ID: 965774096

View in Genome Browser
Species Human (GRCh38)
Location 3:172210079-172210101
Sequence CTGGGTCCAGAGCTGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 765
Summary {0: 2, 1: 11, 2: 26, 3: 110, 4: 616}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965774085_965774096 30 Left 965774085 3:172210026-172210048 CCAGCCAGGGAGTGGAAGCAGGC 0: 1
1: 0
2: 1
3: 30
4: 303
Right 965774096 3:172210079-172210101 CTGGGTCCAGAGCTGCAGCTGGG 0: 2
1: 11
2: 26
3: 110
4: 616
965774086_965774096 26 Left 965774086 3:172210030-172210052 CCAGGGAGTGGAAGCAGGCACTT 0: 3
1: 27
2: 135
3: 223
4: 568
Right 965774096 3:172210079-172210101 CTGGGTCCAGAGCTGCAGCTGGG 0: 2
1: 11
2: 26
3: 110
4: 616
965774091_965774096 -2 Left 965774091 3:172210058-172210080 CCTGCGGGAGCGCAGGGATGCCT 0: 1
1: 0
2: 0
3: 24
4: 288
Right 965774096 3:172210079-172210101 CTGGGTCCAGAGCTGCAGCTGGG 0: 2
1: 11
2: 26
3: 110
4: 616

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965774096 Original CRISPR CTGGGTCCAGAGCTGCAGCT GGG Intronic
900151948 1:1182671-1182693 CTGGGGCCAGGGCTGGAGCTTGG + Intronic
900233891 1:1577438-1577460 CTGGGTCCACAGCCGTGGCTGGG - Intergenic
900376599 1:2357553-2357575 CTGTGTCCAGCCCCGCAGCTGGG - Exonic
900748539 1:4378101-4378123 CTGGCCCCAGAGCTGCATCCAGG + Intergenic
900981362 1:6047953-6047975 CTGGGAGCAGACCTGCAGGTGGG - Intronic
901041079 1:6363937-6363959 CTGGGACCACAGGTGCAGCTGGG - Intronic
901457017 1:9368786-9368808 CTGGGTCCAGAGCCCCGGCTGGG - Exonic
901492338 1:9602883-9602905 CAGCAGCCAGAGCTGCAGCTCGG - Intronic
901936498 1:12630551-12630573 CTGGGTCTGCAGCTGCAGTTTGG - Intergenic
902631174 1:17705551-17705573 CTGGGGCTAGAGCTGGGGCTGGG + Intergenic
903068590 1:20715446-20715468 GCAGGGCCAGAGCTGCAGCTGGG - Intronic
903224037 1:21884995-21885017 CTGGGCCCAGAGCCGCACCTGGG + Exonic
903373506 1:22851836-22851858 CTGTGTGCAGGGCTGCTGCTGGG - Intronic
903750281 1:25617054-25617076 CTGGGTCCGGAGCCGCGGCTGGG - Intergenic
904260189 1:29283637-29283659 CTAGGGCCAGAGGTCCAGCTAGG - Intronic
904443686 1:30550700-30550722 CTGGGTCTGCAGCTGCAACTTGG - Intergenic
904821500 1:33247715-33247737 CTGGGTCCAGATGTGCTGCGAGG + Intergenic
905017316 1:34786506-34786528 CTGGGGCTTGAGCTGGAGCTCGG + Intronic
905225407 1:36475523-36475545 CTGGGAGCAGAGCTTCAGCCCGG - Exonic
905347101 1:37318671-37318693 GCAGGTCCAGAGCTGCCGCTGGG + Intergenic
905363256 1:37434643-37434665 CTGGGACCAGAGAGGTAGCTGGG - Intergenic
905510979 1:38519848-38519870 TTGGGGCAAGAGCTGAAGCTGGG + Intergenic
906132539 1:43469163-43469185 CTGGGTCCACAGCTATAGCTTGG + Intergenic
906211673 1:44015779-44015801 CAGAGATCAGAGCTGCAGCTGGG - Intronic
906448370 1:45922691-45922713 CTGGGTCTGAAGCTGCAGCAGGG + Intronic
907369744 1:53993035-53993057 CTGGGTCCACAGCCACAGTTTGG + Intergenic
907450499 1:54542816-54542838 CTGGGTCCAGACGGCCAGCTGGG + Intronic
907538365 1:55186791-55186813 ATGGGTACAGAGTTTCAGCTGGG + Intronic
907761711 1:57367943-57367965 CTGGGTCCACAGCTGTGGTTTGG - Intronic
907985236 1:59524013-59524035 CCAGGTCCAGAGCCGCAGCTGGG - Intronic
909197665 1:72648403-72648425 CTTGGTTCACAGCTGCAGCTGGG - Intergenic
910563403 1:88617364-88617386 ATGGGTACAGAGCTTCAGTTAGG + Intergenic
910602235 1:89043956-89043978 CTGGGTGTGCAGCTGCAGCTTGG + Intergenic
911266837 1:95753389-95753411 CTGGGTCCACACCCGCAGCCAGG - Intergenic
911288768 1:96029177-96029199 CTGAGTCCACAGCCACAGCTGGG + Intergenic
911475491 1:98367548-98367570 CCAGGTCCAGAGCTGTGGCTGGG + Intergenic
912008510 1:104932568-104932590 CTGGGTCCGGAGACACAGCTGGG - Intergenic
912117029 1:106419361-106419383 GTGGGTCCAGAGGTGCCACTTGG - Intergenic
912386546 1:109273722-109273744 CTGGGCCCAGAGCTGCCTCCGGG + Intronic
912795756 1:112692654-112692676 CTAGTTCCAGAGCTTCAGGTGGG + Intronic
913504962 1:119508606-119508628 CTGGCCCCAGAGCTGATGCTTGG + Intronic
914340987 1:146760311-146760333 CTGGGTACAGAGTTTCAGTTCGG + Intergenic
914420768 1:147526713-147526735 CTGGCTCCGAAGCTCCAGCTGGG - Intergenic
915399649 1:155612873-155612895 CTGTGTCCAGGGCTGTAGCCAGG - Exonic
915416761 1:155748429-155748451 CTGTGTCCAGGGCTGTAGCCAGG - Intergenic
915594936 1:156891506-156891528 ATGGGTACAGAGTTGCAGTTTGG + Intergenic
915751212 1:158212764-158212786 CTGGGTCCACAGCTGCAGTTTGG - Intergenic
915828853 1:159106174-159106196 CTGGGTCCGGAGCTGCAGCTGGG + Intronic
918241490 1:182624127-182624149 CTGAGGCCAGAGCTGAAACTTGG + Intergenic
919263913 1:195237413-195237435 CTGGGTCCAGAGCCATAGTTGGG - Intergenic
919900248 1:202038948-202038970 ATGGGTACAGAGTTGCAGTTAGG + Intergenic
919980361 1:202639084-202639106 CTGGCTCAAGAGCAGCAGCGTGG + Intronic
920416732 1:205804002-205804024 ATAGGTACAGAGCTTCAGCTGGG + Intronic
920688100 1:208125277-208125299 CTGGGACCAGAGGAGCAGTTTGG + Intronic
920808257 1:209255493-209255515 ATGGGTACAGAGTTTCAGCTTGG - Intergenic
921674786 1:217965483-217965505 CTGGGTCTGGAGCCACAGCTGGG + Intergenic
921675116 1:217968283-217968305 CTGGGTCGGGAGCCACAGCTGGG - Intergenic
921952486 1:220945042-220945064 CTGGTTCCAGTGTTGCTGCTGGG + Intergenic
922046370 1:221949712-221949734 CAGGCTCCAGAGGTACAGCTAGG + Intergenic
922132605 1:222794890-222794912 CTGGGTCCGCAGCTGTGGCTTGG - Intergenic
922206881 1:223455817-223455839 CTGAGTCCAGTGGTGGAGCTGGG - Intergenic
922796705 1:228343089-228343111 CTGGGTCCCCAGCTCCAGCACGG - Intronic
923275402 1:232391136-232391158 GTGGGTCCAGAGTTTCAGTTTGG - Intergenic
923328050 1:232898229-232898251 CCAGGTCCACAGCTGCAGCTGGG - Intergenic
924600577 1:245485235-245485257 ATGGGTACAGAGCTTCAGTTTGG + Intronic
924942920 1:248824984-248825006 CTGGGACCAGGGCCCCAGCTTGG + Exonic
1063391472 10:5652545-5652567 CTGGGTGCAGAGCTGCTGCTTGG - Intronic
1063392784 10:5661117-5661139 CTGGGCACAGAGCTGCCACTTGG - Intronic
1063432086 10:5999670-5999692 CTGGGGCCAGAGCTGCAGGCAGG - Intergenic
1063501231 10:6556562-6556584 CTGGGTACAGAGCTTCTGCTTGG + Intronic
1064010216 10:11729757-11729779 CTGGGTCCACAGCTGTGGCTGGG - Intergenic
1064999841 10:21328475-21328497 ATGGGGGCAGAGCTTCAGCTGGG - Intergenic
1065898805 10:30187093-30187115 CTGGGTTCAGAGAAGCAGATTGG + Intergenic
1066258122 10:33701952-33701974 CTGGTCCCAGATCTGCAGATAGG - Intergenic
1066392119 10:34986015-34986037 CTGGGTCCATTGCTGGAGCTGGG - Intergenic
1067024841 10:42836080-42836102 CAGGGGCCAGAGCAGCAGCAAGG - Intergenic
1067239362 10:44477159-44477181 CCTGGTCCAGGGCTGCAGCTGGG + Intergenic
1067434413 10:46266781-46266803 CTGGCCCCAGAGCAGCAGCTGGG - Intergenic
1067569219 10:47359531-47359553 CTGTGGCCTGACCTGCAGCTAGG + Intergenic
1067581536 10:47449646-47449668 CTGGCCCCAGACCAGCAGCTGGG + Intergenic
1067808421 10:49409013-49409035 CTGGGCACAGAGAGGCAGCTGGG - Intergenic
1067839755 10:49666243-49666265 CTGGGGCTGGAGCTGGAGCTGGG - Intergenic
1067839760 10:49666261-49666283 CTGGGGCTGGAGCTGGAGCTGGG - Intergenic
1068130499 10:52889842-52889864 TTGGGTCCATAGCTGAGGCTGGG - Intergenic
