ID: 965774125

View in Genome Browser
Species Human (GRCh38)
Location 3:172210191-172210213
Sequence GGGCGGCTTCGTGGAGCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 318}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965774125_965774139 26 Left 965774125 3:172210191-172210213 CCGCCAGCTCCACGAAGCCGCCC 0: 1
1: 0
2: 2
3: 31
4: 318
Right 965774139 3:172210240-172210262 TTGCAGTGGCTGCTCCACGTGGG 0: 1
1: 0
2: 6
3: 27
4: 195
965774125_965774131 -2 Left 965774125 3:172210191-172210213 CCGCCAGCTCCACGAAGCCGCCC 0: 1
1: 0
2: 2
3: 31
4: 318
Right 965774131 3:172210212-172210234 CCCCCACTCCTCCATGCAGTTGG 0: 1
1: 0
2: 0
3: 16
4: 219
965774125_965774138 25 Left 965774125 3:172210191-172210213 CCGCCAGCTCCACGAAGCCGCCC 0: 1
1: 0
2: 2
3: 31
4: 318
Right 965774138 3:172210239-172210261 TTTGCAGTGGCTGCTCCACGTGG 0: 1
1: 0
2: 4
3: 31
4: 215
965774125_965774137 12 Left 965774125 3:172210191-172210213 CCGCCAGCTCCACGAAGCCGCCC 0: 1
1: 0
2: 2
3: 31
4: 318
Right 965774137 3:172210226-172210248 TGCAGTTGGCATCTTTGCAGTGG 0: 2
1: 4
2: 13
3: 54
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965774125 Original CRISPR GGGCGGCTTCGTGGAGCTGG CGG (reversed) Intronic
900119680 1:1043158-1043180 GGACTGCTGCGTGGGGCTGGGGG + Intronic
900339444 1:2181097-2181119 TGGTGGCTTGGTGGAGGTGGCGG - Intronic
900345788 1:2209686-2209708 GGGGGGCTGCTTGGTGCTGGTGG + Intronic
900582121 1:3414483-3414505 GGGCGGCTCTGTGGAGCGGGTGG + Intronic
900609605 1:3538987-3539009 GGGAGGCTTCCTGGAGGAGGTGG + Intronic
901001046 1:6149000-6149022 GGGCGGCTGCGAGGAGGAGGAGG - Exonic
901138038 1:7010173-7010195 GGAGGGCTTCCTGGAGCTTGGGG + Intronic
902780235 1:18700251-18700273 GGGGGGCTTCCTGGAGGAGGTGG + Intronic
903668783 1:25023293-25023315 GGGAGGCTTCTTGGAGGAGGTGG - Intergenic
905044507 1:34985248-34985270 GGGCGGCTTCTTCGCGCTCGTGG - Exonic
906140887 1:43532614-43532636 GGGAGGCTTCGGGGATCTGAGGG + Intronic
906524473 1:46486134-46486156 GGGAGCCTTCGTGGGGGTGGAGG + Intergenic
907136406 1:52142640-52142662 GGCCGGGTGTGTGGAGCTGGGGG + Intronic
907414079 1:54302037-54302059 GGGCGGCTGGGTGGGGGTGGGGG + Intronic
909958226 1:81802948-81802970 GGGCGGCCTCGTGGGTCGGGAGG + Intronic
912532903 1:110339322-110339344 GGGCGCCTTCCTGGAGCGCGGGG + Exonic
914203377 1:145505900-145505922 GGGCGGCGCCGTGGAGCAGGGGG + Intergenic
914482499 1:148079054-148079076 GGGCGGCGCCGTGGAGCAGGGGG + Intergenic
914938999 1:152005701-152005723 GGGAGGCTTCCTGGAGGAGGAGG + Intergenic
915289553 1:154874056-154874078 GGGTGGCTTCCTGGAGGTGGTGG + Intergenic
915628970 1:157137643-157137665 GGGCAGCTTCCTGGAGCAGTGGG - Intronic
916031044 1:160877809-160877831 GGACGGCATCAAGGAGCTGGTGG - Intronic
916649504 1:166821730-166821752 GGGAGGCTTCCTGGAGCAGGAGG - Intergenic
916655920 1:166875732-166875754 GGAGGGCTTCCTGGAGGTGGAGG - Intronic
918509016 1:185289843-185289865 GGGGGGCTTTGAGGAGATGGTGG + Intronic
920495867 1:206454539-206454561 GGGCGGCCTCCTGGAGAAGGAGG - Intronic
922775786 1:228213742-228213764 GGGCGGCTTCGGGGAGGTAGCGG + Intronic
923372656 1:233328336-233328358 GGGCGGCGGCGCGGGGCTGGCGG - Exonic
924360000 1:243229586-243229608 AGGCTGCTTCTTGGAGCTGTTGG - Intronic
