGCCTGAAGCCTGAGG + Intergenic
1111567240 13:90032348-90032370 CAGGGACTGCCTGAAGCCTGGGG + Intergenic
1111597288 13:90427951-90427973 CAGGGATGGCCTAATGCCTGGGG + Intergenic
1112910934 13:104483386-104483408 CAGGGATGGCCTGATGCCTGGGG - Intergenic
1113229305 13:108195024-108195046 CAGGGATGGCCTGAAACCTGGGG + Intergenic
1113503063 13:110793456-110793478 CAGGGATAGCCTGAAGCATGGGG + Intergenic
1113664414 13:112131478-112131500 CAGGCAGGCCCTGGAGGCTACGG - Intergenic
1113887979 13:113670899-113670921 CAGGGAGGGCCTGGTGGCTCTGG + Intronic
1113970676 13:114185941-114185963 TGGGGAGGGCCTGAAGCCTGGGG + Intergenic
1114344508 14:21781041-21781063 CTGCGATGGCCTGAAGCCTGGGG + Intergenic
1115059101 14:29168803-29168825 CAGGAACAGCCTGAAGCCTGGGG + Intergenic
1115484996 14:33901767-33901789 CAGGGAAGGCCTATAGCCTAGGG + Intergenic
1116019292 14:39441480-39441502 CAGGGATGGCCTGAAGCCTGGGG + Intergenic
1116083391 14:40204525-40204547 CTGGGATGGCCTGAAGCCTGGGG - Intergenic
1116130849 14:40854520-40854542 CAGAGAGGGCCTGAAGGCTGGGG + Intergenic
1116221695 14:42096096-42096118 TGGGGAAGGCCTGAAGCCTGGGG - Intergenic
1116313757 14:43360248-43360270 CAGGGACAGCCTGAAGCATGGGG - Intergenic
1116356746 14:43939227-43939249 CAGGAACGGCCTGAAGCCTGGGG + Intergenic
1116789996 14:49329947-49329969 CAGGGACTGCTTGAAGTCTAGGG - Intergenic
1116961650 14:50973456-50973478 CAGGGATGGCCTGAAGCCTGGGG + Intergenic
1117806053 14:59491875-59491897 CCTCAAGGGCCTGAAGCCTAAGG + Intronic
1118410101 14:65469940-65469962 CAGGGAGGGCCTGAACGTTGGGG - Intronic
1118947020 14:70398278-70398300 CAAGGTGGGCCTGAAGGCTGAGG - Intronic
1119036170 14:71231778-71231800 TGGGGAGGGCCTGAAGCCTGAGG + Intergenic
1119688656 14:76653420-76653442 CAGGGCAGGCCTGGAGCCGATGG - Intergenic
1120592305 14:86390538-86390560 CAGGGATGGCCAGAAGCCTTGGG + Intergenic
1121368603 14:93337028-93337050 CAGAGATGGCCTAAAGCCTGGGG + Intronic
1121494493 14:94382784-94382806 CAGCGAGGGCCTGAAGCTAGTGG - Exonic
1121528024 14:94633052-94633074 CAGGGACAGGCTGAAGCCTGGGG - Intergenic
1121553382 14:94819230-94819252 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
1121636201 14:95455427-95455449 CCAGGAGGGCCTGCAGCCTGCGG - Exonic
1121695359 14:95908056-95908078 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
1122372592 14:101236899-101236921 CTGGGAGGGCCTGAGGACAAAGG - Intergenic
1122386073 14:101349177-101349199 CAGGGAAGACCTGAAGCATGGGG - Intergenic
1122491240 14:102117282-102117304 CAGGGAGGGCCTGAAGGCTGGGG + Intronic
1122506165 14:102233218-102233240 CAGGGAGGGCCTGTGGGCTGAGG - Intronic
1122531644 14:102431983-102432005 CAGGGGTGGCCTGGAGCCCAGGG - Exonic
1123888354 15:24749351-24749373 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1124095952 15:26648899-26648921 CAGGGAGGGGCTGGAGCTTGTGG + Intronic
1124650250 15:31469084-31469106 CAAGGAGGGCCTGAAGGCTGGGG - Intergenic
1125241558 15:37582455-37582477 GAGGGAAGGCCTGAGGCCTGAGG + Intergenic
1125676150 15:41503566-41503588 GAGGGAGGGGCTGAGGCCTGAGG - Intergenic
1125718100 15:41831015-41831037 CAGGGAAGGCCTGAAGCCTGGGG + Intronic
1125862063 15:43008614-43008636 CAGGAATGGCCTGAAGCCTGGGG + Intronic
1126185744 15:45829407-45829429 CAGGGAGGGCCTGAAGGCTGTGG - Intergenic
1126215214 15:46146396-46146418 CAGGGATGGCCTCAGGCCTGGGG + Intergenic
1126979633 15:54227334-54227356 GAGGGATGGCTTGAAGCCTGGGG - Intronic
1127525936 15:59792116-59792138 CAGGGAGGGCCTAATGGCTGGGG - Intergenic
1127533217 15:59865247-59865269 CAGGGAGGGCATGGACCCTCTGG + Intergenic
1128965269 15:72051906-72051928 CAGGGAAGGCCTGAAGCCTGGGG + Intronic
1129245568 15:74276837-74276859 CAGGGAGGACCTGAAGGACAAGG - Intronic
1129369049 15:75076600-75076622 CAGGGAAGGCCTGAAGGCTGGGG - Intronic
1129785030 15:78304260-78304282 CAGGGAGGGACTGAAGACTGGGG + Intergenic
1129832824 15:78681826-78681848 CAGGGAGGCCCTGAGCCATATGG - Intronic
1130013984 15:80173550-80173572 CAGGGAGTCCCTGCAGCCTCTGG + Intronic
1130029004 15:80295210-80295232 CAAGGAGGGACTGAAGGCTAGGG - Intergenic
1130183153 15:81651737-81651759 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1130227824 15:82073257-82073279 CAGGGAGGGTCTGAAGTCTGTGG - Intergenic
1130443681 15:83978930-83978952 AAGGGAGGCCATGAAGCCTCAGG - Intronic
1130738187 15:86571817-86571839 CAGGGAGGGCCTGAAGCCTGGGG - Intronic
1130856138 15:87841554-87841576 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
1131047456 15:89325408-89325430 GAGGAAGGGGCTGGAGCCTAGGG - Intronic
1131999306 15:98163326-98163348 CAGGGATGGCCTGAAGTATGGGG - Intergenic
1132292331 15:100712440-100712462 CATGTTGGGCCTGAAGCCCAGGG + Intergenic
1132887474 16:2188991-2189013 CAGGGAGGGCCTCAGCCTTAGGG - Intronic
1132969922 16:2682248-2682270 CAGGGTGGGGGTGAAGGCTAGGG + Intergenic
1132971744 16:2692672-2692694 CAGGGAGGGCATGAAGGCTGGGG - Intronic
1133234511 16:4381696-4381718 CAGGCAGGGCCTGCAGGCTTAGG - Exonic
1134078419 16:11308500-11308522 CAGGGAGGGTCCGAAGGCTGTGG - Intronic
1134244711 16:12531425-12531447 CAGGGAGGGCCTGACCCAGATGG + Intronic
1135057090 16:19240639-19240661 CAGGGAGGGCCTGAAGCCTGGGG - Intronic
1135644057 16:24145977-24145999 TAGGGTGGGCCTGAATCCAATGG + Intronic
1135826664 16:25734785-25734807 GAGGGAGTGCTAGAAGCCTAAGG + Intronic
1136145107 16:28311933-28311955 CAGGGAGGGCTTGTAGCCACTGG + Intronic
1136183832 16:28573294-28573316 GAGGGAGGCCCTGAAGCCAGAGG + Intronic
1137256378 16:46778415-46778437 CAGGGAGGGCCAGAAGGCTGGGG + Intronic
1137282720 16:46992274-46992296 TAGGGAGGGCCTGAAGGTTGGGG - Intergenic
1137291530 16:47055209-47055231 CAGAGAGGGCCTGAAGGCTGGGG - Intergenic
1137343887 16:47636849-47636871 CAGGGATGACCTGAAGCCTGGGG + Intronic
1137692932 16:50441730-50441752 TAGGGATGGCCTGAAGCCTGGGG + Intergenic
1137825270 16:51489506-51489528 CAGGGAGAGGCTGAAGGCTGGGG - Intergenic
1138394788 16:56695602-56695624 CAAGGAGGGCCTGAAGGCTGGGG + Intronic
1138925104 16:61581395-61581417 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
1138998228 16:62478173-62478195 CAGAGACAGCCTGAAGCCTTTGG + Intergenic
1139015485 16:62684349-62684371 CAAAGAGGGCCTGAAACCTGGGG + Intergenic
1139088699 16:63618196-63618218 CAGGGACAGCCTGAAGCCTGGGG - Intergenic
1139112187 16:63904843-63904865 TAGGGAAGGCCTGGAGCCTAGGG + Intergenic
1139390017 16:66601586-66601608 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
1139463652 16:67142385-67142407 CTGGGATGGCCTGAGGCCTGGGG - Intronic
1139471671 16:67181210-67181232 CAGGGACTGCCTTCAGCCTATGG + Intronic
1139530393 16:67539806-67539828 CAGGAGGGGCCTGAGGCCCAGGG - Intronic
1139569280 16:67800546-67800568 GAAGGAGGGCCTGAAGCTGAGGG - Intronic
1140419578 16:74807490-74807512 CAGGGAGGGCCTGACAGCTGGGG - Intergenic
1140436378 16:74950502-74950524 CAGAGAGGGCCAGAGGCCTGTGG + Intronic
1142366317 16:89651790-89651812 CAGGGAAGGCGTGAAGCCTGTGG + Intronic
1142546627 17:708526-708548 CAGGGAGATGCTGAAGCCTCCGG + Intronic