1068283775 10:54909624-54909646 CCTGGCCCATAGCTGCAGCTTGG + Intronic
1069121703 10:64576523-64576545 CTGGGTCCACAGCCACAGCTGGG - Intergenic
1069212411 10:65779020-65779042 CCTGGTCCAGAGCTGCAGCTGGG - Intergenic
1069345809 10:67468535-67468557 CAGGGTACAGAGATGTAGCTTGG + Intronic
1069592859 10:69652642-69652664 CTGGGTCCACAGTCACAGCTGGG - Intergenic
1070228387 10:74536621-74536643 ATGGGTACAGAGCTTCTGCTTGG - Intronic
1070401493 10:76056805-76056827 CTGGGTCTGCAGCTGCAGCTGGG + Intronic
1070525706 10:77294217-77294239 CTGGGCCCAGAGTTGAAGCCAGG - Intronic
1072154852 10:92715055-92715077 TTGCGTCCACAGCTGCAGTTTGG + Intergenic
1072188612 10:93063428-93063450 CTGGGTCCGGGGCTGGCGCTGGG - Intronic
1073124701 10:101141995-101142017 CAGGTTCCAGCCCTGCAGCTCGG + Intergenic
1073837382 10:107460034-107460056 CTGGGTTCAGAACTACAGCCAGG + Intergenic
1074500118 10:114016120-114016142 ATGGGTACAGAGCTCCAGTTTGG + Intergenic
1074715757 10:116217128-116217150 CCAGGTCCAGACCTGCAGGTGGG + Intronic
1075587097 10:123666133-123666155 CTGGCTCCAGAGGTGCTGCTGGG + Intergenic
1075816967 10:125271862-125271884 CTGAGTGCAGAGCTTGAGCTGGG - Intergenic
1076029441 10:127145148-127145170 CTGGGTCCTGAGCCTCATCTAGG + Intronic
1076655261 10:132019557-132019579 CTGGGTCCACAGCCACAGTTTGG + Intergenic
1076728026 10:132422302-132422324 CTGGGTGCAGAGCTGCGTCGAGG + Intergenic
1077079787 11:720144-720166 CTGGGTCCAGATCTTCTCCTTGG - Exonic
1077096942 11:803062-803084 CTTGGTCCACAGCTGCCTCTTGG - Intronic
1077231579 11:1460186-1460208 CTGGGTCCTGCGCAACAGCTCGG + Intronic
1077564752 11:3290506-3290528 CTGGCTCCACAGCTGCTGCTGGG + Intergenic
1077570642 11:3336323-3336345 CTGGCTCCACAGCTGCTGCTGGG + Intergenic
1078303217 11:10156035-10156057 CCGGGTCCAGAGCTGCAGCTGGG - Intronic
1078315286 11:10289256-10289278 CTTGGTCCACAGCCCCAGCTTGG + Intronic
1078508155 11:11967087-11967109 CCGGGTGCAGAGCTGCAGACAGG + Exonic
1079017505 11:16881676-16881698 CTGACTCCAGAGCTGTAGATAGG - Intronic
1079128661 11:17735366-17735388 CTGCGTCCCGAGCTGCAGCCCGG + Exonic
1079237392 11:18700147-18700169 CTGGCTCCAGATCAGAAGCTGGG + Intronic
1080268057 11:30422287-30422309 CTGTGTTCAGAGGTGCAGGTTGG - Intronic
1080333817 11:31174074-31174096 CTGGGTCTGCAGCTGCAGCTGGG - Intronic
1080333838 11:31174164-31174186 CTGGGTCTGCAGCTGCAGCTGGG - Intronic
1080485617 11:32704181-32704203 CTGGGTTTAGAGCTGTGGCTGGG - Intronic
1080499580 11:32856963-32856985 CTGGGACCACAGGTGCACCTCGG + Exonic
1080648528 11:34204590-34204612 CAGGGTTCGGAGCTCCAGCTGGG + Exonic
1081847703 11:46252597-46252619 CTGGATCCTGAGCTGGGGCTGGG + Intergenic
1082067837 11:47915362-47915384 CTAGGTCCAGATCTGAAGCTTGG + Intergenic
1082983393 11:59144804-59144826 AAGGCTCCAGAGCTCCAGCTGGG - Exonic
1083205971 11:61149489-61149511 CTGGTGCCAGACCTGCTGCTTGG - Intronic
1083491478 11:63017509-63017531 CTGGGTCCAGCCCTGCCCCTCGG + Intergenic
1083631386 11:64097232-64097254 CTGGGTCCAGTGGGGCAGGTAGG + Intronic
1083915962 11:65744045-65744067 TGGGGTCTGGAGCTGCAGCTGGG - Intergenic
1084991044 11:72925939-72925961 TTGGATCCACAGCTGCAGATTGG - Intronic
1086085193 11:82946082-82946104 CCAGGTCCACAGCTGCAGTTTGG + Intronic
1086847808 11:91773681-91773703 CTGGGTCCAGAGATGCTGTCAGG + Intergenic
1086850029 11:91798495-91798517 CTGGGTCTGGAGCCACAGCTGGG - Intergenic
1086947159 11:92854337-92854359 CCAGGTCCAGAGCTGTGGCTGGG + Intronic
1087339017 11:96878689-96878711 TTGGGTCTGCAGCTGCAGCTTGG + Intergenic
1088377262 11:109155517-109155539 CTGGGTACAGAGTTTCAGTTTGG + Intergenic
1088651028 11:111958313-111958335 CTGGGTCCACAGCTGTGGCTTGG - Intronic
1088704397 11:112448347-112448369 CTGGATCCACAGCTGCAGCTTGG + Intergenic
1089063231 11:115643103-115643125 CTGTGTCCAGGGCTGCACTTAGG + Intergenic
1089605225 11:119637854-119637876 CAGGGTACAGAGCTGGAGGTGGG + Intronic
1090079971 11:123605656-123605678 CGGGGTCCAGAGCTGGGGCTAGG + Intronic
1090365843 11:126204800-126204822 ATGGGTCCAGAGTTTCAGTTTGG - Intronic
1090552850 11:127841753-127841775 CTGGGTCCAGTGCACCTGCTTGG - Intergenic
1092029011 12:5268407-5268429 CTGGGCCACAAGCTGCAGCTTGG + Intergenic
1092749018 12:11701248-11701270 CTGGGGACAGAGTTTCAGCTGGG - Intronic
1093139470 12:15491132-15491154 CTGAGGCCAGAGCTGCTGTTTGG - Intronic
1093493104 12:19726519-19726541 CTGGGTTCACAGCTGCTGTTTGG + Intergenic
1093493182 12:19726871-19726893 CAGGGTCCACAGCTGCAGCTTGG + Intergenic
1094010441 12:25803435-25803457 CTGGTTCCTGAGCAGGAGCTGGG - Intergenic
1094487384 12:30935791-30935813 CTGGGTCCATTGGTGCAGTTAGG + Intronic
1095261845 12:40106277-40106299 CTTGCTCCACCGCTGCAGCTCGG - Intergenic
1096431373 12:51546312-51546334 CTGATTCCAGAGCTGAAGCAGGG - Intergenic
1096646934 12:53043909-53043931 CTGGGTCCACTCCTGCAGCTGGG - Intergenic
1097536229 12:60873361-60873383 CCGGGTCTAGAGCTGTGGCTTGG + Intergenic
1098335648 12:69401949-69401971 CTAGGTTCACAGCTGCATCTGGG - Intergenic
1098790475 12:74816510-74816532 CTGGGTCCATAGCTATGGCTGGG - Intergenic
1099295239 12:80821766-80821788 CTGGGTCTGCACCTGCAGCTGGG - Intronic
1100465176 12:94837977-94837999 CTGGCTCAAGAACTGCAGCAAGG + Intergenic
1101355859 12:103977032-103977054 CTGGTTCCTGAGCAGGAGCTGGG - Exonic
1101764124 12:107682739-107682761 CTGGGTCTGCAGCTGCAGTTTGG + Intergenic
1102071084 12:110020475-110020497 GTGTGTCCAGGGCTGCTGCTAGG + Intronic
1102300726 12:111769079-111769101 CTGGGTCCAGATATGCACCCAGG + Intronic
1102529401 12:113534985-113535007 CTGAGTGCAGAGCTGCGGGTTGG + Intergenic
1103175809 12:118862235-118862257 CTGGCTCCATATCTGCAGATAGG - Intergenic
1103721281 12:122976867-122976889 CGGGGGCCAGAGCTGCATCCTGG - Exonic
1103796147 12:123504466-123504488 CTGGGTCCTGAGCTTGAGCTTGG + Intronic
1104009231 12:124917424-124917446 CGGGGTGCTGGGCTGCAGCTGGG + Intergenic
1104982692 12:132581365-132581387 CTGTGAACAGAGCTGCAGATGGG + Intronic
1105409640 13:20161069-20161091 CGGCGTCCTGAGCTGCAGCTTGG - Intergenic
1105425259 13:20289017-20289039 TTGGATCCACAGCTGCAGTTTGG - Intergenic
1105954606 13:25268833-25268855 CTGGGTCCAGAGCCATGGCTGGG - Intronic
1106340084 13:28819731-28819753 CTGGGTCTGGGGCTGGAGCTGGG + Intergenic
1106477139 13:30108512-30108534 CTGGGTCCATTTTTGCAGCTGGG + Intergenic
1106571873 13:30934755-30934777 CTGGGTCTGTAGCTGCAGTTTGG - Intronic
1106999668 13:35527755-35527777 CCAGGTCCAGAGCCACAGCTGGG + Intronic
1107744379 13:43489346-43489368 CAGGGTTTACAGCTGCAGCTGGG - Intronic
1108118699 13:47160182-47160204 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1109345776 13:61113412-61113434 CTGGGTCCAGAGCCATGGCTGGG - Intergenic
1109348371 13:61145098-61145120 CTGGGTCCACAGCCACAGCTGGG - Intergenic
1109426127 13:62168009-62168031 CTGGGTCCACAGCTGCAGTTTGG - Intergenic
1109525144 13:63566069-63566091 CTGGGTCCATAGCTGCAGCTTGG - Intergenic
1109562860 13:64075894-64075916 CTGGCTCCAGGGCTGCGGCTCGG + Intergenic
1109563399 13:64078827-64078849 CTGGGTCCCGAGCCTCGGCTGGG + Intergenic