924617324 1:245622913-245622935 CGGCTGCTTCGTGGAGCTGATGG + Intronic
924763238 1:247008061-247008083 GGGCGGCCTTGGGGATCTGGCGG - Intronic
924787384 1:247210852-247210874 GCGCGGCTTCCGGGATCTGGCGG - Intergenic
1062889650 10:1048802-1048824 GGGCGGCATCGGGGAGCTGCGGG - Intronic
1062971754 10:1653926-1653948 GGGAGGCTCCGTGTGGCTGGGGG + Intronic
1063429594 10:5977339-5977361 GGGCCGGGACGTGGAGCTGGAGG - Intronic
1066975981 10:42367995-42368017 GGGCGGCTTCCGGGTGTTGGCGG - Intergenic
1067894205 10:50162058-50162080 AGGCGGGTTTGTGGACCTGGTGG - Intergenic
1067954635 10:50778203-50778225 AGGCGGGTTTGTGGACCTGGTGG + Intronic
1069075781 10:64037143-64037165 CGGCGGCTTGGCAGAGCTGGAGG - Intergenic
1070360372 10:75682720-75682742 GGGCTGCTTCTTGGAGGGGGTGG + Intronic
1071598752 10:86945897-86945919 GGGAGGCTTCGGGAAGGTGGTGG - Intronic
1072755594 10:98018839-98018861 GGGTGTCTTTGTGGAGCTGGTGG - Intronic
1075102703 10:119517476-119517498 CTGTGGCTTCATGGAGCTGGTGG - Intronic
1075816726 10:125270392-125270414 GGAAGGCTTCTTGGTGCTGGTGG + Intergenic
1075948661 10:126458975-126458997 TGGGGGGTTCCTGGAGCTGGAGG - Intronic
1076384508 10:130046743-130046765 GGGCGGCGTGGGCGAGCTGGTGG - Intergenic
1076422127 10:130339028-130339050 GGGTGTCTTCATGGGGCTGGGGG - Intergenic
1076454019 10:130576781-130576803 GGGCAGCTTTGAGGATCTGGTGG + Intergenic
1076909429 10:133379704-133379726 GGGCGGCCTTGTGGAGCCGTAGG - Intronic
1077187623 11:1242549-1242571 GGGCGTGGCCGTGGAGCTGGTGG - Exonic
1077551039 11:3200485-3200507 GGGGGGCTTCCTGGAGGAGGTGG - Intergenic
1077551055 11:3200525-3200547 GGGGGGCTTCCTGGAGGAGGTGG - Intergenic
1078528787 11:12120572-12120594 GGGAGGCTTCCTGGAGGAGGTGG + Intronic
1078754926 11:14200092-14200114 GGAAGGCTTCCTGGAGGTGGTGG - Intronic
1079010834 11:16826771-16826793 GGGTGGCTTCCTGGAGGAGGTGG - Intronic
1081872268 11:46388731-46388753 GGGCAGCCTCCTGGTGCTGGAGG - Intergenic
1083272288 11:61578590-61578612 GGGAGCCTTGGGGGAGCTGGGGG + Intronic
1083279820 11:61620042-61620064 GGAGGGCTTCCTGGAGGTGGTGG - Intergenic
1083490717 11:63013535-63013557 GGGAGGCTTCATGGAGGAGGTGG - Intronic
1084183446 11:67457854-67457876 GGGGGACTTCCTGGAGCAGGAGG + Intronic
1084420350 11:69057625-69057647 GGGCTACCTCGTGGTGCTGGTGG + Exonic
1084571155 11:69960672-69960694 GGGCGTCTTTGTGGTGCTTGTGG + Intergenic
1085022467 11:73218187-73218209 GGGCGGCGTCCCGGAGCGGGTGG + Intergenic
1088889521 11:114033529-114033551 GGTCTGCTGAGTGGAGCTGGAGG - Intergenic
1089273175 11:117315603-117315625 GGGCAGCTTTGTGGAGATGGTGG - Exonic
1089305323 11:117522782-117522804 GGGGGGCTTCGTGGAGGAGTAGG + Intronic
1089416342 11:118295348-118295370 AGGCAGCTTCCTGGAGGTGGAGG - Intergenic
1091773611 12:3169828-3169850 GGGTGGCTTCCTGGAGCCTGGGG + Intronic
1096413200 12:51391694-51391716 GGGCGCGTTAGTGCAGCTGGGGG - Intronic
1102165403 12:110802097-110802119 GGGGGGCTTCCTGGAGGTGGTGG + Intergenic
1102247264 12:111363214-111363236 GGGCTGCACTGTGGAGCTGGTGG - Exonic
1102518021 12:113463198-113463220 CGGCGGCTTCGTTGAGCTCGGGG + Exonic
1102527130 12:113520094-113520116 GGGGGGCTGCTTGGGGCTGGAGG + Intergenic
1102973539 12:117190126-117190148 GGGCGGCCGCGGGGAGCTAGCGG + Intronic
1103145797 12:118594882-118594904 GGAAGGCTTCATGGAGGTGGTGG + Intergenic