1142682909 17:1561067-1561089 GAGGGAGGGCCAGAAGCCCCAGG - Intronic
1142940681 17:3378087-3378109 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
1143102480 17:4512141-4512163 CAGGCAGGGACAGAAGCCTTTGG - Intronic
1143649726 17:8255990-8256012 CAGGGAGGCCCCTAAGCCAAGGG - Intronic
1144060938 17:11583097-11583119 CAAGGAGGGCCTGAAGGCTGAGG - Intergenic
1144182190 17:12762750-12762772 CAGTGAGGGCCTGAAGATGAGGG - Intronic
1144345562 17:14346163-14346185 GAGGGAGGGACAGAACCCTAGGG - Exonic
1144553313 17:16260278-16260300 CAGTGACAGCCTGAAGCCTGTGG + Intronic
1144695471 17:17301286-17301308 CTGGAAGGGCCTGAAGCCTGGGG + Intergenic
1144714497 17:17424559-17424581 CAGAAAGGGCCTGAAGGCTCGGG + Intergenic
1144783170 17:17817839-17817861 CATGGAGGGCGTGAAGACTGAGG - Exonic
1144832078 17:18137383-18137405 CAGGCAGTGCCTGAAGGCCAAGG - Intronic
1145217085 17:21060816-21060838 TAGGGAGGGCCTGAAGCCCGGGG - Intergenic
1146093494 17:29905711-29905733 CAGGGAGGGCCTGTGGGCTGGGG + Intronic
1146143268 17:30388268-30388290 CAGGGAGGTCCTGAAGGCTGGGG - Intronic
1146359158 17:32159885-32159907 CTGGGAGGGCCTGAAGCCCGGGG + Intronic
1146459430 17:33033728-33033750 CAGAGAAGGCCTGAAGGCTGTGG + Intronic
1146761499 17:35482806-35482828 CTGGGAGGGCCTGAAGGCTGGGG + Intronic
1148640435 17:49183616-49183638 CAAGGAGGGCCTGAGGGCTGGGG - Intergenic
1148870988 17:50658699-50658721 CAGGGCTGGCCTGTAGCCTGGGG - Intronic
1148908421 17:50926523-50926545 GAGGGGGACCCTGAAGCCTAGGG + Intergenic
1149010340 17:51850035-51850057 CAGGGAAGTCCTGAATGCTATGG + Intronic
1149160432 17:53686948-53686970 CAGAGAGGGCCTGAAGTCTGGGG - Intergenic
1149362506 17:55910566-55910588 TGGGGAGGGCCTGAAGCCTGGGG - Intergenic
1149884663 17:60328091-60328113 CAGGGAGGGCCTGAAGGCTGGGG + Intronic
1150950956 17:69801775-69801797 CAGGGAGGGCCTGAAAGCTGGGG + Intergenic
1151010068 17:70483957-70483979 CAGGGAGGGCCTGAAGGGGCTGG - Intergenic
1151395308 17:73819372-73819394 CAGAGCAGGCCTGAAGCCTGGGG - Intergenic
1151477506 17:74352383-74352405 CAGGGAGGGGCTGATGACCAAGG + Intronic
1151667887 17:75556080-75556102 CAGGGACGGGCTGTAGCCGAGGG - Exonic
1151772750 17:76175972-76175994 CAGGGAGAGCCTAAAGTATAGGG - Intronic
1151773076 17:76177573-76177595 CAGGGAGGACGTGAAGGCTGGGG + Intronic
1151895147 17:76975011-76975033 CAGGGAGGTCCTGAAGGCTAGGG + Intergenic
1152530354 17:80914876-80914898 CAGGGACAGCCTGAAGCCTGGGG + Intronic
1152724178 17:81937116-81937138 GAGGGAGGGCCCGGCGCCTAGGG + Intronic
1153139375 18:1954518-1954540 CACGGAGGGCCTGAAGCCTGGGG - Intergenic
1153427987 18:4987584-4987606 CAGGGACAGCCTGATGTCTAGGG - Intergenic
1153428799 18:4993038-4993060 CAGGGATGGCTTGAAGCCTAGGG - Intergenic
1154199584 18:12289932-12289954 TAGGCAGGGTCTGAAGCCTAGGG + Intergenic
1154507939 18:15060929-15060951 CGGGGAAGGTCTGAAGCCTGGGG + Intergenic
1155819184 18:30352943-30352965 CAGGGATGGCCTGAAGCCTGGGG + Intergenic
1155860789 18:30896495-30896517 TAGGGAACTCCTGAAGCCTATGG + Intergenic
1156298788 18:35817757-35817779 CAGGGAGGGTCTGAAGACTGGGG - Intergenic
1156327269 18:36085588-36085610 CAGGGAGGGCTTGAAGGCTGGGG + Intergenic
1157006428 18:43589680-43589702 CGGGGAGGGCCTGAAGCCTGGGG - Intergenic
1157506664 18:48231200-48231222 CAGGGACAGCCTGAGGCCTGGGG + Intronic
1157622148 18:49022853-49022875 AAGGGAGAGCCTGCAGCCTCGGG - Intergenic
1158773833 18:60553216-60553238 CAGGGAGGGCCTGAAGACTGGGG + Intergenic
1158774106 18:60555708-60555730 CAGGGGTGGCCTGAAGCCTGGGG + Intergenic
1159161356 18:64646808-64646830 CAGGGATGGACAGAAGCCTCAGG - Intergenic
1159186664 18:64983997-64984019 CAGGGAGGGCCTGAAGGCTCCGG + Intergenic
1159292441 18:66439942-66439964 CTGGGAAGGCCTAAAGCCTGGGG + Intergenic
1159458550 18:68693772-68693794 CAGGGAAGGCCTGAAGCCTGGGG + Intronic
1160083583 18:75753832-75753854 CAAGGATGGCCTGAAGCCTGAGG - Intergenic
1160116624 18:76085009-76085031 CAGGGATGGCCTGAAGCTGGGGG - Intergenic
1160795395 19:942936-942958 CAGTGAGGTCCTGCAGCGTACGG + Intronic
1161173231 19:2823924-2823946 CAGGGAGGGCCTGAAGACTGGGG - Intronic
1161570995 19:5030878-5030900 CAGGGATGGCCTCAGGCCTTTGG + Intronic
1161780172 19:6286477-6286499 CAGGGAGGGCCTGAAGGCTAGGG + Intergenic
1161781805 19:6297885-6297907 CAGGGAGGCCCTGAAGCCTGGGG + Intergenic
1161824166 19:6551465-6551487 CAGGGAGGGCCTGAAGGCTGAGG - Intergenic
1162429896 19:10622074-10622096 CAGGCAAGGCCTGAAGGCAACGG + Intronic
1164984426 19:32638107-32638129 CAGGGACAGCCTAAAGCCTGGGG + Intronic
1165022619 19:32936475-32936497 CGGAGAGGGCCTGAAGGCTGGGG + Intronic
1165026964 19:32969402-32969424 CAGGGAGGGCCTGAATTCTGGGG - Intronic
1165509069 19:36255692-36255714 CAGGCAGCCCCTGAAGCCTCTGG - Intergenic
1165631622 19:37306339-37306361 CAGGCAGCCCCTGAAGCCTCAGG + Intergenic
1165815568 19:38639967-38639989 CAGGGAGTGCCTAAATCCTGGGG + Intergenic
1166193356 19:41190595-41190617 CAGGGGTGCCCTGAAGCCAAAGG - Intergenic
1166897474 19:46032888-46032910 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1167013158 19:46822049-46822071 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1167235075 19:48309275-48309297 CAGGGAGGGCCTGAAGGCTGGGG + Intronic
1167236909 19:48320852-48320874 CAGGGAGGGACTGAGGCCGCGGG + Intronic
1167244667 19:48365746-48365768 CAGGGCTGGCCTGAAGCCCCCGG + Exonic
1167474572 19:49692272-49692294 CAGCGAGGGTCGGAAGCCCACGG - Exonic
1168282618 19:55313489-55313511 CAGGAAGGGCCTGTAGGCCATGG - Intronic
1168303407 19:55419777-55419799 TAAGGAGGGCCTGAAGGCTGGGG + Intergenic
924963877 2:57979-58001 CAGCCAGGGCCTGAAGGCTGAGG + Intergenic
925048182 2:790162-790184 CAGGAAGGGCCTGAAGGTTTGGG + Intergenic
925515295 2:4674727-4674749 CAGGGAAGGCCTGAAGCCTGGGG + Intergenic
926541251 2:14183159-14183181 CAGGGAGAGCCTGAAGGCTGGGG + Intergenic
926625431 2:15086037-15086059 TAGGTAGGGCCTGAAACCTGGGG + Intergenic
926859294 2:17291832-17291854 CAGGTAGGGCCTGAAGGCTGGGG - Intergenic
927072901 2:19548460-19548482 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
927226171 2:20767656-20767678 CAGGGAGGGTTTGAAGGCTAGGG + Intronic
927236469 2:20880075-20880097 CAGGAAGGGCCTGAAGCCTGGGG - Intergenic
927266913 2:21162237-21162259 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
927743197 2:25590804-25590826 CAGGGAGGGCCTGAAGCCTGGGG - Intronic
928182705 2:29080764-29080786 CAGGGACAGCCTGAAGCCTGGGG - Intergenic
928208118 2:29301840-29301862 CAGGGATGGTGTGAAGGCTATGG + Intronic
928429864 2:31208384-31208406 GAGGGAGGTTCTGAAGCCAAGGG - Intronic
928471500 2:31580771-31580793 CACGGAGAGCCTGAAGCCGGCGG - Exonic
928637876 2:33266450-33266472 CAGGAATGGCCTGAAGCCTGGGG + Intronic
929014559 2:37481628-37481650 TGGGGAGGGCCTGAAGCCTGGGG + Intergenic
929492447 2:42408276-42408298 CACATAGGGCCTGAAGGCTAGGG + Intronic
929870500 2:45755045-45755067 CAAGGAGGGCCTGGAGGCGAGGG + Intronic
930313692 2:49772261-49772283 CAGAAATGGCCTGAAGCCTGGGG - Intergenic