1109982199 13:69923857-69923879 CTGGGCCCACAGCTGCAGCTTGG - Intronic
1110201041 13:72851232-72851254 CTGGGTCCGCAGCTGCGACTGGG - Intronic
1110439223 13:75508362-75508384 CTGGGTCCAGAGCCGTGGCCAGG + Intergenic
1110925456 13:81145474-81145496 CTGTCTCCAGAGTTGCAGATGGG + Intergenic
1110980251 13:81889097-81889119 CTGGGTCTGGGCCTGCAGCTGGG - Intergenic
1111347202 13:86974500-86974522 CCTGGTCCAGAGCTGCTGCTGGG - Intergenic
1111546275 13:89741213-89741235 CCGGGTACAGAGCTGCGGCTGGG - Intergenic
1112086009 13:96033537-96033559 GTTGGTCCACAGCTGCAGCTGGG - Intronic
1112733730 13:102394843-102394865 CTGGAGGCAGAGCTGCAGCGTGG + Intronic
1112971233 13:105265756-105265778 CTGGGTCCAGAGTTTCAGGCTGG + Intergenic
1113229214 13:108194606-108194628 CTGGGTCCAGAGCCATGGCTAGG - Intergenic
1113339047 13:109404413-109404435 CTGGGTCTGCAGCTGCAGTTTGG - Intergenic
1113802374 13:113093243-113093265 CCGGTTGCAGACCTGCAGCTTGG - Intronic
1114344429 14:21780719-21780741 CTGGGTCTGGAGCCACAGCTGGG - Intergenic
1114349667 14:21836083-21836105 CTCGGTCCACAGCTGCAGTTTGG + Intergenic
1114381383 14:22208156-22208178 CTGTCTCCAAACCTGCAGCTGGG + Intergenic
1114432266 14:22671586-22671608 GTGGGTCCAGAGATGCTGCCTGG - Intergenic
1114803559 14:25807020-25807042 AAGGGTCCAGAACTCCAGCTGGG - Intergenic
1115059022 14:29168383-29168405 CCTGGTCCAGAGCTGCAGCTGGG - Intergenic
1115310684 14:31975092-31975114 CTGGGTCATGGGCAGCAGCTGGG + Intergenic
1115641646 14:35339088-35339110 CTAGGTCCTGAACTGCAGCCCGG - Intergenic
1116364328 14:44040876-44040898 CTAGGTCCTGAGCTGTACCTGGG - Intergenic
1116617170 14:47154462-47154484 CCGGGTCCACTGCTGCGGCTGGG - Intronic
1117143952 14:52818076-52818098 CTGGGTATAGAGTTGCAGTTGGG - Intergenic
1118835251 14:69473363-69473385 CAGGGATCAGGGCTGCAGCTGGG - Intergenic
1118853759 14:69605536-69605558 CTGGGGGCAAAGCTGCACCTTGG + Intergenic
1119576332 14:75726067-75726089 CAGGGACCACAGCTTCAGCTGGG + Intronic
1120745365 14:88146936-88146958 CTGGATCTGCAGCTGCAGCTTGG - Intergenic
1120982508 14:90302952-90302974 CTCTGTGCAGAGCTTCAGCTTGG + Exonic
1121235311 14:92387674-92387696 ATGGGTACAGAGGTTCAGCTTGG - Intronic
1122409089 14:101516995-101517017 CTAGGCCCAGAGCCGCAGCAGGG - Intergenic
1122676980 14:103423646-103423668 CTTGGCCCAGAGCTGGAGCCTGG - Intronic
1122690146 14:103528434-103528456 CTGAGTGCAGAGCTGCTTCTAGG - Intergenic
1123425475 15:20167536-20167558 CAGGGGCCAGAGCAGCAGCGAGG - Intergenic
1123491647 15:20786047-20786069 CTGGGTACAGGGCAGCAGCCAGG - Intergenic
1123534697 15:21174054-21174076 CAGGGGCCAGAGCAGCAGCGAGG - Intergenic
1123548150 15:21355141-21355163 CTGGGTACAGGGCAGCAGCCAGG - Intergenic
1124159049 15:27252693-27252715 CTGGGGTCAGACCTGCAGGTGGG - Intronic
1124339105 15:28878471-28878493 CTGGGGCCAGTGCTGCAGAGGGG - Intergenic
1124496059 15:30187886-30187908 CTGGCTCAAGAGCAGCAGCGTGG + Intergenic
1124747515 15:32350761-32350783 CTGGCTCAAGAGCAGCAGCGTGG - Intergenic
1124853219 15:33361121-33361143 CTGGATCCAGGTCAGCAGCTGGG + Intronic
1125435899 15:39645386-39645408 CTGGGTCTGTAGCTGCAGTTTGG - Intronic
1125718006 15:41830630-41830652 CTGGGTCCACAGCTGCAGCTTGG - Intronic
1125854764 15:42938314-42938336 CTGTGCCCTGAGCTGCAGCCAGG - Intergenic
1126215119 15:46145965-46145987 CTGGGTCTACAGCTGCAGCTGGG - Intergenic
1126354076 15:47776202-47776224 CTGGTTCCAGACCAGCACCTGGG - Intergenic
1126850891 15:52796150-52796172 CAAGGTCCAGGGGTGCAGCTAGG + Intergenic
1127447938 15:59084719-59084741 ATGGGTACAAAGCTTCAGCTGGG - Intronic
1127910642 15:63413294-63413316 CTGGGTCCAGAGATGTCGCTAGG - Intergenic
1128636668 15:69306803-69306825 CTGGGTACAGAGTTTCATCTGGG - Intronic
1128847769 15:70916868-70916890 CTGGGTCCACAGCTGCAGTTTGG - Intronic
1128944843 15:71813165-71813187 TTCCATCCAGAGCTGCAGCTGGG - Intronic
1128965170 15:72051492-72051514 CTGGGTCTGCAGCTGCAGCTTGG - Intronic
1129377851 15:75145406-75145428 CTGGGTCCACAGCTGTGACTTGG + Intergenic
1129468345 15:75736852-75736874 CTGGGTACAGAGCTGCAGTGTGG - Intergenic
1129727229 15:77907648-77907670 CTGGGTACAGAGCTGCAGTGTGG + Intergenic
1129752481 15:78076082-78076104 CTGGGCCCAGGCCTGGAGCTGGG - Intronic
1129891511 15:79074829-79074851 ATGGGCCCAGAGCTCCACCTGGG + Intronic
1130183062 15:81651324-81651346 CTGGGTCCACAGCCACAGTTTGG - Intergenic
1130270423 15:82443402-82443424 CTGGGTAAAGAGCTGCAGTGTGG - Intergenic
1130275545 15:82474429-82474451 CTGGGTAAAGAGCTGCAGTGTGG + Intergenic
1130462768 15:84170721-84170743 CTGGGTAAAGAGCTGCAGTGTGG - Intergenic
1130467905 15:84201824-84201846 CTGGGTAAAGAGCTGCAGTGTGG + Intergenic
1130485782 15:84397686-84397708 CTGGGTAAAGAGCTGCAGTGTGG - Intergenic
1130489909 15:84424066-84424088 CTGGGTAAAGAGCTGCAGTGTGG + Intergenic
1130496361 15:84471718-84471740 CTGGGTAAAGAGCTGCAGTGTGG - Intergenic
1130501497 15:84502816-84502838 CTGGGTAAAGAGCTGCAGTGTGG + Intergenic
1130535773 15:84784056-84784078 CGGGGCCCAGAACTGCAGCTGGG - Exonic
1130590197 15:85206422-85206444 CTGGGTAAAGAGCTGCAGTGTGG + Intergenic
1202956481 15_KI270727v1_random:82371-82393 CTGGGTACAGGGCAGCAGCCAGG - Intergenic
1132897474 16:2235942-2235964 CTGGGGGCACAGCTCCAGCTGGG - Exonic
1132995531 16:2820567-2820589 CTGAGGCCAGGGCTGCAGCCAGG + Intronic
1133234172 16:4380167-4380189 CTGGTGACAGAGCTGGAGCTGGG - Intronic
1133319146 16:4902363-4902385 CTGGCTCCAGGGTTTCAGCTGGG - Intronic
1133409737 16:5558331-5558353 CTGCCTCCACAGCTGCATCTAGG - Intergenic
1133607836 16:7405665-7405687 CTGGGACCTGAGTTGCAGCCTGG - Intronic
1133636069 16:7666879-7666901 CTGGGTGCAGCGGTGCAGCTCGG + Intronic
1133972201 16:10576571-10576593 CTGGGTCCAGAGCTGAGGGAGGG - Intronic
1134078513 16:11308886-11308908 CTGGGTCCACAGCTGCAATTTGG + Intronic
1135057254 16:19241387-19241409 CTGGGTCTGCAGCTGTAGCTAGG + Intronic
1136278167 16:29191718-29191740 CTGGGTCCAGGGCTCCAGGTGGG + Intergenic
1137334446 16:47533853-47533875 CTGGGTCCACAGCCACAACTTGG + Intronic
1137343791 16:47636450-47636472 CTGGGTCTGGAGCTGCGGCTGGG - Intronic
1137698574 16:50478995-50479017 CTGGGTCTGCAGCTGCAGTTTGG + Intergenic
1138028032 16:53538388-53538410 ATGGGTCCAGAGTTTCAGTTTGG + Intergenic
1138180581 16:54937931-54937953 CGGGGTCCAGAGTTGGAGCGTGG - Intergenic
1138385581 16:56633661-56633683 CTGGGTTCTGAGCTCCAGCCAGG + Intronic
1138446332 16:57066545-57066567 CTGGACACAGAGCTGCTGCTGGG - Exonic
1138598963 16:58043916-58043938 CTGCGTCCGGAGCTGGAGCTTGG + Intronic
1138878241 16:60979232-60979254 CTGGGTCCCCAGCTGCAGTTTGG - Intergenic
1139183004 16:64770184-64770206 CTGGGTCCACAGCCACAACTGGG - Intergenic
1139183024 16:64770275-64770297 CTGGGTCCACAGGTGCAGTTTGG - Intergenic
1139268546 16:65661452-65661474 CTAGGTCCAGAGCTGGAGTTTGG + Intergenic
1139463737 16:67142716-67142738 CAGGGTCTGGAGCTGCAGCTGGG + Intronic
1139492093 16:67291628-67291650 CTGGCTCCAGAGCCTCACCTTGG + Exonic