1103393651 12:120591679-120591701 GGAAGGCTTCCTGGAGCCGGTGG + Intergenic
1104462248 12:128965275-128965297 GGGCAGCCTCTAGGAGCTGGGGG + Intronic
1107225618 13:38044779-38044801 GGGCGGGTTGGTTGTGCTGGGGG - Intergenic
1110313995 13:74083882-74083904 GGTTGGCTTCTTGGAGCAGGTGG + Intronic
1110436307 13:75481533-75481555 GGGCGGCTGCGGGGCGCCGGCGG - Exonic
1110901597 13:80831789-80831811 GGTGAGCTTCCTGGAGCTGGTGG - Intergenic
1113654205 13:112057935-112057957 GGGCGGCTCCGCGGCGCTGGTGG - Intergenic
1114082237 14:19211089-19211111 GGGCTGCCTAGTGGAGCTGTGGG + Intergenic
1118119115 14:62818086-62818108 GGGTGGCTACCAGGAGCTGGGGG + Intronic
1119307056 14:73615948-73615970 GGGTGGCTTCTTGAGGCTGGAGG + Intronic
1119400620 14:74359876-74359898 GAGCGTCTTCTCGGAGCTGGAGG + Exonic
1121276492 14:92671499-92671521 GGAGGGCTTCTTGGAGTTGGAGG + Intronic
1121843064 14:97150674-97150696 GGGCGGATTTGTGGAGCAAGAGG + Intergenic
1122856988 14:104564680-104564702 CCGCAGCTTCGTGGGGCTGGCGG + Intronic
1123031140 14:105451733-105451755 GGGCTGCATCGTGCAGCAGGAGG - Intronic
1123466755 15:20522597-20522619 TGGCTGCTTCGTGGGGCTGTTGG + Intergenic
1123651358 15:22478444-22478466 TGGCTGCTTCGTGGGGCTGTTGG - Intergenic
1123741767 15:23287287-23287309 TGGCTGCTTCGTGGGGCTGTTGG - Intergenic
1123745229 15:23315271-23315293 TGGCTGCTTCGTGGGGCTGTTGG + Intergenic
1124277501 15:28338591-28338613 TGGCTGCTTCGTGGGGCTGTTGG + Intergenic
1124305199 15:28573015-28573037 TGGCTGCTTCGTGGGGCTGTTGG - Intergenic
1124959294 15:34382793-34382815 GAGCGACTTGGAGGAGCTGGTGG - Exonic
1124975920 15:34529014-34529036 GAGCGACTTGGAGGAGCTGGTGG - Exonic
1125857003 15:42960112-42960134 GGGAGGCTTCATGGAGGAGGTGG + Intronic
1126185845 15:45829756-45829778 TGCCAGCTTCCTGGAGCTGGAGG + Intergenic
1126858128 15:52858792-52858814 TGGCGGCTGAGGGGAGCTGGAGG - Intergenic
1127221669 15:56887119-56887141 GGGCAGCGTCGCGGTGCTGGAGG + Intronic
1128314649 15:66653026-66653048 GGGAGGCTTCCTGGAGGAGGTGG + Intronic
1128520742 15:68373144-68373166 CGACGGCTTCCTGGAGCAGGTGG - Intronic
1128730677 15:70018868-70018890 GAGCAGCTTCAGGGAGCTGGTGG - Intergenic
1128751816 15:70155488-70155510 GGGTGGCTTTGTGGAGGAGGAGG + Intergenic
1129038018 15:72662742-72662764 GTGCAGCTTCGAGGATCTGGTGG + Exonic
1129211871 15:74074489-74074511 GTGCAGCTTCGAGGATCTGGTGG - Exonic
1129227579 15:74179021-74179043 TGGGGGCTTGGTGGAGGTGGAGG - Intergenic
1129398532 15:75266595-75266617 GTGCAGCTTCGAGGATCTGGTGG + Exonic
1129402140 15:75290871-75290893 GTGCAGCTTCGAGGATCTGGTGG + Exonic
1129457905 15:75685434-75685456 GGGCGTCCTTGTGGAGCTGGAGG - Exonic
1129475687 15:75783331-75783353 GTGCAGCTTCGAGGATCTGGTGG + Intergenic
1129692227 15:77720351-77720373 GGGCAGGTGCGTGGACCTGGCGG - Intronic
1129728989 15:77918761-77918783 GTGCAGCTTCGAGGATCTGGTGG - Intergenic
1129761296 15:78130782-78130804 GGGCTCCTTCCTGGGGCTGGGGG + Intronic
1129839511 15:78735105-78735127 GTGCAGCTTCGAGGATCTGGTGG + Intergenic
1129887174 15:79046784-79046806 GGGAGGCTTCTTGGAGCTGGCGG + Exonic
1130115718 15:81002577-81002599 GGGCCGCTTCGGGGAGGCGGGGG + Exonic
1131696508 15:94882583-94882605 GGGCAGCTGCTTGGCGCTGGTGG + Intergenic