930612004 2:53554211-53554233 CGGAGAGGGCCTGAAGCCTGGGG + Intronic
930839184 2:55826316-55826338 CAGGGAGGGCCTCCAGGCTTGGG + Intergenic
930946658 2:57084304-57084326 CAGGGAAGGTCTGAAGCCTGGGG - Intergenic
931005827 2:57849639-57849661 CTGGGAAGGCCTGAAGCCCAGGG - Intergenic
931057005 2:58483500-58483522 CAGTGAGGGCCTGGAGGATAGGG - Intergenic
931300473 2:60973724-60973746 CAGGGAGGGCCTGAAGCCTGGGG + Intronic
931500055 2:62855500-62855522 CAGGGAGGGCCTGAAGGCTGGGG + Intronic
932054755 2:68432894-68432916 CGGGGAGGGCCTGAAGCCTGGGG - Intergenic
932398280 2:71462993-71463015 CAGGGATGGCCTGAAGCCTGGGG - Intronic
932522440 2:72427761-72427783 CAGGGAGGCACTGAAGGCTGGGG + Intronic
933063583 2:77768109-77768131 CCAGGAGGGCCTGAAGGCTGGGG + Intergenic
933093286 2:78146702-78146724 CAGGGAGGGCCTGAGGGCTGGGG + Intergenic
934696540 2:96404536-96404558 TGGGGAAGGCCTGAAGCCTGAGG - Intergenic
935244655 2:101207577-101207599 TATGGAGGGCCTGGAGACTAAGG - Intronic
935667553 2:105525626-105525648 CAGGAACAGCCTGAAGCCTGGGG + Intergenic
936548299 2:113412013-113412035 CAGGGAGACCCCGAAGCCAAAGG + Intergenic
937042988 2:118835598-118835620 GAGGGAGGGCCGGGAGCCGAAGG + Intergenic
937124644 2:119465830-119465852 CAGGGAGGAGCTGTAGCCCACGG + Exonic
937164042 2:119795268-119795290 CACAGAGAGCCTGAAGCCTGGGG - Intronic
937300194 2:120834325-120834347 AAGGCAGGGCCAGAAGCTTAGGG + Intronic
937339132 2:121079808-121079830 CTGGGAAGGCCTGATGCCTGAGG + Intergenic
937370840 2:121296278-121296300 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
937837292 2:126484470-126484492 CAGGAATAGGCTGAAGCCTATGG + Intergenic
938096425 2:128467146-128467168 CAGGGAGGGCCTGAAGACTGGGG - Intergenic
938194903 2:129318942-129318964 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
938732559 2:134158154-134158176 CAGGGATGGCCTGAGGCCTGGGG - Intronic
938899677 2:135789535-135789557 CTGGGAGGGAATAAAGCCTAAGG - Intronic
938991735 2:136636576-136636598 CAGGTAGGACCTGAAGACCATGG - Intergenic
939671608 2:145019419-145019441 CATGGAGGCCCTGAGGCCTAGGG + Intergenic
940398719 2:153222477-153222499 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
940422828 2:153499453-153499475 CAGTGACGGCCTGAAGCATGGGG - Intergenic
940612209 2:156006423-156006445 CAGGGAGGGCCTGAAGGCTGAGG - Intergenic
940711199 2:157165274-157165296 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
940846872 2:158651428-158651450 CAGGGAGGGGGTGAGGCCAATGG - Intronic
941043607 2:160649046-160649068 CAGGGAGGTCCTGAAGCCTGGGG + Intergenic
941131051 2:161650958-161650980 CAGAGATGGCCTGAAGCCTGGGG + Intronic
941151406 2:161919345-161919367 CAGGGACAGCCTGAAGCCTGGGG + Intronic
941404805 2:165074848-165074870 CAGGGATGACCTGAAGCCTGAGG + Intergenic
941998868 2:171626854-171626876 CAGGGATGGCCTGAAGCCTGGGG + Intergenic
942053490 2:172162421-172162443 CAGGGAGGACCTGAAGCCTGGGG - Intergenic
942103997 2:172614273-172614295 CAGGGAGGTCCTGAAGACTGGGG + Intergenic
942585070 2:177466427-177466449 CAGGGAGGGCCTGACGCCTGGGG - Intronic
942868067 2:180699684-180699706 CAGGGATGGCCTGCACCCTGGGG - Intergenic
943023488 2:182601973-182601995 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
943094367 2:183410918-183410940 CAGGAAGGGCCTGAACACTGAGG - Intergenic
943179446 2:184524665-184524687 CAGGGATAGCCTGAGGCCTGGGG - Intergenic
943223973 2:185144900-185144922 CAGGGATAGCCTGAAGACTGGGG + Intergenic
943367610 2:186980968-186980990 CAGAGAGGGCGTTAAGCCCAGGG - Intergenic
943427000 2:187749971-187749993 CAGGGAATACCTGAAGCCTAGGG - Intergenic
943950490 2:194128737-194128759 CAGAGAAGGCCTGAAGCATTGGG - Intergenic
943960213 2:194254436-194254458 CAGGGATGACCTGAAGCCTGGGG + Intergenic
943965560 2:194327883-194327905 CAGGGACGGCCTGATGCCTGGGG + Intergenic
944901828 2:204223531-204223553 CAGGGAAAGCCTGAAGCCTGGGG - Intergenic
945721296 2:213421535-213421557 CAGGCATGGCCTAAAGCCTGGGG + Intronic
945770400 2:214035293-214035315 TGGGGAGGGCCTGAAGCCTGGGG - Intronic
946315190 2:218906697-218906719 CAGGAAGGCCCTGAGGCCTGAGG - Intergenic
947327272 2:228992488-228992510 CAGGGAGGAACTGAAGGCTGGGG - Intronic
947385460 2:229586473-229586495 CAGGGGAGGCCTGAAGCATTGGG - Intronic
948434526 2:237944106-237944128 CAGGGACAGCCTGAAGCCTAGGG + Intergenic
948476110 2:238221078-238221100 CAGGGAGGGCCTGAAGGTTGGGG - Intergenic
948771597 2:240253965-240253987 CAGGGAAGGCCTGAGCCCTACGG - Intergenic
1168983408 20:2026895-2026917 CAGGGACAGCCTGAGGCCTGGGG - Intergenic
1169632348 20:7647583-7647605 CCAGGATGGCCTGAAGCCTAGGG - Intergenic
1169880498 20:10341654-10341676 CAGGGATAGCCTGAAGACTAGGG + Intergenic
1170004165 20:11647112-11647134 CAGGAAGGGCCTGAGGGTTATGG + Intergenic
1170221544 20:13947100-13947122 CAGGAAGGACCTGAAGCCTGGGG + Intronic
1170501011 20:16975084-16975106 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1170630288 20:18059035-18059057 CAGGGATGCCCTGGAGCCCAAGG + Intronic
1170733034 20:18990423-18990445 CAGCCAGTGCCTGAAGCCAAAGG + Intergenic
1171236912 20:23534907-23534929 TGGGGAGGGCCTGAGGCCTCTGG - Intergenic
1172484825 20:35291870-35291892 CTGGGTGGGGCTGAAGCCTGTGG + Exonic
1172676681 20:36677336-36677358 CAGGGAGGCCCTGAAGGCTACGG + Intronic
1173207611 20:41007146-41007168 CTGGGAAGGCCTGAAGCCTGGGG - Intergenic
1173893833 20:46534519-46534541 CAGGCAGGGCCTGGAGTCTGGGG + Intergenic
1175001361 20:55633411-55633433 TAGGGAGGGCCTGAAGCCTGGGG - Intergenic
1175138548 20:56842785-56842807 CAGGGACTGCCTGAAGCCTGGGG + Intergenic
1175899751 20:62355302-62355324 CAGGTAGGCCTGGAAGCCTAGGG + Intronic
1175959919 20:62630843-62630865 AAGGGAGGGCCTGAAACCTGGGG - Intergenic
1176064708 20:63188483-63188505 AAGGGAGTGCCTGCAGCCTGAGG - Intergenic
1176188732 20:63796291-63796313 CAGGGAGGGCGGGAGGCCTCGGG + Intronic
1176221605 20:63971755-63971777 CAGGGAAGGCCTCAGGCCTCAGG + Intronic
1176790144 21:13310870-13310892 CGGGGAAGGTCTGAAGCCTGGGG - Intergenic
1176944048 21:14957108-14957130 CAGGCAGAGCCAGAAGTCTAAGG + Intergenic
1176973276 21:15290143-15290165 CAAGGAAGGCCTGAAGCCTGGGG - Intergenic
1176976490 21:15327128-15327150 CAGGTAGGGCTTGAAGTCTGGGG + Intergenic
1177037427 21:16060952-16060974 CAGAGATGGCCTGAAGCCTGGGG - Intergenic
1177357841 21:20031722-20031744 TAGGGAAGGCCTGAAGCCTGGGG - Intergenic
1177396100 21:20538151-20538173 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
1177404324 21:20645838-20645860 CAGAGACAGCCTGAAGCCTGGGG + Intergenic
1177624865 21:23646590-23646612 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
1177875403 21:26625979-26626001 CAGGGATGGTCTGAATCCTGGGG - Intergenic
1178244383 21:30936657-30936679 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1178467085 21:32858739-32858761 CAGGGAGGGCCTGATGGCTGGGG - Intergenic
1181030287 22:20146209-20146231 CAGGGAGGGCCTGAGGGCTGGGG - Intronic
1181513007 22:23397164-23397186 CAGGGAGGGCCTGAGGGCTGGGG + Intergenic