1139625960 16:68188367-68188389 CCGGGTCAGCAGCTGCAGCTGGG + Intronic
1139719500 16:68841199-68841221 CTGGGTCTAGAACTGCAGATGGG - Intergenic
1140465110 16:75175101-75175123 GTGGGACCAGACCTGAAGCTTGG - Intergenic
1140627212 16:76808535-76808557 GTGGGTACAGAGTTTCAGCTTGG - Intergenic
1140956993 16:79875121-79875143 CTGGCCCCAGAGTTGCTGCTTGG + Intergenic
1141846578 16:86613356-86613378 CTGGGGCCAGGGGTGCACCTGGG + Intergenic
1142082544 16:88157758-88157780 CTGGGTCCAGGGCTCCAGGTGGG + Intergenic
1142940785 17:3378496-3378518 TTGGGTCCAGAGCCACGGCTGGG + Intergenic
1143323169 17:6080958-6080980 CTGGCTCCGGAGCCGCAACTCGG + Exonic
1143371755 17:6444761-6444783 CTGGGCCCAGCGCTGAAGCTCGG + Intronic
1143517098 17:7425372-7425394 CTGGTTCCTGAGCTGAAGATAGG - Intergenic
1143840091 17:9725102-9725124 CTGGCTCCAGAGCTGCGGTGTGG + Intronic
1144495882 17:15744501-15744523 CAGTGGCCAGAGCTGCAGCCTGG - Intronic
1144776177 17:17785783-17785805 CTGGTCCCAGAGCTTCTGCTGGG + Intronic
1145209001 17:20999463-20999485 CAGTGGCCAGAGCTGCAGCCTGG - Intergenic
1146075114 17:29721395-29721417 CTGGGTCCTGAGTTGCCACTGGG - Intronic
1146359061 17:32159486-32159508 CTGGGTCCACAGCCACGGCTGGG - Intronic
1146375014 17:32288005-32288027 CTGGCTGCAGAGCTCCACCTGGG - Intronic
1147412880 17:40266403-40266425 CTGTGCCCAGTGCTGCAGATGGG + Intronic
1147712322 17:42477914-42477936 CTGGGTCCATAAGTGAAGCTGGG + Intronic
1148125600 17:45234938-45234960 CTGGGTTCAGTGCTGTGGCTGGG + Intronic
1149169364 17:53791780-53791802 CTGGGTCTGGAGCTGCAGCTGGG - Intergenic
1149362596 17:55910978-55911000 CTGGGTCTGCAGCTGCACCTGGG + Intergenic
1149570658 17:57670011-57670033 CTGGGTCTAGGGCTGGAACTTGG + Intronic
1149639228 17:58192469-58192491 CAGGGCCCAGAGCAGCACCTGGG - Intergenic
1150226931 17:63529389-63529411 CTAGGCCCAGAGCAGCAGCCTGG + Intronic
1150597917 17:66623408-66623430 ATGGGTGGAAAGCTGCAGCTTGG + Intronic
1150663853 17:67111530-67111552 CTTGTTCCTGAGTTGCAGCTGGG + Intronic
1151677008 17:75603761-75603783 CTGGGAACAGAGCTGCCTCTGGG - Intergenic
1151771622 17:76166383-76166405 CTGGGGCCACAGCTGCTGCCAGG + Intronic
1152092893 17:78256850-78256872 CTGGCTCCAGACCTTCTGCTGGG + Intergenic
1152530209 17:80914298-80914320 CTGGATCCAGAGTTGTGGCTGGG - Intronic
1153608057 18:6854766-6854788 CCGGGTCCAGAGCTGCAGGTGGG - Intronic
1153797668 18:8639937-8639959 CTGGGTGCAGAGTTTCAGCTGGG + Intergenic
1153883474 18:9440762-9440784 ATGGGTGCAGAGTTTCAGCTGGG + Intergenic
1154173184 18:12065611-12065633 CTGGGGCCAGATGTGCAGCAGGG - Intergenic
1154449230 18:14460737-14460759 CTGGGTACAGGGCAGCAGCCAGG - Intergenic
1155150000 18:23115685-23115707 ATGGGTACAGAGTTTCAGCTGGG - Intergenic
1156317873 18:35987799-35987821 CAGGGTCCAGAGTTTCAGCTGGG + Intronic
1156354863 18:36332239-36332261 CTGGGGCCACAGCTGCTGCAGGG - Intronic
1156480350 18:37432341-37432363 CTGGGCCCAGAGGGGGAGCTTGG + Intronic
1156531042 18:37815243-37815265 CTGTGTCCAGTGCTGCTGATGGG + Intergenic
1157799058 18:50603594-50603616 CTGAGTCCACAGCTGCAGAATGG + Intronic
1158497584 18:57970402-57970424 CTGGTTCATGAGCTTCAGCTGGG - Intergenic
1158773696 18:60552679-60552701 CTGGGTCTGCAGCTGCAGTTTGG - Intergenic
1158774020 18:60555292-60555314 CCAGGTCTGGAGCTGCAGCTGGG - Intergenic
1158876254 18:61737207-61737229 GTGGGTTCAGAGTTTCAGCTGGG + Intergenic
1159019699 18:63133151-63133173 CTGGTTCCAAACCTGCAGCAAGG - Intronic
1159186595 18:64983695-64983717 TTGGATCCACAGCTGCAGTTGGG - Intergenic
1160837609 19:1132108-1132130 CTGCAGCCACAGCTGCAGCTGGG + Intronic
1160957651 19:1700753-1700775 CTGGGGCCAGAGGTGCAGACGGG + Intergenic
1160986863 19:1843160-1843182 CCGGGCCCAGAGCCGCAGCTGGG + Intronic
1160986884 19:1843220-1843242 CCGGGCCCAGAGCCGCAGCTGGG + Intronic
1160986906 19:1843281-1843303 CAGGGCCCAGAGCCACAGCTGGG + Intronic
1162384597 19:10353540-10353562 CTGGGCGAAGAGCAGCAGCTGGG + Exonic
1162798716 19:13099516-13099538 CTGCGGCCAGAGCTGCGGCTTGG + Exonic
1162889678 19:13723446-13723468 ATGGGTACAGAGTTTCAGCTTGG + Intergenic
1163145824 19:15379050-15379072 CCGGGTACAGAGCTGGAGCCCGG + Intronic
1164393446 19:27844735-27844757 CTGGGTAGATAGCTGCTGCTAGG + Intergenic
1164619710 19:29687349-29687371 CTGGGGCCAGAGGCGCAGCCAGG + Intergenic
1164906471 19:31972532-31972554 CTGGGTGCAGATGTGCACCTAGG - Intergenic
1164984344 19:32637689-32637711 CTGGATCCAGAGCTGCGGCTGGG - Intronic
1165007531 19:32818822-32818844 CTGGGTCTGCAGCTGCACCTGGG - Intronic
1165095742 19:33409051-33409073 CTGCCTCTACAGCTGCAGCTGGG + Intronic
1165215135 19:34265600-34265622 TTGGGCCCAGAGCTGCAGGAAGG + Intronic
1166042573 19:40212782-40212804 CTGGGTCCAGAGAAGCCACTTGG - Intronic
1167777916 19:51573369-51573391 CTGGGTCCAGAGAAGCAGGATGG + Exonic
1168593121 19:57652987-57653009 CTGGGTTATGAGCTGCATCTTGG - Intergenic
1168640074 19:58025213-58025235 CTGGGCCCAGACGTGTAGCTGGG + Intergenic
925647963 2:6056427-6056449 CTGGCTCCAGAGCTGCCCCTGGG + Intergenic
925918188 2:8622394-8622416 CGTGGGCCAGAGGTGCAGCTGGG + Intergenic
926099866 2:10107822-10107844 ATGGGTCCAGAGTTTCAGTTTGG + Intergenic
926118045 2:10225631-10225653 CTGGCTCAGGTGCTGCAGCTGGG - Intergenic
926157157 2:10462666-10462688 CTGTGTGCAGAGCTGGGGCTGGG - Intergenic
926476950 2:13335624-13335646 CTGGGTACTGAGCTCCAGGTAGG - Intergenic
926547116 2:14255541-14255563 CCGGGTCCAGAGCTGTAGCTGGG + Intergenic
927940745 2:27101502-27101524 CTGGGCCCAGAGGGGAAGCTGGG - Exonic
928312238 2:30220602-30220624 CTGGTTCCATACCCGCAGCTGGG - Intergenic
928444038 2:31317400-31317422 CCAGGTCCAGAGATGCAGCGTGG - Intergenic
928904378 2:36355487-36355509 CCGGGGCCAGAGCCGCAGCTCGG + Intergenic
929102077 2:38324906-38324928 ATGGGCACAGAGCTTCAGCTGGG + Intronic
929847253 2:45542386-45542408 CCAGGTCCAGAGCTGTAGCTGGG + Intronic
930033319 2:47071099-47071121 CTGAGCCCAGCGCTGCACCTAGG - Intronic
930957161 2:57217053-57217075 CCAGGTCCACAGCTGTAGCTTGG - Intergenic
930996050 2:57719751-57719773 ATGGGTACAGAGTTTCAGCTTGG + Intergenic
932578506 2:72977136-72977158 CTGGGTCCAGACGTGATGCTTGG + Intronic
932818759 2:74881963-74881985 CTGGACCCAGGGCTGCAGCCTGG + Intronic
934044870 2:88164683-88164705 CTGGGACCAGTTCTGCTGCTGGG + Intergenic
935518871 2:104078837-104078859 CTGGGTCCACAGCCGCAACTTGG + Intergenic
935591867 2:104852478-104852500 CTGCGTCCTGGGCTGCCGCTCGG + Intergenic
935667457 2:105525216-105525238 CCAGGTCCAGAGCTGCAGCTGGG - Intergenic
935730975 2:106065085-106065107 CTGGGTTCAGAGCTGCAGTCCGG - Intronic
935839570 2:107094573-107094595 CTAGGGCCAGAGCAGCTGCTCGG + Intergenic
936030448 2:109066622-109066644 CTGGGTCTAGAAAGGCAGCTGGG - Intergenic
937737708 2:125312575-125312597 CTGGGTCTAGAGCTGTGGCTGGG - Intergenic
937749421 2:125456741-125456763 CTGTGACCATAGCTGCAGCCTGG - Intergenic
938180756 2:129179642-129179664 CTGGATCCACAGCCGCAGTTTGG + Intergenic
939085060 2:137708542-137708564 CTGGATCCAGAGCTGTGACTGGG + Intergenic
940398817 2:153222899-153222921 CTGGGTCCAGAGAGGCGGCTGGG + Intergenic