1132055242 15:98647473-98647495 GGGCGGCTGCGGGGAGCGGCCGG - Intergenic
1132592856 16:733922-733944 GGGCATCCTCGTGGACCTGGTGG + Intronic
1132657224 16:1046413-1046435 TGGTGGCTTCCTGGAGGTGGAGG - Intergenic
1132663938 16:1073204-1073226 GGGCTGGCTCCTGGAGCTGGAGG + Intergenic
1132708909 16:1257992-1258014 GTGCTGCTTCGTGGACTTGGTGG - Intronic
1132893241 16:2214804-2214826 GGGCGGCTGCGAGGAGCGGCCGG - Exonic
1135521598 16:23182570-23182592 GGGCGGCTTCGGGGCGCCAGGGG + Intergenic
1135691144 16:24539210-24539232 GGGAGGCTTAGAGGAGCTGACGG + Intronic
1136656646 16:31713233-31713255 GGGCGGCTTCCGGGATTTGGCGG + Exonic
1136672843 16:31873767-31873789 GGGCGGCTTCCGGGATTTGGCGG + Exonic
1137441799 16:48504379-48504401 GTCCGGCTGCATGGAGCTGGTGG + Intergenic
1139597004 16:67963985-67964007 GTGCGGCTTCGTCTATCTGGAGG - Intronic
1140165259 16:72543911-72543933 CGGTGGCTTTGTGGTGCTGGTGG - Intergenic
1141666668 16:85469333-85469355 GGGCGGCCACGTGAAGATGGAGG + Intergenic
1142141418 16:88474345-88474367 GGGGGGCTGCCTGGAGGTGGTGG + Intronic
1142467934 17:146684-146706 GGACGGCTTCCTGGAGGAGGCGG - Intergenic
1142611250 17:1110039-1110061 GGGCTGCTTGGAGGAGGTGGGGG - Intronic
1142636402 17:1260312-1260334 GGGCGGGGGCGGGGAGCTGGGGG - Intergenic
1142998859 17:3777874-3777896 GGGCGGCTTCTTGGAGGAGGGGG - Intronic
1144672698 17:17141844-17141866 GGGTGACTTCTTGCAGCTGGAGG + Intronic
1144707531 17:17379491-17379513 TGGTGGTTTCCTGGAGCTGGGGG - Intergenic
1144826879 17:18110137-18110159 GGTTGGCTTGGTGCAGCTGGGGG - Intronic
1145262768 17:21364665-21364687 TGGAGGCTTCAGGGAGCTGGTGG + Intergenic
1146034117 17:29390875-29390897 GGGCGGCTTGCTGGGGCTCGGGG + Exonic
1146263976 17:31438972-31438994 GGGAGGCTTCCTGGAGGAGGCGG - Intronic
1146398463 17:32486629-32486651 GGGCGGCGGCGCGGAGCGGGCGG + Exonic
1147262023 17:39214315-39214337 GGGTGGCTTTGGGGAGCTGCGGG + Exonic
1147581189 17:41628070-41628092 GGGCAGCCTGGTGGAGATGGAGG - Intergenic
1148052864 17:44777695-44777717 GGGAGGCCACGTGCAGCTGGCGG + Exonic
1148394171 17:47295237-47295259 GGGTGGCTTCATGGAGGAGGTGG + Intronic
1148547599 17:48529626-48529648 GGGCAGCCTGGTGGGGCTGGGGG + Exonic
1151377688 17:73702347-73702369 GGGCGGGTTTGTGGAGCAGTCGG + Intergenic
1151661893 17:75523566-75523588 AGGCTGCTTCCTGGAACTGGTGG + Intronic
1152223974 17:79084244-79084266 GGGTGGCTTTGGGGGGCTGGGGG - Intronic
1154005725 18:10526033-10526055 GGGCGGATTCTTGGCGCCGGAGG + Exonic
1154303812 18:13217241-13217263 GGGCGGTTTCGGGAGGCTGGGGG - Intergenic
1155164634 18:23222298-23222320 GGGGCTCTTAGTGGAGCTGGGGG - Intronic
1155826428 18:30449304-30449326 GGGCAGGTTAGGGGAGCTGGCGG - Intergenic
1159953311 18:74501433-74501455 GGGGGGCTCTGTGGAACTGGTGG + Exonic
1160774451 19:848577-848599 GGGGGGCTTCCTGGAGGAGGTGG + Intergenic
1160809142 19:1005556-1005578 GGGCGGCCTCGGGGGGCTGCGGG + Intronic
1160861191 19:1237799-1237821 GGGCGGCTGCGTGGCGCTCGCGG + Exonic
1160895509 19:1400248-1400270 GGGAGGCTTCCTGGAGGAGGGGG + Intronic
1161067952 19:2247800-2247822 GGGAGGCTGGGTGGAGCCGGGGG - Exonic
1161420920 19:4175550-4175572 GGGAGGCTTCCTGGAGCAGGTGG - Intronic
1161543744 19:4867575-4867597 GGGCGTCTCAGTTGAGCTGGGGG - Intronic
1162829432 19:13275309-13275331 GGGCGCCATCTTGGAGCTGCAGG + Intronic