1181531201 22:23518477-23518499 TAGGGAGGGCCAGGAACCTAAGG + Intergenic
1181911557 22:26242340-26242362 CAGGGAGGGGCTTGAGCCCAGGG - Intronic
1182419377 22:30241528-30241550 CAGGCAGGTCCTGAGGCCTGGGG - Exonic
1183108891 22:35634041-35634063 CAGGGAGTGGCTGAATCATAGGG + Intronic
1183208258 22:36433836-36433858 CAGGCAGGGACTGAAGCCGCTGG + Intergenic
1183678629 22:39313788-39313810 CAGGGAGGGCCTGAACCTGGAGG - Intronic
1183685460 22:39359050-39359072 CTGGGAGGGGCTGAAGGCTCAGG - Intronic
1183758072 22:39789481-39789503 CAGAGATGTCCTGAGGCCTAAGG - Intronic
1184054271 22:42033929-42033951 CAGGGAGGGCTTGAAAGCTGGGG - Intronic
1184242350 22:43217827-43217849 CAGGGATGTCGTGAGGCCTAGGG - Intronic
1184407378 22:44307880-44307902 CGGGGAGGGGCTGAGGCCTCAGG + Intronic
1184546165 22:45169878-45169900 CAGGGAGGGGTTCAAGCCTCTGG - Intronic
1184560904 22:45262507-45262529 CAGGGAGGCCCTGAAGGCTGGGG - Intergenic
1184865832 22:47201553-47201575 CAGGGAAGGCCTGAAGGCTGGGG - Intergenic
949218570 3:1601211-1601233 CATGGAGGGCCTGAAGGCTGGGG - Intergenic
949226335 3:1699881-1699903 CAGGGACGGCCTGATGCCTGGGG + Intergenic
949311262 3:2701180-2701202 CAAGGAAGGCCTGAAGCAAAGGG - Intronic
950994451 3:17480353-17480375 CAGGTATGGCCTGAAGCATGGGG + Intronic
951136238 3:19107351-19107373 CAGGGAAGGCCTGAAGGTTGGGG - Intergenic
951508901 3:23479999-23480021 TGGGGATGGCCTGAAGCCTGTGG - Intronic
951566854 3:24019910-24019932 CAGGGAAGGCCTGAAGCTTGGGG - Intergenic
951718475 3:25673894-25673916 CAGGGAAGGCCTGGAGCCTGGGG - Intergenic
952016123 3:28959116-28959138 CAGGGAGGGCCTGAAGGTTGGGG + Intergenic
952269394 3:31817197-31817219 CAGGGAGGGCCTGAAGGCTGAGG - Intronic
952408537 3:33026538-33026560 TGGGGAGGGCCCGAAGCCTGGGG + Intronic
953024417 3:39136672-39136694 CAGGGAGAGCCTGCAGCCTCTGG + Intronic
953354990 3:42248508-42248530 CAGGGAAGCCCTGAAGGCTGTGG + Intergenic
953718456 3:45335416-45335438 CAGGGAGGGCCTGGAGCCCAAGG + Intergenic
953748188 3:45591166-45591188 CAGGGACAGCCTGAAACCTAGGG - Intronic
954498033 3:50983329-50983351 TAGGGAGGACCTGAAGGCTGGGG + Intronic
954650906 3:52162270-52162292 CAGAGAAGGCCTGAAGGCTGGGG - Intergenic
954701310 3:52452303-52452325 CACGGAGGGCCAGAACCCTGGGG + Intronic
955111902 3:55958459-55958481 CAGGGACAGACTGAAGCCTGGGG - Intronic
955241528 3:57182777-57182799 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
955303809 3:57809615-57809637 CAGTGAGGGCCTAAAGGCTGGGG + Intronic
956989992 3:74751831-74751853 CAGAGAGGGCCTGAAGACTGGGG - Intergenic
957427009 3:80051726-80051748 CAGGGAGGGCCTGAGGCCTGGGG + Intergenic
957614050 3:82505762-82505784 CAGGGACAGCCTGAAGCCTAGGG + Intergenic
957624412 3:82640748-82640770 CAAGGAGGGCATGAAGCCTGGGG + Intergenic
957625827 3:82650857-82650879 CATGGAGGGCCTGAAGGCTGGGG + Intergenic
957636345 3:82790716-82790738 CAGCGATGGCCTGAGGCCTGAGG + Intergenic
957646667 3:82939335-82939357 CAGGGATGGCCTGAAGCCTGGGG + Intergenic
957665338 3:83218541-83218563 CAGGGATGGCCTGAGGCCTGGGG - Intergenic
957678754 3:83404358-83404380 CAGGGAGAGCCTGAAGGCTGGGG + Intergenic
957705139 3:83770489-83770511 CAGATAGGGCCTGAAGGCTGGGG + Intergenic
957775886 3:84756989-84757011 CAGGGACAGCCTTAAGCCTGGGG - Intergenic
958572972 3:95911757-95911779 CAGGAAGGGCCTGAAAGCTGGGG - Intergenic
958636231 3:96750476-96750498 CAAGGAGGGCCTGAAGGCTGGGG + Intergenic
959252534 3:103966191-103966213 CAGGGACAGCCTGAAGCCTGGGG + Intergenic
959476801 3:106821760-106821782 CAGGGATGGCCTGGAACCTGGGG + Intergenic
959863707 3:111243034-111243056 CTAGGAGGGCCTGAAGGCCAAGG - Intronic
960574688 3:119218239-119218261 CAGGGAGTGCCAGCAGCCTCTGG - Intronic
960690578 3:120342212-120342234 CAGGGTGGGCCTGAAGGCTGGGG + Intronic
960753528 3:120982903-120982925 CAGGCAGCACCTGAACCCTAGGG - Intronic
961097008 3:124166052-124166074 GAGGGAGGGCCTGAATGCTGGGG - Intronic
961311394 3:126004174-126004196 CAGGAATGGCCTGAAGCCTGGGG + Intergenic
961942974 3:130656600-130656622 CAGGGGGAGCCCGAAGCCTGGGG - Intronic
962105246 3:132382954-132382976 TAGGGAGGGCCTGAAGGCTGGGG - Intergenic
962539820 3:136369201-136369223 CAGAGAGGGCCTTCAGCCTTTGG - Exonic
962785950 3:138768537-138768559 CAGGGAGGGTCTGAAGGCTAGGG - Intronic
962824553 3:139088575-139088597 CAGGGAGGGCCTGAAGGCTGGGG - Intronic
963250185 3:143095737-143095759 CAGGGATGACCTGAAGTCTGGGG + Intergenic
963483351 3:145904296-145904318 CATGGACGGCCTGAAGGCTGGGG + Intergenic
963805143 3:149714724-149714746 CAAGGGGGGCCTGAAGCCTGGGG + Intronic
964255052 3:154766555-154766577 CAGGGAGGGTCTGAAGGCTGGGG - Intergenic
964887665 3:161503166-161503188 CACGGAGGGCCTGGCGCCAAGGG + Exonic
964996761 3:162891701-162891723 CAGGAAGGGCCTGAAGGCTGGGG + Intergenic
965009817 3:163073379-163073401 CAGTGATGGCCTGAAGCATGGGG + Intergenic
965261351 3:166489665-166489687 CAGGAAGGGCCTGAAAGCTGGGG + Intergenic
965309896 3:167115641-167115663 CAGGGAGGGCCTGAAGGCAGGGG - Intergenic
965367771 3:167820800-167820822 CAGGGATGACCTGAGGCCTGGGG + Intronic
965517826 3:169640957-169640979 CACAGAGGGCATGAAGCCTTTGG + Intronic
965542050 3:169880271-169880293 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
965774001 3:172209683-172209705 CAGGGAGGGCCTGAAGCCTATGG - Intronic
965793095 3:172410937-172410959 CAGGGAGGACTTGAAGGCTAGGG - Intergenic
965984666 3:174736722-174736744 CCAGGATGGCCTGAAGCCTGGGG - Intronic
966491471 3:180532051-180532073 CATGGAGGGCCTGAAGGCTGGGG + Intergenic
966840148 3:184081543-184081565 CAGGGAGTGCCTGAAGGCTGAGG + Intergenic
967649883 3:191973484-191973506 CAGGGAGGACCTAAAGGCTGGGG - Intergenic
968142970 3:196273824-196273846 CAGGGATGGCCTGAAGCCTGGGG - Intronic
968538677 4:1151183-1151205 CAGGGAGGTCCTGAAGGCTGGGG - Intergenic
968980776 4:3848378-3848400 CAGGGCTGGCCTGAAACCTGGGG - Intergenic
969179225 4:5424353-5424375 CAGGGATGGTCTGAAGCCTGGGG + Intronic
969490308 4:7495859-7495881 CAGGGAGGAGCTGAGGCCCAGGG + Intronic
971092419 4:23360875-23360897 CAGGGAAGGCCTGAAGCATGGGG + Intergenic
971669814 4:29542632-29542654 CAGGGACAGCCTGAAGCCTGGGG - Intergenic
971714112 4:30153519-30153541 CAGGGCAGGCCTGAAGCCTGGGG - Intergenic
971869394 4:32216198-32216220 CAGGGACGGCCTGAGACCTGGGG - Intergenic
971876837 4:32318898-32318920 CAGGGATGGCCTGAAGCATGGGG - Intergenic
971938830 4:33188844-33188866 CAGGGAGGGCTTGAAGGCTGGGG - Intergenic
972072551 4:35038943-35038965 CAGGAAGGACCTGAAGGCTTGGG + Intergenic
972158831 4:36198398-36198420 CAGGGAGGGCCTAAAGGTTAGGG - Intronic
972203906 4:36747947-36747969 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
972358300 4:38303333-38303355 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
973041135 4:45471794-45471816 TAGGGAAGGCCTGAAGCCTGGGG + Intergenic
973637912 4:52876993-52877015 GAGGGTGGGCCTGAGGGCTAGGG + Intronic
974023434 4:56711544-56711566 CAGGGATGGCCAGAAGCCTAGGG + Intergenic
974178965 4:58360463-58360485 CAGTGATGGCCTGAAGCCTGGGG - Intergenic