940422929 2:153499876-153499898 CTGGGTGCACAGCTGCGGCTGGG + Intergenic
940612332 2:156006934-156006956 CTGGGTCCACAGCCCCAGCTTGG + Intergenic
940694383 2:156959920-156959942 CTTGGTCTGCAGCTGCAGCTTGG + Intergenic
941043515 2:160648643-160648665 CTGGGTCCCCAGCAGCAACTTGG - Intergenic
941158055 2:162002741-162002763 TGGGGTCCAGAGGGGCAGCTGGG + Intronic
941432235 2:165426819-165426841 CCGGGTCCAAAGCCACAGCTGGG - Intergenic
941998773 2:171626449-171626471 CTGGGTCTGGAGCTGTAGCTGGG - Intergenic
942446183 2:176080378-176080400 CAGGGTGCAGAGCCGCCGCTGGG + Exonic
942450343 2:176105081-176105103 CTGGGTCCTGAGCTACCGCAGGG + Intronic
942585189 2:177466935-177466957 CTGGATCCAGAGCCACAGCTGGG + Intronic
942682540 2:178492777-178492799 GTGGGTACAGACCTTCAGCTGGG + Intronic
942915074 2:181295046-181295068 CTGGGTCCAGAGGTGCTCTTTGG - Intergenic
942930463 2:181486432-181486454 CTGGCTGCAGAGCTGGAGCAGGG + Intronic
943191256 2:184681811-184681833 CTGGGTCCAGAGCCACATCTGGG - Intronic
943191773 2:184686187-184686209 CTGGGTCCAGAGCCAAAGTTAGG + Intronic
943223878 2:185144482-185144504 CTGGATCCAGAGCCACAGCTAGG - Intergenic
943226418 2:185184973-185184995 CTGGGTCCAGAGCTGCAACTGGG - Intergenic
943308276 2:186294526-186294548 CTAGATCCAGAGCTACAGCATGG + Intergenic
943526174 2:189020466-189020488 CTGGGTCTGCAGCTGCAGTTTGG - Intergenic
943950585 2:194129154-194129176 CTGGGTCCTCAGCTGTGGCTGGG + Intergenic
944131712 2:196354120-196354142 GTGGCTCCAGAGCTGGGGCTTGG - Intronic
944483717 2:200182061-200182083 CTGGGTCTACAGCTGCAGTTTGG - Intergenic
945721193 2:213421113-213421135 CCAGGTCCAGAGCTGCAGCTGGG - Intronic
945723292 2:213445923-213445945 CTGGAACCAGGTCTGCAGCTTGG - Intronic
945754389 2:213829142-213829164 CTGGGTCCAGAGTTGCTGTCTGG + Intronic
946946249 2:224825844-224825866 CATGGTCCAGCTCTGCAGCTTGG - Intronic
947140613 2:227016551-227016573 CTGGCTCCAAAGCTGAAGCAGGG + Intronic
947717915 2:232351153-232351175 CGGGTTCCAGAGCTGCAGCCCGG + Intergenic
947724179 2:232387314-232387336 CCGCTTCCAGAGCTGCAGCCCGG + Intergenic
948282673 2:236760084-236760106 CTGGGGCTACAGCTGGAGCTGGG - Intergenic
948712894 2:239836295-239836317 CTGGGTCCACAGCCACAACTTGG - Intergenic
948795832 2:240401713-240401735 CTGGGCCCAGAACTGCCTCTGGG - Intergenic
948845426 2:240680668-240680690 CTGGGTCAGGGGCAGCAGCTTGG + Intronic
948845819 2:240682378-240682400 CATGGCCCAGAGCTGCAGCTCGG - Exonic
948848038 2:240692352-240692374 CATGGCCCAGAGCTGCAGCTCGG + Exonic
948848435 2:240694211-240694233 CTGGGTCAGGGGCAGCAGCTTGG - Intronic
948877425 2:240837095-240837117 CTGTGTCTGGAGCTGCAGCATGG + Intergenic
1169014346 20:2279613-2279635 CTGGGCCTACAGCTGCAGCATGG - Intergenic
1170221447 20:13946686-13946708 CTGGGTCTGCAGCCGCAGCTGGG - Intronic
1170315050 20:15032224-15032246 CTGGGTCCGGAGCTGTGGCTGGG + Intronic
1170613819 20:17933892-17933914 CTGTGTGCATAGCTGCAGCCAGG + Intergenic
1170802269 20:19600193-19600215 CAGGGTCTGGAGCTGGAGCTGGG - Intronic
1171285907 20:23937990-23938012 CCAGGTCTGGAGCTGCAGCTGGG - Intergenic
1172070207 20:32251196-32251218 ATGGGTCCAGAGTTTCAGTTTGG - Intergenic
1172698692 20:36839469-36839491 CTGGGCCCACAGTAGCAGCTAGG + Intronic
1173415802 20:42854769-42854791 CTCTGCCCAGAGCAGCAGCTGGG + Intronic
1173524591 20:43721913-43721935 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1173885170 20:46451139-46451161 CTGGGTCCAGGGCTGGAGAGTGG + Intergenic
1174176589 20:48649350-48649372 CTTGGTGAAGAGCTGCAGGTAGG + Exonic
1174283220 20:49454212-49454234 CTGGGGTCAGGGCTGCAGCCAGG - Intronic
1175525090 20:59628317-59628339 CGGGAGCCAGGGCTGCAGCTGGG - Intronic
1175916372 20:62427844-62427866 CTGGGTCGGGGGCTGCAGGTGGG + Intergenic
1176183900 20:63767562-63767584 CCGGGTCCCGGGCTCCAGCTGGG - Intronic
1176446978 21:6829795-6829817 CTGGGTACAGGGCAGCAGCCAGG + Intergenic
1176825149 21:13694821-13694843 CTGGGTACAGGGCAGCAGCCAGG + Intergenic
1177404229 21:20645409-20645431 CTGGGTCTGCAGCTGCAGCTGGG - Intergenic
1177849149 21:26325681-26325703 CTGGGACGAGAGGGGCAGCTTGG + Intergenic
1178719929 21:34999156-34999178 CTGGACCCAGAGCCGGAGCTTGG + Intronic
1178915641 21:36704429-36704451 CTGGATCCCCAGCTGCAGCCTGG - Intronic
1178937315 21:36874828-36874850 CTGGGTCCAGAGCCGTGGCTGGG - Intronic
1179022934 21:37656407-37656429 CTGGGTCTGCAGCTGCAGCCCGG - Intronic
1179376470 21:40854039-40854061 CTGGGGGGAGAGCTGCAGATGGG + Intergenic
1179407259 21:41136390-41136412 CTGGGTCTGGAGCTGTGGCTGGG - Intergenic
1179941447 21:44641061-44641083 CTGCATCCAGAGCTGATGCTGGG - Intronic
1180172514 21:46067132-46067154 CTGGGGCCACGGCCGCAGCTGGG + Intergenic
1181439873 22:22930270-22930292 CTGGGTCCCGAGCTGAGGCTGGG - Intergenic
1181479107 22:23186511-23186533 CTGGGTACAGAGCTTCAGTCGGG - Intronic
1181693656 22:24581954-24581976 CTGGGTTGATAGCAGCAGCTAGG + Intronic
1182226118 22:28800256-28800278 CTGGGGCCAGATCTGAAGCCGGG - Intronic
1183025061 22:35058676-35058698 CTGGGTCCACAGCCGCAGTTTGG + Intergenic
1183316757 22:37141313-37141335 CTGGGTCCACAGCCACAACTTGG - Intronic
1183459547 22:37941568-37941590 CAGGGACCAGAACTGCAGCCTGG - Exonic
1184130036 22:42512227-42512249 CCAGGCCCAGAGCTACAGCTGGG - Exonic
1184140215 22:42574045-42574067 CCAGGCCCAGAGCTACAGCTGGG - Exonic
1184406138 22:44301938-44301960 ATGGGTGCAGAGTTGCAGTTTGG + Intronic
1184457547 22:44620324-44620346 GAGGGTCCAGCGCTGCGGCTGGG + Intergenic
1184473894 22:44710520-44710542 CAGGGCCCAGAGGGGCAGCTGGG + Intronic
1184561050 22:45263094-45263116 CTGGGTCCACAGCCGTGGCTTGG + Intergenic
1184828839 22:46971298-46971320 CTGAGTGCACAGATGCAGCTGGG - Intronic
1185091897 22:48780279-48780301 CTGAGTCCTGAGCTGAAACTGGG + Intronic
949448456 3:4161411-4161433 GTGGGTCCAGAGATGCAGTCTGG + Intronic
949930850 3:9077330-9077352 GTGGGCCCAGAGCTGCAGTAGGG - Intronic
950036475 3:9889651-9889673 ATGGGTACAGAGCTTCAGTTCGG - Intergenic
950106080 3:10389626-10389648 ATGGGTGCAGAGCTTCAGTTTGG + Intronic
950649835 3:14400532-14400554 GTGTGTTCAGAGCTGCAACTTGG - Intergenic
951210201 3:19966160-19966182 GTGGGTGCAGAGTTTCAGCTAGG - Intronic
951262542 3:20527615-20527637 CTGGCTCAAGAGCAGCACCTGGG + Intergenic
952793237 3:37217186-37217208 CTGGGTCTGCAGCTGCAGTTTGG - Intergenic
953801937 3:46031237-46031259 CTGGATCCATAGCTACAGCAGGG - Intergenic
954286987 3:49626096-49626118 CTGGGTCCACAGCCCCAGCCTGG + Intronic
954651023 3:52162697-52162719 CTGGGTCTGCAGCTGCAGTTTGG + Intergenic
954741357 3:52753361-52753383 CTGTGGCCAGAGATGCCGCTGGG + Intronic
955059241 3:55482158-55482180 CTGGCTTCCGAGCCGCAGCTGGG + Intronic
955082443 3:55670536-55670558 CTGACTCCAGAGCTGCAGGGCGG - Intronic
955111996 3:55958878-55958900 ATGGGCCCAGAGCCACAGCTGGG + Intronic
956060319 3:65342191-65342213 CTGTGTCCAGGGCTGCAGAAAGG + Intergenic
958019752 3:87980957-87980979 CCAGGTCCACAGCTGTAGCTGGG + Intergenic
958161318 3:89819136-89819158 CTGGGTCCAGAGCCACTGCTGGG + Intergenic