1162937609 19:13989209-13989231 TGGCGGGTTTGTGGAGCTGTAGG + Intronic
1163605722 19:18274328-18274350 GGGCGGGTGAGTGGGGCTGGTGG - Intronic
1163605732 19:18274357-18274379 GGGCGGGTGAGTGGGGCTGGTGG - Intronic
1163893763 19:20039507-20039529 GGGCGGTGTCCTGGAGCTGGCGG - Intergenic
1163983421 19:20923227-20923249 GGGCGGCTTCCGGGATGTGGCGG + Intronic
1163999240 19:21082173-21082195 GGACGGCTTCGGGGATGTGGCGG + Intronic
1164077825 19:21836190-21836212 GGGCGGCTTCCGGGATGTGGCGG - Exonic
1164136606 19:22422348-22422370 GGGCGGCTTCCGGGATGTGGCGG - Intronic
1164162152 19:22634300-22634322 GGGCGGCTTCCGGGATGTGGCGG + Intergenic
1164226482 19:23250396-23250418 GGGCGGCTTCCGGGATTTGGCGG - Intergenic
1164296467 19:23914856-23914878 GGGCGGCTTCCGGGATTTGGCGG + Intronic
1164477383 19:28585973-28585995 GGAAGGCTTCATGGAGGTGGTGG - Intergenic
1165351687 19:35279260-35279282 CGGCGGCTGCGTGGTGGTGGCGG - Exonic
1166544158 19:43624171-43624193 GGGCGGCATCCTGGCGCTGCTGG - Exonic
1166988552 19:46677211-46677233 GTGCGGCTTCATGGAGCAGGTGG - Intronic
1167041994 19:47027943-47027965 GGGAGGCATCGGGGAGTTGGTGG + Intronic
1167461319 19:49625979-49626001 GGGTGGCTTCAGAGAGCTGGGGG + Exonic
1168257630 19:55175318-55175340 GGTCCCCTACGTGGAGCTGGGGG - Exonic
1168563505 19:57403606-57403628 GGGTGGCTGCCTGGGGCTGGTGG - Intronic
927708511 2:25311394-25311416 GGGCGGCTCCCTGGAGGTGCTGG + Intronic
927787502 2:25983472-25983494 GGAAGGCTTCGTGGAGGAGGAGG - Intergenic
929880573 2:45833516-45833538 GGGAGGATTCGAGGAGATGGTGG - Intronic
930096418 2:47570202-47570224 CGGCCGCTTCGTGCTGCTGGCGG - Exonic
930746987 2:54894935-54894957 GGACGGCATCGTGGAGCTCTGGG + Exonic
931428214 2:62190151-62190173 GGGAGGCTTCCTGGAGAAGGTGG - Intergenic
932420622 2:71599303-71599325 GGGCAGCCTCGTGCAGCTAGAGG - Intronic
932435938 2:71702565-71702587 GGGAGGCTTCCTGGAGGAGGTGG + Intergenic
933302038 2:80552059-80552081 GGCCGTCTTGGTGGAGCAGGCGG + Intronic
937083898 2:119158338-119158360 GGGCGGCAAGGAGGAGCTGGTGG - Exonic
938091805 2:128439428-128439450 GGGTAGCTGTGTGGAGCTGGCGG + Intergenic
938302719 2:130228355-130228377 GGGGGGCTTCCTGGAGGAGGAGG - Intergenic
938453950 2:131445867-131445889 GGGGGGCTTCCTGGAGGAGGAGG + Intergenic
938494351 2:131785515-131785537 GGGCTGCCTAGTGGAGCTGTGGG - Intergenic
938706235 2:133929999-133930021 GGGAGCCTTCGTGGAGGTGAAGG - Intergenic
942279263 2:174343929-174343951 GGGCGGCCTCCTGGCGCGGGAGG + Intergenic
943797638 2:192017153-192017175 AGGTGGCTTGGTAGAGCTGGAGG + Intronic
946373343 2:219293975-219293997 GGGGGGCTCAGTGGAGCAGGTGG - Intronic
948432668 2:237929954-237929976 GGGTGGCTTGGGGGTGCTGGTGG - Intergenic
948947612 2:241229039-241229061 AGGCAGGTTCCTGGAGCTGGGGG - Exonic
949037773 2:241825585-241825607 TGGTGGCTTCCAGGAGCTGGGGG + Intergenic
1168967475 20:1907578-1907600 GGAAGACTTCCTGGAGCTGGTGG - Intronic
1172425397 20:34852257-34852279 GGGCTGGTTCAGGGAGCTGGGGG + Exonic
1172694941 20:36816037-36816059 CCGCCGCATCGTGGAGCTGGAGG - Exonic
1172766215 20:37352468-37352490 GGGAGGCTGGATGGAGCTGGTGG - Intronic
1173488430 20:43458361-43458383 GTACGGCTTCGTGGAGTTCGAGG + Exonic
1174379257 20:50146258-50146280 GGATGGCTTCCTGGAGATGGAGG - Intronic