974308633 4:60174784-60174806 CAGGGAGGATTTGAAGGCTAGGG - Intergenic
974432568 4:61817272-61817294 CAGGGATGGCCTGAAGCCTGTGG + Intronic
974521628 4:62987838-62987860 CAAGGATGGCCTGAAGCCTCTGG - Intergenic
974607698 4:64174061-64174083 CAGGGATGGCCTGAAACCTGGGG + Intergenic
974644203 4:64671613-64671635 TGGGGAGGGCCTGAAGCCTGAGG - Intergenic
974683505 4:65195061-65195083 TGGGGAGGGCCTGAAGCCTGAGG - Intergenic
974697928 4:65398509-65398531 CAGGGATGGCCTGAAGCCTGGGG + Intronic
974761845 4:66286093-66286115 TAGGGAGGGCCTGAAGCCTGAGG - Intergenic
975008504 4:69320875-69320897 CAGGGACAGCTTGAAGCCTTAGG + Intronic
975221196 4:71814550-71814572 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
975321141 4:73011415-73011437 CAGGCAGGGCCAGGAGCCAAGGG + Intergenic
975321308 4:73012090-73012112 TGGGGAGGGCCTGAAGCCTGGGG + Intergenic
975498313 4:75057949-75057971 CAGGGATGACCTGAGGCCTGGGG + Intergenic
975597794 4:76066734-76066756 CAGGGAGGGCCTGAAGGCTGGGG - Intronic
975710844 4:77158186-77158208 CAGGGAGGGCCTTCTGCCCAGGG - Intronic
975910269 4:79258707-79258729 CATGGAGGGCCTGAAGGCTGGGG + Intronic
975913666 4:79297860-79297882 TAGGGAGGGCCTGAAGGCTGGGG + Intronic
976097823 4:81528078-81528100 CAGGGATGGCTTGAGGCCTGGGG - Intronic
976129678 4:81870975-81870997 CAAGGATGGCCTGAAGCCTGGGG + Intronic
976647342 4:87399924-87399946 CACGGATGGCCTGAGGCCTGGGG + Intergenic
976675493 4:87697879-87697901 TAGGGAGGGCCTGAAGGCTGGGG - Intergenic
976700785 4:87966643-87966665 CAGGGAGAGCCTGAAGGCTGGGG + Intergenic
976705341 4:88013911-88013933 CAGTGTGGGCTTCAAGCCTAGGG + Intronic
977033916 4:91924970-91924992 CAGGGCAGGCCTGAAACCTGGGG + Intergenic
977816242 4:101416873-101416895 CAGGGATGGCCTGAGGCCTGGGG - Intronic
978061455 4:104344937-104344959 CAGGGAAGACCTGAAGCCTGGGG + Intergenic
978149369 4:105415177-105415199 CAGGGATGGCCTGAAGCCTGGGG - Intronic
978229919 4:106385923-106385945 CAGGGAAGGCCTGAAGGCTGGGG - Intergenic
978248571 4:106604311-106604333 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
978301063 4:107270155-107270177 GGGGGAGGGCCTGAAGCCTGAGG - Intronic
978347652 4:107788588-107788610 CAGGGAAGGCCTGAAGCCTGGGG - Intergenic
978466736 4:109016480-109016502 CAGGAAAGGCCTGAAGCCTGGGG + Intronic
978822285 4:112979936-112979958 CAGGGAGGGGCTGAAGCCTGGGG - Intronic
978964568 4:114725568-114725590 CAGAGAGGGCCTGAAGGGTGGGG - Intergenic
979648967 4:123107574-123107596 CATGGACAGCCTGAAGCCTGGGG - Intronic
979649512 4:123114276-123114298 CAGGGCAGGCCTGAAGGCTGGGG - Intronic
980007592 4:127559412-127559434 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
980450139 4:132959238-132959260 TGAGAAGGGCCTGAAGCCTAGGG + Intergenic
980544782 4:134244609-134244631 CAGGGATGGGCTGAAGCTTCGGG + Intergenic
980582711 4:134774219-134774241 CAGGGATGGCCTGAAGCATCAGG + Intergenic
980730955 4:136823916-136823938 TGGGGAGTGCCTGAAGCCTGGGG - Intergenic
981889214 4:149716040-149716062 TGGGGATGGCCTGAAGCCTGGGG - Intergenic
982158057 4:152540570-152540592 TGGGGAAGGCCTGAAGCCTGGGG - Intergenic
982181332 4:152751212-152751234 CAGAAACGGCCTGAAGCCTGGGG + Intronic
982545197 4:156724627-156724649 CAGGGAAAGCCTGAAGCCTGAGG + Intergenic
982611051 4:157574823-157574845 CTGGGAGGGCCTGAAGCCTGGGG + Intergenic
982802613 4:159723104-159723126 CAGGGACGGCCTGAAGCCTGGGG - Intergenic
982856234 4:160385728-160385750 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
982901045 4:161003366-161003388 TAGGAATGGCCTGAAGCCTGGGG - Intergenic
982918887 4:161249745-161249767 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
982957699 4:161792452-161792474 CAGGAATGGCCTGAAGCCTGGGG + Intronic
982959880 4:161823189-161823211 GAGGGACGGCCTAAAGCCTGGGG - Intronic
983069713 4:163254104-163254126 CAGGGACAGCCTGAAGGATAGGG - Intergenic
983323786 4:166227524-166227546 CAGGGATGGCCTGAAGGCTGGGG + Intergenic
983784566 4:171715526-171715548 CAGGGAGGGCCTCAAGGCTGGGG + Intergenic
984102120 4:175499364-175499386 CAGGGAGGGCCTGAAGGGTGGGG - Intergenic
984325190 4:178242014-178242036 TGGGGAAGGCCTGAAGCCTGGGG + Intergenic
984375325 4:178922281-178922303 CAGGGATGGCCTGAAGCCCAGGG + Intergenic
984526749 4:180866918-180866940 CAGGCATGACCTGAAGCCTGAGG - Intergenic
984763761 4:183384102-183384124 CAGGAATGGCCTGAAGCCTGGGG + Intergenic
985121329 4:186645614-186645636 CAGGGAGGGACTGAAGACTGTGG + Intronic
985228629 4:187789807-187789829 CAGGGACAGACTGAAGCCTGGGG + Intergenic
985293695 4:188412205-188412227 CAGGGTGTGCCTGAATCCTGAGG - Intergenic
985816560 5:2132195-2132217 CAGGGAGGGCCTGGTGCCACTGG + Intergenic
985926710 5:3024889-3024911 AAGGGACAGCCTGAAGTCTAGGG + Intergenic
986950635 5:13080446-13080468 CAGAGATGGCCTGAAGCCCAGGG + Intergenic
987442072 5:17968277-17968299 CAGGAGTGGCCTGAAACCTAGGG - Intergenic
987537703 5:19209028-19209050 CAGGGACAGCCTGAAGCCTGGGG + Intergenic
987875406 5:23674859-23674881 CAGGGACAGCTTGAAGCCTGGGG + Intergenic
988346369 5:30042271-30042293 CAGGGAGGTACTGAAGCATGGGG + Intergenic
988565924 5:32320175-32320197 CAGGGAGGGCCTGAAGTCTGGGG - Intergenic
988641073 5:33041331-33041353 CAGAGATGGCCTGAACCCTGGGG - Intergenic
989339163 5:40354642-40354664 CAGGGATGGCCTGAGGCCTGGGG + Intergenic
989520654 5:42396533-42396555 CAGGGGAGGTCTGAAGCCTGGGG + Intergenic
989590004 5:43104478-43104500 CAGGGTAGGCCTGTAGACTAGGG - Intronic
989837655 5:46013168-46013190 TTGGGAGTGCATGAAGCCTATGG + Intergenic
989856882 5:46307416-46307438 TAGGGAGTGCCTGAGGTCTATGG - Intergenic
990557445 5:56951256-56951278 CAGGGAGGGACTGAACACTCTGG - Intronic
990639141 5:57762176-57762198 CAGGGAGGACCTGAAGGCTGGGG + Intergenic
990878761 5:60517384-60517406 CTGGGATGGCCTGAAGCCTGGGG + Intronic
991039675 5:62162596-62162618 CAGGGCTGACCTGAAGCCTCGGG - Intergenic
991107627 5:62862085-62862107 CGAGGAAGGCCTGAAGCCTGGGG - Intergenic
991359305 5:65803179-65803201 CAGGGAAGGCCTGAAGCCTGGGG - Intronic
992029681 5:72709023-72709045 CAGGGATGACCTGCAGCCTTGGG - Intergenic
992838928 5:80668308-80668330 CAGGAACAGCCTGAAGCCTGGGG - Intronic
993211851 5:84962035-84962057 CAGGGATGGTCTGAAGCCCGGGG - Intergenic
993703353 5:91143713-91143735 TGGGGAAGGCCTGAAGCCTGGGG - Intronic
993827576 5:92710640-92710662 CAGGGAGAGTCTGAAGGCAACGG + Intergenic
994246942 5:97489097-97489119 CAGGGACAGTCTGAAGCCTGGGG - Intergenic
994451563 5:99950605-99950627 CAGTGATGGCCTGAAGCCTGGGG + Intergenic
994593891 5:101806927-101806949 CTGAGATGGCCTGAAGCCTGAGG + Intergenic
994692386 5:103034710-103034732 CTGGGATGGCATGAAGCCTGAGG - Intergenic
994790843 5:104224069-104224091 CATGGAGGGCCTGAAGACTGAGG - Intergenic
994851243 5:105057369-105057391 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
995146011 5:108787467-108787489 CAGCGATGGCCTGAAGCCTGGGG + Intronic
995723997 5:115166163-115166185 CAGGGATAGCCTGAAGCCTAGGG + Intronic
995724631 5:115170127-115170149 GAGGGAGGGGCTGATGCGTAGGG - Intronic