958498500 3:94875274-94875296 CCGGGTCCACAGCCCCAGCTGGG + Intergenic
958595198 3:96213579-96213601 GTGGGTTGAGAGATGCAGCTTGG - Intergenic
959079675 3:101786901-101786923 ATGGGTAAAGAGCTGCAGTTTGG - Intronic
960690460 3:120341794-120341816 CTGGGTCTGCAGCTGCAGGTTGG - Intronic
961195828 3:125000640-125000662 CTGGGATAAGAGCTGGAGCTTGG - Intronic
961311282 3:126003734-126003756 CTGGGTCCAGAGCCACGGCTGGG - Intergenic
961357112 3:126346189-126346211 CTGTGTGCCCAGCTGCAGCTGGG - Intronic
961402923 3:126659736-126659758 CAGCCTCCAGAGCAGCAGCTGGG - Intergenic
961440371 3:126949282-126949304 CTGGGTCCAGGGCCGCCACTGGG - Intronic
961561556 3:127733863-127733885 CTGGGTGCGCAGCTGCACCTGGG + Intronic
962068336 3:132007347-132007369 CTGACTCCAGAGTTGCTGCTTGG - Intronic
962105343 3:132383366-132383388 CTGGGTCCACAGCTGTGGTTTGG + Intergenic
962369152 3:134806386-134806408 CTGGGACTTGAGCTGGAGCTGGG - Intronic
964010675 3:151887875-151887897 CTGGGTCTGAAGCTGGAGCTGGG + Intergenic
964011582 3:151898496-151898518 CTGGGTCTGAAGCTGGAGCTGGG - Intergenic
964179472 3:153865857-153865879 CTGGGTCCAGAGATGCTGTTGGG - Intergenic
964590822 3:158360824-158360846 CTGGGTCCACAGCCCCAACTTGG + Intronic
965261236 3:166489172-166489194 CTGGGTCCACAGCCACAACTTGG - Intergenic
965272633 3:166638449-166638471 CTAGGTTCACAGATGCAGCTTGG - Intergenic
965774096 3:172210079-172210101 CTGGGTCCAGAGCTGCAGCTGGG + Intronic
965793208 3:172411401-172411423 CTGGATCCACAGCCACAGCTTGG + Intergenic
966298749 3:178454962-178454984 CTGGGTCTCTTGCTGCAGCTGGG + Intronic
966875928 3:184321679-184321701 CTGGTTCCAGATCTTCAGATGGG - Exonic
967102101 3:186223969-186223991 CTGGGGCCACACCTACAGCTGGG - Intronic
967648262 3:191952817-191952839 CAAGGTCCAGAGCAGCAGCGCGG + Intergenic
968729840 4:2264525-2264547 CTGAGGGCTGAGCTGCAGCTAGG + Intergenic
969136472 4:5033253-5033275 CGGCGTCCACAGCTGCAGCACGG + Intergenic
969180439 4:5436554-5436576 CTGGGTCCAGAGGCCCAGCTGGG + Intronic
969659139 4:8516191-8516213 CTGGGGCCATAGCAGCAGATGGG - Intergenic
970230513 4:13905797-13905819 CTTGGCCCAAAGCTGCAGATGGG + Intergenic
971350277 4:25849555-25849577 ATGGGTCCAGAGTTTCAGTTTGG + Intronic
971386073 4:26141412-26141434 CTGGGGCCTGTGCTGCAGCCTGG - Intergenic
971434290 4:26603926-26603948 ATGGGTACAGAGTTTCAGCTTGG - Intronic
971985769 4:33821645-33821667 ATGGGTACAGAGCTTCAGTTTGG - Intergenic
972128493 4:35800945-35800967 CTAAGTCCACAGCTGCAGTTTGG - Intergenic
972285763 4:37646464-37646486 AAGTGTCCAGAGCTTCAGCTTGG + Intronic
972532959 4:39977283-39977305 CGGGGGCCAGAGAAGCAGCTGGG - Intronic
972544436 4:40066829-40066851 CTGGGTACAGAGTTTCAGTTTGG - Intronic
972645733 4:40966495-40966517 CTGGGTCCACATTAGCAGCTGGG - Intronic
974179054 4:58360894-58360916 CCGGGTCCACAGCCACAGCTGGG + Intergenic
974432467 4:61816830-61816852 CTGGGTCCAGAGCTGCTACTAGG - Intronic
975514949 4:75236727-75236749 CTGCTTCCAGAGCTGGAGCAAGG + Intergenic
976728994 4:88244127-88244149 CTGGGTCCAGAGCCATGGCTGGG - Intergenic
976879651 4:89904402-89904424 ATGGGTACAGAGCTTCAGTTTGG - Intronic
976921556 4:90449822-90449844 CAGGGTCCACAGCCACAGCTGGG + Intronic
978477892 4:109152906-109152928 ATGGGTACAGAGATTCAGCTGGG + Intronic
979448306 4:120840069-120840091 CTGGGTCCACAGCGCCAACTTGG + Intronic
980405076 4:132344924-132344946 CTGGGGCCGGGGCTGCGGCTGGG + Intergenic
980450045 4:132958822-132958844 CTAGGTCCACAGCTGCAACTTGG - Intergenic
980731035 4:136824304-136824326 CTGGGTCAACAGCCCCAGCTTGG + Intergenic
980750196 4:137077506-137077528 CTGGATCCACAGCTGCAGTTTGG + Intergenic
982901139 4:161003787-161003809 CTAGGTCCAGAGCCGTCGCTGGG + Intergenic
982957600 4:161792019-161792041 CTGGGTCCACAGCTGCAGCTGGG - Intronic
983491788 4:168398080-168398102 CTGGGTCCACAGTTGCAGCTTGG - Intronic
984325086 4:178241603-178241625 CTGGGTCCACAGCTGCGGCTTGG - Intergenic
984915281 4:184718135-184718157 CTGGATCCACTGCAGCAGCTGGG + Intronic
985107791 4:186515738-186515760 ATGGGTACAGAGTTTCAGCTGGG + Intronic
985203536 4:187507822-187507844 CTGGATCTAGAACTGAAGCTTGG - Intergenic
985471250 5:48253-48275 GTGGGTCCACAGGTGCTGCTGGG + Intergenic
985664827 5:1176684-1176706 CTGGGGCCAGAGCCGGGGCTGGG - Intergenic
987003778 5:13688558-13688580 CTGTGTCCTGAGCTGTACCTTGG - Intergenic
987051319 5:14148876-14148898 CTGGGTCCCCAGCTGGAGCAAGG + Intronic
987662735 5:20898245-20898267 CTGGCTACAGAGTTCCAGCTTGG + Intergenic
987816089 5:22902140-22902162 CTGGGTCCAGAGCTGCAGCTGGG + Intergenic
987999365 5:25330169-25330191 ATGGGCCCAGATCTGCATCTTGG - Intergenic
988109942 5:26807445-26807467 CTAGGTCCAGAGCCGCAGCTGGG - Intergenic
988346273 5:30041837-30041859 CTGGGTCCACAGCCGCGGCTGGG - Intergenic
988759957 5:34303949-34303971 CTGGCTACAGAGTTCCAGCTTGG - Intergenic
988940302 5:36139080-36139102 CTGGGTCCACAGCCACAGCTGGG - Intronic
989730560 5:44642293-44642315 CCAGATCTAGAGCTGCAGCTGGG + Intergenic
992139332 5:73780209-73780231 ATGGGCCCTGAGCTGCAGGTTGG - Intronic
992222603 5:74587571-74587593 CTGGGCCCAGAGGCGCTGCTTGG - Intergenic
992839020 5:80668721-80668743 CCGGGTCCACAGCCACAGCTTGG + Intronic
994247033 5:97489502-97489524 CGGGGTCCAGAGCTGTGGCTGGG + Intergenic
994517873 5:100793845-100793867 CCGGGTCCAGAGTTGCCTCTGGG - Intergenic
994692475 5:103035129-103035151 CTAGGTCCACAGCTACGGCTGGG + Intergenic
994725814 5:103434248-103434270 CTGGGTCTGCAGCTACAGCTTGG - Intergenic
994790947 5:104224470-104224492 TTGGATCCATAGCTGCAGTTTGG + Intergenic
995145919 5:108787084-108787106 CTGGGCCCCAAGCTGCAGCTGGG - Intronic
995926926 5:117386003-117386025 CAAGGTCCAGAGCTGTGGCTGGG - Intergenic
997153769 5:131528873-131528895 CTGTGTCAAGTGCTGCAGATAGG + Intronic
997399542 5:133591695-133591717 TGGGGCCCAGAGCTGCAGCAAGG + Intronic
997571970 5:134936452-134936474 CTGGGTACAGAGCAGCAGATTGG + Intronic
997589239 5:135062803-135062825 CTGTGTCCCAAGCTGCAGCTAGG - Intronic
998040215 5:138946796-138946818 CAAGGTACAGAGCTGCTGCTTGG + Exonic
998406693 5:141878304-141878326 CTGGGGCTGGAGCTGCAGTTCGG + Exonic
998792186 5:145777694-145777716 CTGGGTCTGCAGCTGCAGTTTGG - Intronic
999454911 5:151707205-151707227 CTGGGTGCTGGGATGCAGCTGGG + Intergenic
999799577 5:155020123-155020145 CTGGGTCTGCAGCTGCAGGTTGG + Intergenic
1001940989 5:175739269-175739291 CTGGGTCCATGCCTGGAGCTGGG - Intergenic
1001981796 5:176043356-176043378 CTGGGACCAGATGTCCAGCTGGG + Intergenic
1002066314 5:176653687-176653709 CTGGATCCAGAGCTGACTCTTGG - Intronic
1002235670 5:177800704-177800726 CTGGGACCAGATGTCCAGCTGGG - Intergenic
1002678115 5:180935631-180935653 CTGGGTCTGGAGCTGCGGCTGGG + Intronic
1002688909 5:181037080-181037102 TTGGATCCACAGCTGCAGTTTGG - Intergenic
1002908853 6:1472521-1472543 ATGGGTTCAGAGCTTCAGTTAGG + Intergenic
1003317226 6:5023941-5023963 CTAGGTCCAGAACAGCACCTTGG + Intergenic
1003455343 6:6276664-6276686 CTTGGTCCAGAGCTGTGACTGGG + Intronic