1175195144 20:57238126-57238148 GGGTGGGTGCCTGGAGCTGGAGG - Intronic
1175268167 20:57714976-57714998 GGGGGCCTCCGTGGAGCTGAGGG - Intergenic
1175831457 20:61967209-61967231 GGAGGGCTTCCTGGAGCTGGTGG + Intronic
1175840887 20:62026577-62026599 CTGCGGCTTTGTGGAGATGGGGG - Intronic
1176114173 20:63423912-63423934 GGGCGGCTTCTCGGGGGTGGGGG - Intronic
1176207267 20:63895636-63895658 GGGCGGCCGCGGGGACCTGGGGG - Intronic
1176613570 21:9008850-9008872 GGGCTGCCTAGTGGAGCTGTGGG + Intergenic
1176711614 21:10155022-10155044 GGGCGGCCTAGTGGAGCTGTGGG - Intergenic
1178585118 21:33865262-33865284 GGGCAGCCCCGTTGAGCTGGCGG - Exonic
1179274896 21:39883221-39883243 GGGTGGCTTGGTGGGGTTGGGGG + Intronic
1179419170 21:41222356-41222378 GGTCAGCTTCGTGGAGAAGGTGG + Intronic
1179792753 21:43764879-43764901 GGCCGGCCTCGTGGAGGTGACGG - Intergenic
1180498538 22:15911581-15911603 GGGCTGCCTAGTGGAGCTGTGGG - Intergenic
1180831070 22:18906389-18906411 GGGCGCCTTGGAGGAGGTGGCGG + Exonic
1181230238 22:21417566-21417588 GGGCGGCCTTGTGGGGCGGGGGG + Intronic
1182295037 22:29307365-29307387 GGGAGGCTTCTTGGAGGAGGCGG + Intronic
1182832264 22:33313657-33313679 GCGTGGCTTCGAGGAGCTGAGGG + Intronic
1183343014 22:37292482-37292504 GGGAGGCTTCCTGGAGGAGGTGG + Intronic
1183390858 22:37545181-37545203 GGGCGGCTTCATGGAACTAGAGG + Intergenic
1184071490 22:42150184-42150206 GGGCCACTTTGTGAAGCTGGAGG - Intergenic
1184098198 22:42327989-42328011 GGGAGGCTTCCTGGAGGAGGGGG - Intronic
1184362037 22:44024513-44024535 GGGCGGCCTCGTGGGGCTCTAGG - Intronic
1184765458 22:46569844-46569866 TGGGGGCTTGGAGGAGCTGGAGG - Intergenic
1185156528 22:49196416-49196438 GGGAGGATGCGTGGAGCCGGGGG + Intergenic
1185398539 22:50604505-50604527 GCCCGGCGGCGTGGAGCTGGTGG + Exonic
1203281157 22_KI270734v1_random:131660-131682 GGGCGCCTTGGAGGAGGTGGCGG + Intergenic
949483995 3:4519934-4519956 GGGGGGCTTTGTGGAGAAGGTGG + Intronic
950460784 3:13121132-13121154 AGGCAGCTTCGTGGAGCGTGTGG - Intergenic
950722183 3:14891297-14891319 GGGCGGCTGGATGGAGGTGGTGG - Intronic
952076348 3:29701867-29701889 GGGCGGCGCCGTGGAGCAGGGGG - Intronic
952944808 3:38472213-38472235 ATGCTGCTTTGTGGAGCTGGGGG + Intronic
954121597 3:48503390-48503412 GGGTGGCTTCGTGGAGGGGAAGG - Intronic
954385151 3:50240249-50240271 GGGGGGCTTCCTGGAGGAGGGGG + Intronic
954794244 3:53153452-53153474 GGGAGGCTTCCTGGAGGAGGAGG + Intergenic
957945011 3:87052726-87052748 CGGCGGCGACCTGGAGCTGGAGG - Intergenic
961405036 3:126672524-126672546 GGGCGGACCCCTGGAGCTGGTGG + Intergenic
964255144 3:154766922-154766944 GGGCTGCTCCCTGGAGCAGGAGG + Intergenic
965774125 3:172210191-172210213 GGGCGGCTTCGTGGAGCTGGCGG - Intronic
966708117 3:182939671-182939693 GTGTGGCTGCGTGGGGCTGGAGG + Exonic
966904394 3:184511258-184511280 GGGGGGCTCCCTAGAGCTGGAGG + Intronic
968063821 3:195747262-195747284 GGGCGGCCTCTTGCTGCTGGGGG - Exonic
968137368 3:196228748-196228770 GGGCGTCTTCCTGGGGCAGGGGG + Intronic
968662667 4:1805233-1805255 GGAGGGCTTCCTGGAGGTGGTGG + Intronic
968916871 4:3500471-3500493 GGGCTGCTGGGTGGGGCTGGGGG - Intronic
968980913 4:3848907-3848929 TGCAGGCTGCGTGGAGCTGGCGG - Intergenic
969307250 4:6332883-6332905 GGGAGGCTTCTTGGAGGAGGTGG - Intronic