995742414 5:115368842-115368864 TGGGGAAGGCCTGAAGCCTGGGG + Intergenic
995862997 5:116661316-116661338 CAGGCATGGCCTGAGGCCTGGGG + Intergenic
995927010 5:117386419-117386441 CAGGGATGGCCTGAAGCCTCGGG + Intergenic
996176748 5:120368568-120368590 CAGGGACAGCCTGAAGCCTGGGG + Intergenic
996217551 5:120887702-120887724 CAGGGAGGGCCTGAAGCCTGGGG - Intergenic
996234463 5:121108757-121108779 CAGGGAGCACCTGAAGGCTGAGG - Intergenic
996302791 5:122008154-122008176 CTGGGCTGCCCTGAAGCCTAGGG + Intronic
996923863 5:128800115-128800137 CAGAGAGGGCCTGAAGGCTGGGG - Intronic
997042815 5:130277952-130277974 CAGGGACAGCCTGAAGCCTGGGG - Intergenic
998135094 5:139670220-139670242 CAGGGAGGGCCTGCGGTCTGGGG + Intronic
998792263 5:145778018-145778040 CAGGGAGGGCCTGAAGGCTGGGG + Intronic
998907996 5:146927522-146927544 CAGGAAAGGCCACAAGCCTAAGG - Intronic
998929244 5:147162405-147162427 CAGAGAGGGCTTGAAGTCCAAGG + Intergenic
999199160 5:149803930-149803952 CAGTGAGGGCCAGAGGCCAAGGG - Intronic
999799426 5:155019597-155019619 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
999859902 5:155633786-155633808 CAGGAAGGGCCTGATGGCTGAGG + Intergenic
1000854239 5:166379376-166379398 CAGGGATGGCCTGAAACATGGGG - Intergenic
1002072419 5:176688158-176688180 CAGGGAGAGCCTGAAAGCTGGGG - Intergenic
1002194462 5:177494693-177494715 CAGGGAGGGGCTCAAGCCAGGGG + Intronic
1002368574 5:178731235-178731257 CAGGAAGTGCCTGAAGCAAAGGG + Intergenic
1002570567 5:180137294-180137316 CCGGGAGGGCCTGCTGCCTCTGG - Intronic
1002678034 5:180935224-180935246 CAGGGATGACCTGAAGCCTGGGG - Intronic
1002800386 6:516508-516530 CAGGGCAGGCCTGAAGCCAAGGG + Intronic
1004013859 6:11714538-11714560 TAGGGAAAGCCTGAAGCCTGAGG - Intronic
1004215059 6:13694718-13694740 CAGGGCGGGACTGAATCCAATGG - Intronic
1004304476 6:14487634-14487656 CTGGGAGAGCCTGAAGGCTGGGG + Intergenic
1004520824 6:16359229-16359251 GAGGGAGGGCCTGAAGGCTGGGG + Intronic
1004622848 6:17346436-17346458 GAGGTAGGGAATGAAGCCTATGG - Intergenic
1004720832 6:18266137-18266159 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
1005043493 6:21620509-21620531 CAGGGAGGGCCTGAAGGCTGAGG - Intergenic
1005658518 6:27967935-27967957 CAAGGATGGCCTGAAGCCTGGGG - Intergenic
1005912603 6:30324564-30324586 GAGGGAGGGCCAGAATCCAAGGG + Intergenic
1006225869 6:32535579-32535601 CAGGGAGGGATTGAAGGCTGTGG + Intergenic
1006347956 6:33498229-33498251 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1006463802 6:34179100-34179122 CACGGACAGCCTGAAGTCTAGGG - Intergenic
1006467122 6:34202577-34202599 CAAGGAGGGCCTGAAGTCTGGGG - Intergenic
1006719726 6:36142470-36142492 CACAGAGGGCCTGCAGCCCAGGG - Intronic
1006753741 6:36396584-36396606 CAGGGAAGGCCTAAAGGCTGGGG + Intronic
1006766333 6:36510062-36510084 CAGGGATGGCCTGAAGCCTGAGG - Intronic
1006867620 6:37222221-37222243 CAGGGAGAGCCTGAAGGCTGGGG - Intronic
1006898372 6:37484738-37484760 CAGGAAGGGTCAGAAGCCCAAGG - Intronic
1007551631 6:42734254-42734276 CAGGGAGGGGTTTAAGCCTCTGG + Intergenic
1007578076 6:42938875-42938897 CAAGGAGGGGCTGAAGGCTGCGG - Exonic
1007786527 6:44283259-44283281 CAGTGAGGGGCTGAGGCCTCAGG - Intronic
1008188333 6:48423018-48423040 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
1009196706 6:60695375-60695397 CAGGGAGGCCCTGAAGGCTGGGG + Intergenic
1009241703 6:61193445-61193467 CTGGGATGGCCTGAAGCCTGGGG - Intergenic
1009530212 6:64803505-64803527 CAGGGAAGGCGTGAAGCATGGGG - Intronic
1009534309 6:64861037-64861059 CCAGGAAGGCCTGAAGCCTGGGG - Intronic
1009588621 6:65637973-65637995 CAGGGATGGCCTGAAGCCTGGGG + Intronic
1009643107 6:66362809-66362831 CAGGGACGTCTTGAAGCCTAGGG - Intergenic
1009684302 6:66936495-66936517 CATTGACGGCCTGAAGCCTGGGG + Intergenic
1010519698 6:76817977-76817999 CAGTGACGGCCTGAGGCCTGGGG + Intergenic
1010884026 6:81215144-81215166 TAGGGAGGGCCTAAAGGCTGGGG + Intergenic
1011530170 6:88312638-88312660 CATGGAGGGCCTGAAGGCTGGGG - Intergenic
1012052284 6:94361371-94361393 AAGGGAGGGCCTGAAGGCTGGGG - Intergenic
1012122366 6:95384433-95384455 CAGGGAGATCCTGAAGCCTGGGG + Intergenic
1012169551 6:96001995-96002017 CAGGGAGGGCCTGAAGGTTGGGG - Intergenic
1012231178 6:96762609-96762631 AAAGGAGGGCCTGAAGGCTGGGG - Intergenic
1012698213 6:102417346-102417368 CAGGGAGGGCAGGGAGCTTATGG - Intergenic
1012752769 6:103184241-103184263 TGGGGAGGGCCTGAAGCCTGGGG + Intergenic
1012889921 6:104885942-104885964 CAGGGATGGCCTGAGGCCTGGGG + Intergenic
1013375509 6:109510098-109510120 CAGGGAGGGCCTGAAGGCTGGGG + Intronic
1013438590 6:110138863-110138885 CAGGGAAGGCCTGTAGCCTGGGG - Intronic
1014018965 6:116566107-116566129 CAAGGACAGCCTGAAGCCTAGGG - Intergenic
1014227162 6:118861809-118861831 CAGGGACAGCCTGAAGCCTGAGG - Intronic
1014384708 6:120786107-120786129 CAGGAACAGCCTGAAGCCTGGGG + Intergenic
1014391677 6:120872465-120872487 CTGGGATGACCTGAAGCCTAGGG + Intergenic
1014391887 6:120873645-120873667 CAGGAATGGCCTGAAGCCTGGGG + Intergenic
1014505340 6:122248050-122248072 CAGGCATGGCCTAAAGCCTGGGG - Intergenic
1015143284 6:129958835-129958857 CAGGGAAGACCTGAAGCCTCGGG + Intergenic
1015412528 6:132910982-132911004 GAAGGAGGACCTGAAGCCCAGGG + Intergenic
1015455666 6:133424330-133424352 CAGTGAGGGCCTGAAGGCTGGGG - Intronic
1016083400 6:139882516-139882538 GGGGGAGGGCCCGAAGCCTCTGG - Intergenic
1016163328 6:140908266-140908288 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
1016190789 6:141261545-141261567 CAGGGAGGGCCTGAGGGATGGGG + Intergenic
1016199995 6:141395054-141395076 CAGGGAGGGCCTCAAGGTTGGGG + Intergenic
1016210826 6:141531546-141531568 CAGGGACAGCCTGAAGCCTGGGG + Intergenic
1016339688 6:143049551-143049573 CAAGGAGGGCCTGAAGGCTGAGG - Intergenic
1016745126 6:147571151-147571173 CAAGGAGGACCTGAAGCATAAGG - Intronic
1017054480 6:150424903-150424925 CAGGGAGGGCCTGAAGGCTGTGG + Intergenic
1017396281 6:154003095-154003117 CAGGGATGGTCTAAAGCCTGGGG - Intergenic
1017420522 6:154268037-154268059 CAGGGAGGGCCTGAAGACTGGGG - Intronic
1017522357 6:155213597-155213619 CGGGGAAGGCCTGAAGTCTGGGG - Intronic
1017868593 6:158466955-158466977 CAATGAAGGTCTGAAGCCTAAGG + Intronic
1017890138 6:158631102-158631124 CAGGGACGTCCTGAAGGCTGAGG - Intronic
1018064984 6:160118582-160118604 CAAGAAGGGCCTGAAGGCTGGGG - Intergenic
1018544420 6:164919286-164919308 GAGGGCAGGCCTGAAGCCTGGGG + Intergenic
1018544449 6:164919426-164919448 TGGGGAGGGCCTGAATCCTGAGG + Intergenic
1018659959 6:166076810-166076832 CAGGGAGAGACTGAAGACTGGGG - Intergenic
1019216130 6:170445013-170445035 CAGGGAGGGCGTGAGGCCGTCGG - Intergenic
1019321452 7:417296-417318 CAGGTAAGGGCTGAAGCCCAGGG - Intergenic
1019661726 7:2227982-2228004 CAGGGAGGGCCTGGAGAACATGG - Intronic
1019897942 7:3997765-3997787 CAGTGAGGGCCTGGAGGCTGGGG - Intronic
1020474855 7:8582790-8582812 CAGGGACAGCCTGAAGCATGGGG - Intronic
1020568042 7:9822516-9822538 CAGGGAGGTCCTAAAGGCTGGGG - Intergenic