1003509849 6:6770678-6770700 ATGGGTACAGAGCTTCAGTTTGG + Intergenic
1003627156 6:7752278-7752300 CTGGCTCATGAGCTGTAGCTTGG + Intronic
1003979527 6:11376958-11376980 CTGTGGCCAGAGCTGTACCTGGG - Intronic
1004282605 6:14293644-14293666 CTGGGTCCAGCGCTCCACGTGGG + Intergenic
1005367872 6:25097678-25097700 CTGGGTGGAGAGCTGGGGCTGGG - Intergenic
1006351233 6:33522476-33522498 ATGGGTACAGAGTTGCAGTTTGG - Intergenic
1006672020 6:35735546-35735568 CTGGGTCCTGGGCTGCACCCAGG - Intergenic
1007375968 6:41456909-41456931 CTGGGTAAACAGCTGCTGCTGGG + Intergenic
1007407750 6:41644569-41644591 CTGGGCCCAGGGAGGCAGCTGGG + Intronic
1007649840 6:43412649-43412671 CTGGGTCCACAGCTGGGGTTGGG - Intergenic
1007789005 6:44298181-44298203 CTGGTACCAGACCTTCAGCTGGG - Intronic
1009582875 6:65558486-65558508 CTGGGTCAGGAGCCACAGCTGGG + Intronic
1009684179 6:66935739-66935761 CCAGGTCCGGAGCTGCAGCTGGG - Intergenic
1009847007 6:69146518-69146540 CTAGGTCTGCAGCTGCAGCTGGG + Intronic
1010489242 6:76453537-76453559 CTGTGTCCAGAGCTGTGGCTGGG + Intergenic
1011331748 6:86215887-86215909 CTGGGTCCACTCCAGCAGCTTGG - Intergenic
1011349022 6:86402077-86402099 CTGTGGCCAGAGCTGTACCTTGG + Intergenic
1011658164 6:89570518-89570540 ATGGGTATAGAGCTTCAGCTGGG - Intronic
1012709465 6:102581551-102581573 CCTGGTCCAGAGCTGCAGCTTGG - Intergenic
1014018650 6:116564007-116564029 CCGGCTCCAGGGCTGCAGGTGGG - Intergenic
1015030377 6:128587165-128587187 GTGGGTCCAGAGCTACAGTCTGG - Intergenic
1016061518 6:139636031-139636053 GTGGGTCCGGAGGTGCTGCTCGG + Intergenic
1016758958 6:147716436-147716458 CTGGGTCCACAGCTGTGGCTTGG + Intronic
1016790504 6:148062541-148062563 CTTGATCCAGAGCTGCATTTAGG + Intergenic
1017054374 6:150424410-150424432 CTGGGTCTACAGCTGCAACTTGG - Intergenic
1017760177 6:157562459-157562481 GTGGGGCCAGGGCTGCTGCTGGG + Intronic
1018154611 6:160974179-160974201 CTGGGTCCAGGGGAGCAGGTGGG - Intergenic
1018747774 6:166775705-166775727 CTGGCTTCAGGGCTGCAGCCCGG + Intronic
1019232275 6:170577615-170577637 CTGTGCTGAGAGCTGCAGCTTGG - Exonic
1019539181 7:1544144-1544166 CTGGGCCCAGAGCCGCAGGGTGG - Exonic
1019775062 7:2907479-2907501 ATGGGCCCAGAGTTGCAGTTTGG - Intronic
1019913672 7:4116878-4116900 CTGGGCCCAGCCCTGCTGCTTGG - Intronic
1019923940 7:4180176-4180198 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923951 7:4180226-4180248 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923994 7:4180426-4180448 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1020701790 7:11493296-11493318 CTGGTTCCAGAGTTCCATCTTGG - Intronic
1021097151 7:16547496-16547518 CTGGGCCCACAGCAGCAGTTTGG - Intronic
1021262301 7:18473096-18473118 CTGGGACCAGAGATTCAGCAAGG - Intronic
1022375352 7:29806826-29806848 CTGGGCCCGGGGCTGCAGCCCGG - Intronic
1022596580 7:31718804-31718826 CTGGGTGCCTAGCAGCAGCTAGG - Intergenic
1023024113 7:36035627-36035649 CTGGGTCCAGAGCAAAAGCATGG - Intergenic
1023341238 7:39222526-39222548 ATGGGTACAGAGTTTCAGCTGGG - Intronic
1023659694 7:42459366-42459388 CTGGGGCCAGAGCTGCTGCATGG - Intergenic
1023790610 7:43750262-43750284 CTGGGTCTGCAGCTGCAGTTTGG + Intergenic
1024074654 7:45812321-45812343 CTGGGCCGAGAGATGCAGCCAGG + Intergenic
1024213468 7:47227279-47227301 ATATGTCCAGAGCTGCTGCTGGG + Intergenic
1025052313 7:55741560-55741582 CTGGGCCGAGAGATGCAGCCAGG - Intergenic
1025052707 7:55743108-55743130 CTGGGCCGAGAGATGCAGCCAGG - Intergenic
1025130291 7:56371344-56371366 CTGGGCCGAGAGATGCAGCCAGG - Intergenic
1025130611 7:56372642-56372664 CTGGGCCGAGAGATGCAGCCAGG - Intergenic
1025198053 7:56947194-56947216 CTGGGTTCAGATGTCCAGCTGGG - Intergenic
1025673896 7:63629743-63629765 CTGGGTTCAGATGTCCAGCTGGG + Intergenic
1026370282 7:69691668-69691690 CTGGGTCCAGAGCCACAGCTGGG + Intronic
1026392136 7:69912314-69912336 CTGGGTCTGGAGCCACAGCTGGG + Intronic
1027687488 7:81295301-81295323 CTGGGTCTGGAGCTACTGCTGGG + Intergenic
1027735034 7:81920932-81920954 CTGGGTCTGGAGCTGAGGCTGGG + Intergenic
1027924739 7:84446946-84446968 CTGGGTCCCCAGCTGTGGCTGGG - Intronic
1028136659 7:87230180-87230202 CCAGGTCCACAGCTGCAGCTGGG - Intergenic
1028233189 7:88330058-88330080 CTGGGTCTGCAGCTGCAGTTTGG - Intergenic
1028354259 7:89887163-89887185 GCGGGTCCAGAGATGCTGCTTGG + Intergenic
1028596014 7:92546980-92547002 CTGGGTCCGCAGCTGTGGCTTGG - Intergenic
1029973875 7:104814957-104814979 CTGGGTCCATAGCTGCAGTTTGG + Intronic
1030199103 7:106884436-106884458 ATGGGTACAGAGTTTCAGCTGGG - Intronic
1030243701 7:107359120-107359142 CTGGGTCCACAGCTGTGGCTGGG - Intronic
1030311562 7:108074042-108074064 CAGGCTCCAGAGCTCCAGGTGGG + Intronic
1030621445 7:111795323-111795345 CTGGGGCCAGGGATGAAGCTGGG - Intronic
1031230998 7:119106144-119106166 CTGAGAACAAAGCTGCAGCTGGG + Intergenic
1031837129 7:126691428-126691450 CTGAGTCCGCAGCCGCAGCTAGG + Intronic
1031922076 7:127609404-127609426 CTGGGTCTGGAGCCACAGCTAGG + Intergenic
1032083858 7:128873483-128873505 CTCCCTCCAGGGCTGCAGCTGGG - Intronic
1032658450 7:133956074-133956096 CTGGGTCCGCAGCTGCAACTGGG + Intronic
1032945823 7:136851479-136851501 CTGGCTCCAGTGCTGCCTCTGGG - Intergenic
1033553128 7:142465516-142465538 CTGAGGCCAGAGCTGCAGGAGGG - Intergenic
1033555465 7:142484964-142484986 CTGAGGCCAGAGCTGCAGGAGGG - Intergenic
1033936093 7:146587440-146587462 CTAGGTGTAGGGCTGCAGCTTGG + Intronic
1034207156 7:149327727-149327749 ATGGGACCAGAGCAGCAGTTTGG + Intergenic
1034210504 7:149358603-149358625 CTAGGTCTGCAGCTGCAGCTTGG + Intergenic
1034252291 7:149701947-149701969 CTAGGTCCAGAGCCGTGGCTGGG + Intergenic
1034481096 7:151320918-151320940 CTGGGTCCACAGCCCCAACTTGG - Intergenic
1034880468 7:154758864-154758886 GTGGGACCAGAGCTGGAGCCTGG + Intronic
1034883010 7:154776596-154776618 CTGGCTCCAGTTCTGCAGCAGGG + Intronic
1035074253 7:156168146-156168168 CTGGGTCCAGAGCCTCAGTGGGG + Intergenic
1035414744 7:158673501-158673523 CTGGCTCCAGAGCTGCCTGTGGG + Intronic
1036137710 8:6176860-6176882 ATGGGTGCAGAGTTTCAGCTGGG + Intergenic
1036399696 8:8396788-8396810 GTGGGTACAGAACTGCAGTTTGG + Intergenic
1036590141 8:10161696-10161718 CTGGGGTCAGAGCTGAAGCCAGG + Intronic
1037715423 8:21393280-21393302 CTAGCTCCAGAGCTCCAGGTGGG + Intergenic
1037748945 8:21667534-21667556 CAGGAACCAGAGCTCCAGCTGGG + Intergenic
1037762686 8:21752387-21752409 CTGTGTCCAGTGCTGCTGATGGG - Intronic
1038149802 8:24932394-24932416 CTGGGTCTAAGGATGCAGCTGGG - Intergenic
1038371306 8:26994578-26994600 ATGGGTGCAGAGTTTCAGCTGGG + Intergenic
1038444019 8:27590781-27590803 ATGGGTACAGAGCTTCAGTTAGG + Intergenic
1041339325 8:56825580-56825602 CTGGGTACAGAGTTTCAGTTTGG + Intergenic
1041539434 8:58966505-58966527 CTGGGTACAGTGCGGCTGCTTGG + Intronic
1042159524 8:65877978-65878000 TTGGGTCCAGAGCACCTGCTGGG + Intergenic
1042196904 8:66238587-66238609 CTGGGTCCACAGCCACAGTTTGG + Intergenic
1042624992 8:70748285-70748307 CCAGGTCTAGAGCTGCAGCTGGG - Intronic
1043323296 8:79017763-79017785 ATGGGTCCAGAGTTGCAGTCAGG + Intergenic