969364777 4:6687990-6688012 GGGAGGCTTCCTGGAGGAGGTGG - Intergenic
969594588 4:8141932-8141954 GGGCTCCTGCATGGAGCTGGGGG - Intronic
969646223 4:8431025-8431047 GGCCATCTTGGTGGAGCTGGAGG + Intronic
969864878 4:10068670-10068692 GGCAGGCTTCCTGGAGCAGGAGG - Intergenic
972258196 4:37381508-37381530 GAGCGGCCTCATGGAGTTGGAGG - Intronic
973993577 4:56435465-56435487 CGGCGGCGACATGGAGCTGGAGG - Exonic
975689359 4:76949422-76949444 TGCCCGCTTCGTGGAGCCGGTGG + Intergenic
976227360 4:82806164-82806186 GGAGGGCTTCGTGGAGGAGGTGG + Intergenic
980130498 4:128812076-128812098 GAGCGGATTGGTGCAGCTGGCGG + Intronic
982911674 4:161149505-161149527 GCTGAGCTTCGTGGAGCTGGGGG - Intergenic
983752894 4:171298609-171298631 GGGCGCCGCCGTGGAGCAGGGGG - Intergenic
984954476 4:185031824-185031846 AGTGGGCTTCGTGGAGCTGGTGG + Intergenic
985535867 5:465460-465482 GGGCGGCCTCGGGAAGCCGGCGG - Intronic
987182735 5:15384852-15384874 AGGCGGCTGCCAGGAGCTGGAGG + Intergenic
987329338 5:16842010-16842032 GGGGGGCTTGGTGGGGGTGGGGG + Intronic
990306054 5:54494880-54494902 GGGTGGCTTCTAGGAGCTGATGG - Intergenic
992089408 5:73303878-73303900 GGGCTACCTTGTGGAGCTGGAGG - Intergenic
992800160 5:80288617-80288639 GGGTGGCTTGGGGGACCTGGTGG + Intergenic
992877629 5:81073392-81073414 GGGGGGCTTCTTGGAGCTGGCGG - Exonic
999696282 5:154190799-154190821 GGGCGGACGCGCGGAGCTGGGGG + Exonic
1002078431 5:176723498-176723520 GGGAGGCTGGGAGGAGCTGGAGG - Intergenic
1002617919 5:180467086-180467108 GGGAGGCTTCCTGGAGGAGGAGG + Intergenic
1003085442 6:3056568-3056590 GGGCGGCTTCGAGGATCAGGAGG - Intergenic
1003921718 6:10838653-10838675 GCGGGGCTTCATGGAGCCGGGGG + Intronic
1006091599 6:31631899-31631921 GTGCGGCCTCGGGGAGCAGGAGG - Exonic
1006153857 6:32003639-32003661 GGAAGGCTTCCTGGAGCAGGTGG + Intergenic
1006160165 6:32036376-32036398 GGAAGGCTTCCTGGAGCAGGTGG + Intergenic
1006360746 6:33585753-33585775 GCGAGGCTTCCTGGACCTGGGGG - Intergenic
1006376868 6:33676582-33676604 GGAAGGCTTCCTGGAGGTGGTGG + Intronic
1006512334 6:34528465-34528487 GGAAGGCTTCCTGGAGGTGGTGG + Intronic
1006983708 6:38164461-38164483 GGGTGGCTACGGGGCGCTGGTGG + Intergenic
1018238067 6:161745290-161745312 GGCAGGCTTCCTGGAGGTGGTGG + Intronic
1018902909 6:168060179-168060201 GGGGGGCTTCCTGGAAGTGGGGG + Intronic
1019437573 7:1029904-1029926 TGGAGGCCTCCTGGAGCTGGTGG + Intronic
1020010630 7:4804012-4804034 GAGCGGCTCAGTGGGGCTGGAGG - Intronic
1020055911 7:5117447-5117469 GGGCCTCTTCGTGGCCCTGGGGG + Intergenic
1021188149 7:17589409-17589431 GGCAGGCTTCGTGGAGGTGGTGG + Intergenic
1022508137 7:30919341-30919363 GGAAGGCTTCTAGGAGCTGGTGG + Intronic
1023034202 7:36116534-36116556 GGAGGGCTTCTTGGAGGTGGTGG - Intergenic
1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1026836572 7:73643634-73643656 GGGCTGCTTGGTGGAACTGAAGG + Intergenic
1027187753 7:75982022-75982044 GGGAGGCGGCGTGGAGCTGCCGG - Intronic
1029123301 7:98282030-98282052 GGGGTCCTTCCTGGAGCTGGAGG + Intronic
1029180857 7:98700759-98700781 GGGAGGCTTCCTGGAGGAGGTGG - Intergenic
1029181568 7:98705603-98705625 GGGAGGCTTCCTGGAGGAGGTGG - Intergenic
1029401434 7:100349298-100349320 GGGCAGCTTCCTGAAGGTGGTGG + Intronic