1020649243 7:10854988-10855010 CAGGGAGGGCCTGAAGCCAGGGG + Intergenic
1020659617 7:10966493-10966515 CAGGGATGGCCTGAAGCCTGTGG - Intergenic
1020812464 7:12864110-12864132 CAGGGAGAACCTGAAGCCTGGGG - Intergenic
1020832559 7:13110124-13110146 CTGGGACAGCCTGAAGCCTGGGG - Intergenic
1021021138 7:15599956-15599978 CAGTGAGGGCCTGAAGCCTGGGG - Intergenic
1021500781 7:21330052-21330074 CAAGGAGAGCCTGAAGCCTGGGG - Intergenic
1021677663 7:23097416-23097438 CAAGAATGGCCTGAAGCCTGGGG + Intergenic
1022952156 7:35349355-35349377 CAGGGAAGGACTGAGGCATAAGG + Intergenic
1023699409 7:42877831-42877853 CAGGGAGGGTCTGAAGGCTGAGG + Intergenic
1023789106 7:43737734-43737756 CAGGGAGGGCCTAAAGACTGGGG + Intergenic
1023790455 7:43749725-43749747 CAGGGAGGGCCTGAAGCCTGGGG - Intergenic
1024254786 7:47532254-47532276 CAGGGAGGGCCTGTAGGCTGGGG + Intronic
1024565164 7:50674508-50674530 CGAGGAGGGCCTGAAGCCCGAGG + Exonic
1024786232 7:52911119-52911141 CAAGGAAGGCCTGAAGCCTGGGG - Intergenic
1024857045 7:53794533-53794555 CAGGGACAGCCTGAAGACTGGGG - Intergenic
1025004205 7:55342647-55342669 CAGGGAGGGTCTGGAGGCTGAGG + Intergenic
1026370185 7:69691251-69691273 CAGGGATGGCCTGAAGCCTAGGG - Intronic
1026393597 7:69928335-69928357 CAGGGATGGCATGAAGTCTGTGG - Intronic
1026730097 7:72904123-72904145 CAGGCAGGGAGTAAAGCCTAGGG - Intronic
1027113879 7:75462999-75463021 CAGGCAGGGAGTAAAGCCTAGGG + Intronic
1027286131 7:76647604-76647626 CAGGCAGGGAGTAAAGCCTAGGG + Intergenic
1027333739 7:77126876-77126898 CAGGGAGGGCCTGAAGGCTGGGG - Intronic
1027681993 7:81233208-81233230 CAGGGACAGCCTGAAGCCTGGGG - Intergenic
1027734945 7:81920527-81920549 CAGAGACGGCCTAAAGCCTGGGG - Intergenic
1027779861 7:82507762-82507784 AAGGGAGGGCCTGAAGACTGGGG - Intergenic
1027911804 7:84260879-84260901 CAGGGACTTCCTGAAGCCTGAGG + Intronic
1027924830 7:84447366-84447388 CAGGGATGGCCTGAAGTCTTGGG + Intronic
1027987751 7:85315990-85316012 CATGGATGGCGTGAAACCTAAGG - Intergenic
1028053102 7:86208788-86208810 CAGAGATGGTCTGAAGCCTGGGG - Intergenic
1028111763 7:86949937-86949959 CAGGGAGGCTCTGAAGCCTGGGG + Intronic
1028136762 7:87230605-87230627 CAAGGATGGCCTGAAGCATGAGG + Intergenic
1028401945 7:90433901-90433923 TAGGGACAGCCTGAAGCCTGGGG - Intronic
1028527411 7:91801375-91801397 TGGGGAGGGTCTGAAGCCTAGGG - Intronic
1028640779 7:93039834-93039856 CAGAGAAAGCCTGAAGCCTGGGG + Intergenic
1028816898 7:95157056-95157078 GAGAGAAGGCCTGAAGCCTGGGG - Intronic
1028880663 7:95876061-95876083 CAGGGAGGCTCAGATGCCTATGG + Intronic
1029727400 7:102416142-102416164 CTGGCAGGGCCTGCAGCCAAGGG - Intronic
1029782055 7:102744456-102744478 CAGGAAGGGCCTGAAGGCTGGGG + Intergenic
1029899298 7:104022449-104022471 CAGGGAAGGCCTGAAGGCTGGGG + Intergenic
1030218069 7:107067050-107067072 CAGGGAGGGGGTGAAGCATGGGG - Intronic
1030484528 7:110149247-110149269 CAGGGATAGCCTGAGGCCTGGGG - Intergenic
1030514069 7:110519434-110519456 CAGGGAGGTCCTGAAGGCAGGGG - Intergenic
1030756330 7:113291649-113291671 CAGGAATGGCCTGAGGCCTGGGG + Intergenic
1031239499 7:119219684-119219706 CCGGGTGGGCCTAGAGCCTAAGG + Intergenic
1031242055 7:119258142-119258164 CAGGGAGGGCCTGAAAGCTAGGG - Intergenic
1031248620 7:119350580-119350602 CAGGTAGGGCCTGAAGGCTGGGG + Intergenic
1031786572 7:126040876-126040898 CAGGGAGGGCCTGAAGCCTGGGG + Intergenic
1031859086 7:126957839-126957861 CAGGGATGCCCTGAAGCCCGGGG + Intronic
1031921976 7:127608983-127609005 CAAGAATGGCCTGAAGCCTGGGG - Intergenic
1032858619 7:135858000-135858022 CAAGGAGGGCCTGAACCCTGGGG - Intergenic
1032919275 7:136527495-136527517 CAGGGACAGCCTGAAGCATGGGG - Intergenic
1034481201 7:151321330-151321352 CAGGGAGGGTCTGAAGGCTGGGG + Intergenic
1034909662 7:154985368-154985390 CAGGAAGGGCCTGGACACTATGG - Intronic
1035252403 7:157605897-157605919 CAGGGAGGGTTTGAAGGCTGGGG - Intronic
1035361869 7:158318594-158318616 CAGGGAGGCTCAGAAGCCCAGGG + Intronic
1035450976 7:158976541-158976563 CAGCGAGGGCCTGAAGGCTGGGG + Intergenic
1035457901 7:159021231-159021253 TGGGGAAGGCCTGAAGCCTGGGG - Intergenic
1036128303 8:6084078-6084100 CAGTGAGGGGCAGGAGCCTAAGG + Intergenic
1036907619 8:12720366-12720388 CAGGGATGGCCTGAAGCCTGGGG + Intergenic
1037150236 8:15626962-15626984 TTGGGAGGGCCTGAAGCCTGGGG + Intronic
1037553993 8:20004480-20004502 CAGGGAGGGCCTGAAGGCCAGGG - Intergenic
1039144969 8:34437557-34437579 CAGGGAAGGCTTGTAGCCTGGGG + Intergenic
1039182327 8:34880531-34880553 CAGGGAGGGCCTGAAGCCTGGGG - Intergenic
1039210148 8:35204561-35204583 CAGGGAGAGCCTGAAGCCTGGGG - Intergenic
1039556670 8:38481362-38481384 CAGGGTGGTTCTGAAACCTAGGG - Intergenic
1040661835 8:49583198-49583220 CAGGGAGGGCCTGGAAGCTGTGG + Intergenic
1040725645 8:50378948-50378970 CAGGGAGGGCCTGAAGGCTGGGG - Intronic
1041024066 8:53666180-53666202 CAGGGAGGGCCGGCAGGCTGGGG + Intergenic
1041357284 8:57014208-57014230 CAGGGAGGGCCTGAAAGCTGGGG - Intergenic
1042196837 8:66238278-66238300 CAGGGAGCGCCTGAAGGCTGGGG - Intergenic
1042396050 8:68292864-68292886 CAGGGAGGGCCTGCAGGCTGCGG + Intergenic
1042609018 8:70577335-70577357 CAGGGACAGCCTGAAACCTGGGG + Intronic
1042687868 8:71462084-71462106 CAGGGAGGGCCTGAAGGCTGAGG - Intronic
1043082546 8:75784599-75784621 CAGGGATGGCCTGAGGCCTGGGG - Intergenic
1043180657 8:77083269-77083291 CAGGGATGTCCTAAAGCCTGGGG - Intergenic
1043414563 8:80033932-80033954 CAGGGACAGCCTGAAGCCTGGGG - Intronic
1043568125 8:81570894-81570916 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
1043702845 8:83312847-83312869 AAGGGATGGCCTGAGGCCTGGGG - Intergenic
1043708051 8:83378218-83378240 CAGAGACGGCGTGAAGCCTGGGG - Intergenic
1043734241 8:83724211-83724233 TGGGGAGGGCCTGCAGCCTGGGG - Intergenic
1043955977 8:86360263-86360285 AAGGTAGGACCTGAAGCCTGTGG - Intronic
1044053763 8:87542690-87542712 CAGGGAGGGCCTGCAGCCTGGGG - Intronic
1044129665 8:88505930-88505952 AAGGGATGGCCTGAAGCCTGGGG - Intergenic
1044259225 8:90098335-90098357 CAGGGAGGGCCTGAAGGCTGAGG - Intergenic
1044962332 8:97542964-97542986 CAGGGAAGGCCCGAAGGCTGGGG + Intergenic
1045300733 8:100908177-100908199 CAGGGACGACCTGAGGCCTGGGG - Intergenic
1045797320 8:106061287-106061309 CAGGGACTGCCTGAAGACTGGGG + Intergenic
1046395289 8:113632821-113632843 TAAAGAGGGCCTGAAGCCTGGGG - Intergenic
1046407331 8:113791156-113791178 CAGGGAAGGCTTGAGGCCTGGGG - Intergenic
1046459746 8:114518158-114518180 CAGGAAGGGCCTGAAGGCTGGGG - Intergenic
1046674674 8:117094683-117094705 CAGGGAGAGCCTGAAGCCTGGGG - Intronic
1046775371 8:118158622-118158644 CAGGGATAGTCTGAAGCCTGGGG + Intergenic
1047104677 8:121719892-121719914 CAGGGAAGGCCTGAAGCCTGGGG - Intergenic
1047642324 8:126833753-126833775 CAGGAGGGGCCTGAAGCCCGTGG - Intergenic
1048339131 8:133525487-133525509 CAGGGACAGCCTGAAGCCTGGGG - Intronic
1048421710 8:134284124-134284146 CAGGGAGGACCTGAAAGCTGGGG - Intergenic
1048547966 8:135404773-135404795 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