1043414653 8:80034285-80034307 CTGGATCTGGAGCTGCAGCTGGG + Intronic
1043533142 8:81172060-81172082 CTGGGTTCGGGGCCGCAGCTGGG + Intergenic
1043756153 8:84005967-84005989 CTGGGTCCAGAGCCACAGCTGGG + Intergenic
1044304923 8:90628030-90628052 CTGGGATCAGAAGTGCAGCTGGG - Intronic
1044467594 8:92525606-92525628 CTGGATCCAGTGGTGCAGCCAGG + Intergenic
1044525058 8:93242058-93242080 CTGGGTCCACAGCAGCTGTTTGG + Intergenic
1045430940 8:102114628-102114650 CTGGGTTGCAAGCTGCAGCTTGG - Intronic
1046080247 8:109362517-109362539 CTGGCTCTAGTGCTGGAGCTCGG - Exonic
1046187116 8:110735191-110735213 CTGGGTCTGGAGTCGCAGCTGGG + Intergenic
1047602982 8:126445780-126445802 CTGGGTTCTGAGCAGGAGCTGGG - Intergenic
1048008524 8:130438438-130438460 CTTGTTCCAAAGCTGCAGCCAGG - Intronic
1048339223 8:133525911-133525933 CTGGGTCCAGAGCTGTGGCTAGG + Intronic
1048548061 8:135405194-135405216 CTGGGTCTGCAGCTGCAGCTAGG + Intergenic
1048693159 8:136989949-136989971 CTGGGTTCAGAGCCGTAGCTAGG + Intergenic
1048816776 8:138341450-138341472 GTGGGTTCAGAGTTTCAGCTGGG + Intronic
1048888508 8:138928183-138928205 CTGTGTCCATAGCAGCAACTTGG + Intergenic
1048976758 8:139677475-139677497 CTTGGCCCTGAGCTGCTGCTTGG - Intronic
1049175642 8:141190835-141190857 CTTGGCACAGAGCTGCAGCCTGG + Intronic
1049257459 8:141621511-141621533 CTGGGTTGAACGCTGCAGCTTGG + Intergenic
1049560196 8:143306487-143306509 CTGTGTCCTGAGCTGTGGCTTGG + Intronic
1049823871 8:144654704-144654726 CTGGGTCTGCAGCAGCAGCTTGG - Intergenic
1049826951 8:144675007-144675029 CTGGGTCCATAGCCACAGCTAGG + Intergenic
1050248249 9:3714229-3714251 GTGTGTCCAGAGATGCAGCCTGG - Intergenic
1050426453 9:5516906-5516928 CTGGGTCCAGAGCCACTGCTGGG + Intronic
1050589804 9:7149415-7149437 CCGGGTCCAGAGCCACGGCTGGG + Intergenic
1051029720 9:12658969-12658991 CTGGGTCCACAACCACAGCTGGG + Intergenic
1051920680 9:22260217-22260239 CTGTGTCCAGAGCTGTACCTGGG - Intergenic
1052597022 9:30574575-30574597 CCAGGTCCAGAGCCACAGCTGGG - Intergenic
1052623390 9:30943700-30943722 CAGGGTCCAGAGCCACGGCTGGG - Intergenic
1052686511 9:31764448-31764470 CTGGGTCTAGCAGTGCAGCTGGG - Intergenic
1053128049 9:35598919-35598941 CTGGGTCCACAGCCGTGGCTTGG - Intergenic
1053317360 9:37063337-37063359 CTGGGTACAGAGTTTCAGTTTGG + Intergenic
1053363618 9:37507537-37507559 CTGACTCCAGGGCTGCAGCAGGG - Intergenic
1053617261 9:39781322-39781344 TTGGATCCACAGCTGCAGTTTGG - Intergenic
1053619240 9:39798993-39799015 CTGGGTCCACAGCTGCAGCTTGG + Intergenic
1053875444 9:42540685-42540707 TTGGATCCACAGCTGCAGTTTGG - Intergenic
1053877396 9:42558342-42558364 CTGGGTCCACAGCTGCAGCTTGG + Intergenic
1053897201 9:42753948-42753970 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1054234299 9:62543380-62543402 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1054236256 9:62561039-62561061 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1054264917 9:62908436-62908458 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1054266905 9:62926115-62926137 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1054550398 9:66595569-66595591 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1055385159 9:75753676-75753698 CTGGGTTTAGAGCTGGGGCTGGG + Intergenic
1055572520 9:77631958-77631980 CTGGGTCTGCAGCTGCAGTTTGG - Intronic
1055645324 9:78357242-78357264 CTGGGTCCACAGCCGCGACTTGG - Intergenic
1056000007 9:82205207-82205229 CTGGGCCCAGGTCTACAGCTGGG - Intergenic
1056816114 9:89802436-89802458 CTGTCCCCAGAGCTGCAGCCGGG - Intergenic
1057085643 9:92207388-92207410 CTGCTTCTAGAGCTGGAGCTGGG - Intergenic
1057274539 9:93669314-93669336 CTGGCTCCTGAGCTGGGGCTGGG + Intronic
1057566615 9:96170779-96170801 CAGAGTCCAGAGCTGATGCTAGG + Intergenic
1058270751 9:102968406-102968428 CTGGGTCTGCAGCTGCAACTGGG + Intergenic
1059344056 9:113616374-113616396 CAGGGGCCTGAGCTGCAGATGGG - Intergenic
1059401120 9:114071168-114071190 CTGGGTCCACAGCCACAGCAGGG - Intronic
1059585004 9:115596452-115596474 CTGGGTTCAGAGATGGAACTTGG + Intergenic
1059875269 9:118627821-118627843 CTGAGTCAGGAGCAGCAGCTGGG - Intergenic
1060485279 9:124042445-124042467 GTGGGTCCAGTGCTGGGGCTGGG - Intergenic
1060618731 9:125043939-125043961 ATGGGTCCAAAGCTGCAGCTGGG - Intronic
1061041382 9:128142753-128142775 CTGTGTAGACAGCTGCAGCTGGG - Intergenic
1061061440 9:128252477-128252499 CTGGGCCAAGAGCTGCAGTGTGG + Intronic
1061782870 9:133006080-133006102 ATGGGTACAGAGCTTCAGTTTGG + Intergenic
1061816341 9:133199699-133199721 CTGGGAACGCAGCTGCAGCTGGG - Intergenic
1062139422 9:134947659-134947681 CGGGGTCCTGACGTGCAGCTGGG - Intergenic
1062160915 9:135079279-135079301 CTGGGTCCAGGCTTGCACCTGGG + Intronic
1062523299 9:136968527-136968549 CTGTGTCAGGAGCTGCAGCCAGG - Intergenic
1062585494 9:137247611-137247633 CTGGGGCCAGGGCTGCAGGAGGG - Intronic
1062647546 9:137556575-137556597 CTGGGCCCAGGGCTTCAACTGGG + Intronic
1062673648 9:137726426-137726448 CTGGGGCCCGCGCTGCAGCGTGG - Intronic
1062675161 9:137738727-137738749 CTGGGGCCCGCGCTGCAGCGTGG + Intronic
1203522212 Un_GL000213v1:54736-54758 CTGGGTACAGGGCAGCAGCCAGG - Intergenic
1186805758 X:13139130-13139152 CTGGGTCTAAAGCTGCAGTTTGG - Intergenic
1188168481 X:26892339-26892361 CTGGATCCAGCAGTGCAGCTGGG + Intergenic
1188207678 X:27380440-27380462 CTGGGTCCACAGCCACAGCTTGG - Intergenic
1188727878 X:33607425-33607447 CCAGGTCCAGAGCCACAGCTGGG + Intergenic
1188756404 X:33968989-33969011 CTGGGTCCTCAGTTGCAACTTGG - Intergenic
1188952539 X:36393952-36393974 CTGGGTACAGAGTTTCAGCTTGG - Intergenic
1190681592 X:52831016-52831038 CTGGGTCTACAGCTGCTGTTTGG - Intergenic
1191018274 X:55833791-55833813 CTGACTCCAGAGCTCCAGTTGGG - Intergenic
1192493635 X:71598323-71598345 GTGGGTCAAGAGCTGAGGCTAGG + Intronic
1194205188 X:91003177-91003199 TTGGATCCATAGCTGCAGTTTGG + Intergenic
1195880399 X:109586774-109586796 CTGGGTCCAAAGCCACGGCTGGG + Intergenic
1196996645 X:121390709-121390731 CTGGGTCCAGAGATGAAGAATGG + Intergenic
1197230333 X:123997424-123997446 ATGGGTCCAGAGTTTCAGTTTGG - Intronic
1197406916 X:126065101-126065123 CTGGGTCCAGAGCCATGGCTGGG - Intergenic
1197609669 X:128623762-128623784 CTGGGTCCACAGCCACAACTTGG + Intergenic
1197945169 X:131830845-131830867 CTCTGTCCAGAGCTTCAGGTAGG + Intergenic
1199156200 X:144551562-144551584 GTGGGTTCAGAGCTGCTGTTAGG - Intergenic
1199188091 X:144939852-144939874 CTGGATCCACAGCTGTAGCAGGG + Intergenic
1199252317 X:145677317-145677339 CTGGGTCCAGGCCTGATGCTGGG + Intergenic
1199982289 X:152927758-152927780 CTGGGCCCAGAGCTTCACCAGGG + Intronic
1200551007 Y:4578298-4578320 TTGGATCCATAGCTGCAGTTTGG + Intergenic
1202368280 Y:24181306-24181328 CTGGGTAAAGAGCTGCAGTGTGG - Intergenic
1202372417 Y:24207876-24207898 CTGGGTAAAGAGCTGCAGTGTGG + Intergenic
1202498368 Y:25462244-25462266 CTGGGTAAAGAGCTGCAGTGTGG - Intergenic
1202502505 Y:25488811-25488833 CTGGGTAAAGAGCTGCAGTGTGG + Intergenic