1029701395 7:102248825-102248847 GGGCGGCGGCGCGGAGCTCGGGG - Exonic
1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029759277 7:102592294-102592316 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1032125347 7:129189092-129189114 GGGGGGCTCCGAGGAGCAGGCGG + Exonic
1033165548 7:139035918-139035940 GCGCGGCCACGTGGAGCTGTCGG - Exonic
1034491691 7:151396353-151396375 GGGTAGCTTCCTGGAGGTGGGGG - Intronic
1034654743 7:152720530-152720552 GGTGGGCTTGGGGGAGCTGGTGG - Intergenic
1035450846 7:158976065-158976087 GGGCAGCTTCGTAGAGCAGGAGG - Intergenic
1035952408 8:4037374-4037396 GGGCTGTTGCGTGGAGCTGATGG - Intronic
1035959062 8:4116734-4116756 GGGCGGCTACGTGGAGAGGCAGG + Intronic
1035996287 8:4551195-4551217 AGGAGGGTTGGTGGAGCTGGTGG - Intronic
1037813041 8:22097960-22097982 GGGCGTCGGCCTGGAGCTGGAGG - Intronic
1039428320 8:37505405-37505427 GAGCTGCTTCCTGGAGCAGGTGG - Intergenic
1039473783 8:37828924-37828946 GGGCGCCTTCCTGGGCCTGGGGG + Exonic
1040501397 8:48008427-48008449 GGGCGGCTGCGTCGGGCTGCAGG + Exonic
1045287134 8:100801582-100801604 GGGTGGCTTCTAGGAGCTGAAGG + Intergenic
1047038110 8:120962106-120962128 TGGTGGTTTCCTGGAGCTGGAGG - Intergenic
1047352312 8:124087951-124087973 GCTCAGCTTCCTGGAGCTGGGGG + Intronic
1048385159 8:133905236-133905258 GGGAGGCTGGGTGGAGGTGGAGG + Intergenic
1048479977 8:134780429-134780451 GGGAGGCTTCCTGCAGCAGGTGG - Intergenic
1049261587 8:141641859-141641881 AGGGGGCTTCCTGGAGGTGGGGG + Intergenic
1049398084 8:142411225-142411247 GGAAGGCTTCTTGGAGCAGGTGG - Intergenic
1049402923 8:142438513-142438535 GGGAGGCCACGTGGAGATGGAGG - Intergenic
1049988679 9:973266-973288 GGGCGGCTTCGGGGATCTCATGG + Intergenic
1053462601 9:38282176-38282198 GGGTGGCTTCGTGGGGCTGATGG - Intergenic
1053648606 9:40140713-40140735 GGGCTGCCTAGTGGAGCTGTGGG - Intergenic
1053757139 9:41323129-41323151 GGGCTGCCTAGTGGAGCTGTGGG + Intergenic
1054329588 9:63738658-63738680 GGGCTGCCTAGTGGAGCTGTGGG - Intergenic
1054535976 9:66235457-66235479 GGGCTGCCTAGTGGAGCTGTGGG + Intergenic
1060217073 9:121744838-121744860 GGGAGGCTTTGTGGAGGTGGTGG + Intronic
1061422015 9:130477741-130477763 GGGAGGCTTCCTGGAGGAGGTGG + Intronic
1061584104 9:131555140-131555162 GGGAGGCTCCCTGGAGGTGGGGG + Intergenic
1061750517 9:132773822-132773844 GGGAGGCTTCCTGGAGCAGGTGG + Intronic
1061999709 9:134209778-134209800 GGGCTGCCTTGTGGGGCTGGGGG + Intergenic
1062197553 9:135282660-135282682 GGGAGGCTTCCTGGAGGAGGTGG + Intergenic
1062321016 9:135990612-135990634 GAGCTGCTTCGTGGAGCAGACGG + Intergenic
1202796369 9_KI270719v1_random:124011-124033 GGGCGGCCTAGTGGAGCTGTGGG - Intergenic
1185471431 X:386407-386429 GGGCGCGTTCCTGGGGCTGGAGG + Exonic
1185754467 X:2642417-2642439 AGGCGGCCACGTGGAGATGGAGG - Intergenic
1186481956 X:9902790-9902812 GGGCGGCCCCCTGGAGCTGTGGG + Intronic
1188002138 X:24993270-24993292 GGTTGGCTTTGTGGTGCTGGTGG + Intronic
1190337337 X:49270265-49270287 GCGCGTCATGGTGGAGCTGGAGG + Exonic
1192167406 X:68834560-68834582 CGGGGGCTGGGTGGAGCTGGGGG + Intronic
1194379202 X:93174463-93174485 GGGCTGCACCATGGAGCTGGTGG + Intergenic
1199599353 X:149532751-149532773 GGGAGGCTTCGTAGAGGAGGGGG - Intronic
1200080244 X:153572679-153572701 TGGAGGCTGCCTGGAGCTGGGGG - Intronic