1049217077 8:141413160-141413182 CAGGGAGGCCCTGAACTCTCCGG + Intronic
1049653369 8:143787016-143787038 CACGGAGGGCTTGACGCCTAGGG + Intergenic
1049826848 8:144674573-144674595 CAGGGACAGCCTGAAGCCTGGGG - Intergenic
1050130486 9:2406836-2406858 AAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1050182322 9:2934424-2934446 CAGGGAGGGCCTGAAACCTGAGG + Intergenic
1050589702 9:7148962-7148984 CAGGGATGGCCTGAAGCCTGGGG - Intergenic
1050808892 9:9718976-9718998 CAGGGATGACCTGAAGCCTGGGG + Intronic
1050947940 9:11549778-11549800 CAGGGATGGCCTGAAGCATGGGG + Intergenic
1051355168 9:16234141-16234163 CAGGGACAGCCTGAAGCTTGAGG + Intronic
1052233988 9:26188562-26188584 TAGAGTGGGCCTGAAGCCTGAGG - Intergenic
1052459327 9:28742054-28742076 CAGGCAGTGCCTGAAGACTAAGG - Intergenic
1052466818 9:28839758-28839780 CTGGGATGGCCTAAAGCCTTGGG - Intergenic
1052623479 9:30944128-30944150 CCGAGAAGGCCTGAAGCCTGGGG + Intergenic
1052633573 9:31071708-31071730 TAGGGAGGGCCTGAAAGCTGGGG - Intergenic
1052644182 9:31211235-31211257 CAGGAATGTTCTGAAGCCTAGGG - Intergenic
1052652392 9:31321379-31321401 CTGGGAGAGCCTAAAGCCTGGGG - Intergenic
1052654251 9:31335127-31335149 CAGGGAGAGCCTGAAGGCTGGGG - Intergenic
1053128171 9:35599494-35599516 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1053619157 9:39798580-39798602 TGGGGTGGGGCTGAAGCCTAGGG - Intergenic
1053727264 9:41016774-41016796 CAGGGAGACCCCGAAGCCAAAGG - Intergenic
1054265000 9:62908849-62908871 TGGGGTGGGGCTGAAGCCTAGGG + Intergenic
1054701253 9:68415338-68415360 CAGGGAGACCCTGAAGCCAAAGG + Intronic
1056043883 9:82696070-82696092 CAGGGAGGGTATAGAGCCTAGGG + Intergenic
1056715251 9:89023143-89023165 CAGGGTGGGCCTGAGGCCCCAGG - Intronic
1056986100 9:91364610-91364632 CAAGGAGGGCCTGAAGGCTGGGG + Intergenic
1057172794 9:92973881-92973903 CTGGGAGGCCCAGAAGACTAAGG - Intronic
1057468535 9:95337655-95337677 CAGGAAGGGCCTGAAGGTTGGGG + Intergenic
1057531181 9:95847743-95847765 CAGGGAGGGCCTGTAGGCTGGGG + Intergenic
1057548515 9:96035263-96035285 CAGGGAATGCCTGAAGGCTAGGG + Intergenic
1058091911 9:100814384-100814406 CAGGGAAGGCCTGAAGGTTGGGG + Intergenic
1058545801 9:106059557-106059579 CAGGGATAGCCTGAAGCCTTGGG - Intergenic
1059104781 9:111501771-111501793 CAGGGACAGCCTAAAGCCTGGGG + Intergenic
1059339234 9:113588090-113588112 CAGGGAAGGGCTGCAGCCTGTGG - Intronic
1059401211 9:114071580-114071602 TGGGGAGGGCCTGAAGCCTGGGG + Intronic
1059565491 9:115379883-115379905 CAGGGAGGGCCCAAAGGCTGGGG + Intronic
1059681528 9:116590610-116590632 CTGGGATGGCCTGAACCCTGGGG + Intronic
1059852826 9:118363388-118363410 CAGGGATGGCCTGAAGCTTGGGG + Intergenic
1060149320 9:121277946-121277968 CAGAGAGGGTGTGTAGCCTATGG + Intronic
1060180112 9:121527896-121527918 CAGGGAGGGCCTGAAGCCTGGGG - Intergenic
1060521204 9:124295068-124295090 CAGGGTGGGCCTGCAGCATCAGG - Intronic
1061249262 9:129416969-129416991 TAGGGAGGGCCAGGAACCTAGGG - Intergenic
1061267351 9:129514473-129514495 CAGGGAAGGCCTGAAGGCTGGGG + Intergenic
1062105001 9:134750529-134750551 CAGGGGGGCCCTGAAGACAAGGG - Exonic
1062184707 9:135211733-135211755 CAGGGAGGGCCTAAAGGCTGGGG + Intergenic
1062329118 9:136029087-136029109 CAGGAATGGCCTGAAGCCCAGGG + Intronic
1062406999 9:136401360-136401382 CAGGGAAGGCCTGTGGCCTGAGG + Intergenic
1188647860 X:32592193-32592215 CAAGAATGGCCTGAAGCCTGGGG + Intronic
1188800606 X:34525052-34525074 CAGGGAGGGCATGAAAACTCTGG + Intergenic
1188859879 X:35244136-35244158 CAGGGAGAACCTGAAGACTGGGG - Intergenic
1189083576 X:37997770-37997792 CAGGAAGGGCCTGAAAGCTGGGG + Intronic
1189111102 X:38289907-38289929 GAGGGAGAGCCTGGAGTCTAAGG + Intronic
1189360183 X:40343935-40343957 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1189382909 X:40514433-40514455 CAAGGAGGTCCTAAAGCCAATGG + Intergenic
1189856369 X:45229058-45229080 CAGAGACGGCCTGAAGGCTGCGG - Intergenic
1190096187 X:47482910-47482932 TAGGGACGGCCTGAGGCCGAGGG - Exonic
1190335427 X:49258861-49258883 CAGGGAGGGCTAGAGGCCTGAGG - Intronic
1190369495 X:49727296-49727318 CAGGGAAGTCCTGAAGCCTGGGG + Intergenic
1190376901 X:49797181-49797203 CCTGGAGGGGCTGAAGCCAAAGG - Intergenic
1190444880 X:50514686-50514708 CAGGGAGGGCCTGAAGGCTGGGG - Intergenic
1190605591 X:52139211-52139233 CCAGGAAGGCCTGAAGCCTGTGG - Intergenic
1191016350 X:55813777-55813799 CAGGGATGGCCTGAAGCTTGGGG + Intergenic
1191062904 X:56318385-56318407 TGGGGTGGGCCTGAAGCCTGAGG - Intergenic
1192179852 X:68909586-68909608 CAGGCTGGGCCTGCAGCCAATGG + Intergenic
1192788054 X:74354080-74354102 TGGGGTGGGCCTGAAGCCTGTGG - Intergenic
1193211460 X:78811258-78811280 CAGTGATGGCCTGAAGTCTAGGG - Intergenic
1193468748 X:81875458-81875480 CAGGGAGGGCCTGAAAGCTGAGG - Intergenic
1193554137 X:82932550-82932572 CAGGGAGGGTCTGAAGCCTGGGG + Intergenic
1193575027 X:83185974-83185996 CAGGGAGGACATGAAGGCTGGGG - Intergenic
1193919378 X:87406922-87406944 CAGGGAGGGCCTGAAGGCTAGGG - Intergenic
1194205068 X:91002693-91002715 TAGGGAGGGCATGAAGGCTGGGG - Intergenic
1194212197 X:91082572-91082594 CAGGGAATGTCTGAAGCCTGGGG + Intergenic
1194316136 X:92379616-92379638 CAGAGAAGGCCTGAAGCCTGGGG + Intronic
1194380276 X:93181792-93181814 CAGGGAGGGCCTGAAAGCTGGGG + Intergenic
1195126499 X:101813838-101813860 CAGGGAGGGCCTGAAGGCTGGGG + Intergenic
1195179077 X:102339508-102339530 CAGGGAGGGCCAGAAGGCTGGGG - Intergenic
1195454281 X:105051094-105051116 CAGGGAGGGCCTGAAGGCTGAGG - Intronic
1195564229 X:106323322-106323344 TGGGGTGGGCCTGAAGCCCAGGG - Intergenic
1195655014 X:107324903-107324925 CAGGGTGTGCCTGAAGGCTGGGG + Intergenic
1195828488 X:109029394-109029416 TGAGGAGGGCTTGAAGCCTAGGG - Intergenic
1195880297 X:109586356-109586378 CAGGGAGGGCATGAAGCATGGGG - Intergenic
1196082738 X:111649905-111649927 GAGGGCAGGCCTGAAGCCTAGGG + Intergenic
1197035642 X:121870423-121870445 CAGGGAGGGCCTGAAGCCTGGGG + Intergenic
1197240092 X:124114343-124114365 TGGGGTGGGCCTGAAGCCTGTGG + Intronic
1197527183 X:127577554-127577576 CAGGGATGGCCTGAAGCCTGGGG + Intergenic
1197609550 X:128623261-128623283 CAGGGAGGGCCTAAATCCTGAGG - Intergenic
1197758125 X:130010405-130010427 GAGGGAGGGCCTGAAGGAAAGGG - Intronic
1197846578 X:130810407-130810429 TATGGTGGGCCTGAAGCCTAGGG - Intronic
1198189484 X:134288064-134288086 CAGGGATGGCCTAAAGCCTGGGG + Intergenic
1198699491 X:139382277-139382299 CAGGGAGGGCCTGAAGACTGGGG - Intergenic
1199614775 X:149647805-149647827 CGGGGAGGGCCTGAAGTCTGGGG + Intergenic
1200208187 X:154332773-154332795 CAGGTAGCGCCTGAAGCGTGGGG - Intergenic
1200550896 Y:4577836-4577858 TAGGGAGGGCATGAAGGCTGGGG - Intergenic
1200624181 Y:5491190-5491212 CAGAGAAGGCCTGAAGCCTGGGG + Intronic
1200749154 Y:6929140-6929162 CAGGGATGGCCTGAAGCCTGGGG - Intronic
1201935425 Y:19406629-19406651 CAGGGAGGACCTGATTCCTGAGG - Intergenic
1202018184 Y:20434492-20434514 CAGGGAGGGCCCAAAGCCTGGGG - Intergenic